a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6 mtm6sf-shrna8 6 P=.3 3 P=.4 x -6 Hepatic TG (mg/g) 4 Hepatic CE (mg/g) Plasma TG (mg/dl) 5 5 P=3.6x -8 Plasma Cholesterol (mg/dl) 5 5 P=. Supplementary Fig. Short hairpin RNA-mediated knockdown of Tm6sf in mice. (a) AAV vector alone or AAV expressing a shrna directed against mtm6sf mrna were injected into the tail veins of 8 week old chow-fed C57Bl/6J male mice (n=5/group). After two weeks, the mice were killed and the liver, white adipose tissue (WAT) and small intestine were harvested. Levels of Tm6sf mrna were measured using Real-Time PCR and normalized to m36b4 levels. The differences in mean expression levels were compared using a two sample t-test. (b) AAV expressing 3 different shrnas or AAV vector alone were injected intravenously into 8-week old chow-fed C57BL/6J male mice (n=6/group). All three shrnas were directed against mouse Tm6sf, but only shrna8 knocked down the levels of Tm6sf mrna with high efficiency in cultured cells. Two weeks after the injection, mice were fasted for 4 h, the livers were harvested and the levels of TM6SF mrna were measured using Real-Time PCR. Values were normalized to m36b4, and expressed relative to the mean value of the AAV-only treated mice. Plasma was collected in the same experiment and TG and cholesterol levels measured as described in Methods. Differences in mean expression levels were compared using a two-sample T-tests. Ct, cycle threshold value. Nature Genetics: doi:.38/ng.9
Supplementary Table Characteristics of Dallas Heart Study participants stratified by TM6SF (E67K) genotype. Characteristic EE a EK KK P-value b Total n 4,5 43 3 - Female, n (%),389 (57.6) 5 (53.) 9 (69.).6 Ethnicity c, n (%) Non-Hispanic African-American,3 (53.) 6 (37.8) (5.4). - Non-Hispanic European-American,69 (8.) 74 (4.) (84.6) 3.9 - Hispanic 676 (6.3) 69 (6.3) ().35 Other 3 (.5) (4.7) ().9 Age, years (mean) 45 ± 44 ± 5 ±.73 Body-mass index, kg/m 9.6 (6-35) 8.5 (6-34) 3.8 (8-34).95 Diabetes d, n (%) 53 (.6) 37 (8.7) (6.7).4 Alcohol consumption e > g/day, n (%) 334 (8.) 48 (.4) (7.7).58 Lipid-lowering medication (statins), n (%) 359 (8.8) 33 (8.) ().7 HDL-cholesterol (mg/dl) 5.6 ± 4.9 49.9 ± 4. 5. ± 8.8.98 HOMA-IR (U) f 3. (-5).9 (-5) 4.6 (-8).5 Fasting glucose (mg/dl) g 9 (84-98) 9 (85-99) 94 (86-4).5 Gamma-glutamyl transpeptidate (IU/L) 3 (7-36) 4 (6-38) (-8).5 Bilirubin (mg/dl).5 (.4-.7).5 (.4-.7).6 (.5-.8).9 HTGC (%) h 3.5 (.9-6.7) 4.4 (.-9.9) 5.7 (8.8-8.4) 5.6-7 Values are median (interquartile range), mean ± s.d., or number (%). a Missense variant (E67K) in TM6SF. b P-values were calculated using linear regression for continuous variables (age, body-mass index, glucose, HOMA-IR) and logistic regression for categorical variables (gender, ethnicity, diabetes diagnosis, alcohol consumption, and use of lipid-lowering drugs). Regression models were adjusted for age, gender, ethnicity, and BMI (where appropriate). c Ethnicity was self-reported as described in the Methods. d Diabetes was defined as a self-reported diagnosis of diabetes, use of prescription medication, fasting glucose 6 mg/dl or nonfasting glucose mg/dl or HbAc 6.5%. e Alcohol consumption was self-reported. f HOMA-IR, homeostatic model assessment of insulin resistance was calculated as described in the Methods. g Diabetics excluded. h P-value after adjustment for HOMA-IR, alcohol consumption and covariates listed above. Nature Genetics: doi:.38/ng.9
Supplementary Table Conditional association analysis for variants in the chromosome 9 region including NCAN, TM6SF, SUGP, CILP, and PBX4 Locus SNP Median Hepatic TG % P P MAF SNP conditional on conditional P rs585496 by genotype Beta Unconditional rs585496 on SNP (%) NCAN rs863 (P9S) 3.7 3.5 3.9..76..79.3-5 NCAN rs5755 (V548L).64 3.6 3.3 -.33.57.5 5.5-8 NCAN rs46537 (S838N) 3.9 3.6.8 3. -.6.3.5 6.8-8 NCAN rs64395 9.7 3.7 3.5 3..7.5. 3. -8 TM6SF rs585496 (E67K) 5. 3.5 4.5 5.7.5 5.7-8 NA NA SUGP rs4969.4 3.6 3.6 3.3.35.4.6 7. -7 SUGP rs7756 (R9H) 7.9 3.5 3.9.4..4. 3.7-8 SUGP rs38388 (D4D).7 3.6 3.3 -.7.6.56 5.5-8 CILP, PBX4 rs699648.8 3.6 3.3 5..5.84.. -7 CILP, PBX4 rs7655 5.3 3.5 4. 8..73.5.4.6-5 Variants within kb of the coding sequences of NCAN, TM6SF, and SUGP genotyped using the ExomeChip array, with a minor allele frequency of >.5%, and other variants at the 9p3 locus reported in previous GWAS, are listed in the table. Genotypes were coded as,, and for wild-type homozygotes, heterozygotes, and variant allele homozygotes, respectively. Each SNP was tested for association with hepatic TG content using linear regression including ancestry, age, gender, and BMI as covariates. Conditional analysis was also adjusted tor TM6SF rs585496 genotype. NA, not applicable. Nature Genetics: doi:.38/ng.9
Supplementary Table 3 Association between TM6SF (E67K) and hepatic triglyceride content (HTGC), liver enzymes and plasma lipid levels in Dallas Heart Study participants stratified by TM6SF (E67K) genotype and (self-reported) ethnicity. Trait Ethnicity EE a EK KK P-value b HTGC (%) mean DHS 5.79 (.4) 8. (.6) 3. (.63) 5.7 x -8 Non-Hispanic African-American 4.78 (.7) 6.5 (.86).5 (-).58 Non-Hispanic European-American 5.86 (.5) 8.63 (.98) 5.4 (.3).7 x -6 Hispanic 8.35 (.4) 9.4 (.38) -.9 HTGC (%) median DHS 3.46 (-7) 4.49 (-) 5.7 (9-8) 5. x -5 Non-Hispanic African-American 3.5 (-5) 4.7 (-7).5 (-). Non-Hispanic European-American 3.5 (-7) 4.9 (-9) 6.87 (3-9).44 6 Hispanic 4.74 (3-) 6. (3-3) -.77 ALT (U) Non-Hispanic African-American ±. 3.3 ± 6.8 3. ± NA.78 Non-Hispanic European-American 3.7 ± 6.4 6. ± 8.5 3.4 ± 8.4.84 Hispanic 7.7 ± 5 3.7 ± 9.9 -.5 AST (U) Non-Hispanic African-American 4. ± 7.3 5.5 ± 7.7 8. ± NA.9 Non-Hispanic European-American 3.9 ± 7.4 4.4 ±. 7.3 ± 7.5.95 Hispanic 5.7 ± 33 6. ±.6 -.3 ALP (U) Non-Hispanic African-American 7.6 ± 9 7.4 ±.3 6. ± NA.63 Non-Hispanic European-American 66.6 ±.5 64.3 ±.4 63.4 ± 7.8.87 Hispanic 77. ± 6.3 7.3 ± 9. -. LDL (mg/dl) Non-Hispanic African-American 8. ± 37.7 ± 34.8 6. ± NA.33 Non-Hispanic European-American.8 ± 34.9 8.7 ± 33.9 96.3 ± 4.. Hispanic 8.7 ± 33. 4.8 ± 33.6 -. Triglyceride (mg/dl) Non-Hispanic African-American 7. ± 95. 96.9 ± 55. 67. ± NA.4 Non-Hispanic European-American 36. ± 98.4 6.3 ± 76.6 3. ± 68.6 Hispanic 49.6 ± 8.7 44.6 ± 6.8 -.46 HDL (mg/dl) Non-Hispanic African-American 5.6 ± 5 5 ± 3. 65. ± NA.85 Non-Hispanic European-American 49.7 ± 5.4 49.5 ± 5.3 5.6 ± 9..76 Hispanic 46.4 ±.5 46.9 ±.5 -.73 Nature Genetics: doi:.38/ng.9
Values are median (interquartile range, st 3 rd quartile) or mean (s.e.m) for HTGC, and mean ± s.d. for all other traits. P-values for comparison of means were calculated using linear regression adjusted for age, gender, BMI and ancestry. P-values for median HTGC were determined using the Jonckheere-Terpstra rank test for trend. Ethnicity was self-reported as described in the Methods. Supplementary Table 4 Characteristics of the Dallas BioBank participants stratified by TM6SF (E67K) genotype. Characteristic EE a EK KK P-value b Total n 7,46, 57 - Female, n (%),65 (3.5) 345 (3.) 8 (3.6).7 Age, years 53± 54± 54±.69 Body-mass index, kg/m 6. (4-9) 6. (4-9) 6. (4-9).7 Diabetes c, n (%) 73 (.3) 7 (.4) (3.5).6 Lipid-lowering medication (statins), n (%) 443 (6.) 7 (6.3) 6 (.5).37 Fasting glucose (mg/dl) d 9 (87-98) 93 (88-99) 9 (86-96).4 Bilirubin (mg/dl).56 (.4-.76).56 (.4-.74).54 (.39-.76).7 HDL-cholesterol (mg/dl) 57.±7. 57.8±6.7 56.3±9.3.4 Values are median (interquartile range), mean ± s.d., or number (%). a Missense variant (E67K) in TM6SF. b P-values were calculated using linear regression for continuous variables (age, body-mass index, glucose, HOMA-IR) and logistic regression for categorical variables (gender, ethnicity, diabetes diagnosis, alcohol consumption, and use of lipid-lowering drugs). Regression models were adjusted for age, gender, and BMI, where appropriate. c Diabetes was defined as a self-reported diagnosis of diabetes by a physician, use of prescription medication, fasting glucose 6 mg/dl or non-fasting glucose mg/dl or HbAc 6.5%. e Alcohol consumption was self-reported. d Diabetics excluded. Nature Genetics: doi:.38/ng.9
Supplementary Table 5 Baseline characteristics of participants in the Copenhagen General Population Study and the Copenhagen City Heart Study combined (The Copenhagen Study), stratified by TM6SF (E67K) genotype. Characteristics EE EK a KK P-value b Total n 6,79,7 553 - Age, years 58 (47-67) 58 (47-67) 56 (45-66). Female, n (%) 34,75 (56) 6,377 (55) 35 (57).7 Body mass index, kg/m 6 (3-8) 6 (3-8) 5 (3-8).4 Diabetes c 3,5 (5) 588 (5) 34 (6).4 Physical activity c 8,858 (48) 5,459 (47) 67 (49).6 Alcohol consumption c,874 (8),4 (8) 3 (9).3 Gamma-glutamyltransferase, U/L 8 (-4) 8 (-4) 8 (-4).6 Bilirubin, μmol/l (8-3) (8-3) (8-4).87 Lipid-lowering therapy c (statins), n (%) 5,693 (9),3 (9) 45 (8).3 HDL (mg/dl) 6. ± 9.7 6. ± 9.6 6.6 ± 9.4.67 Values are median (interquartile range), mean ± s.d., or number (%). a Missense variant (E67K) in TM6SF. b P-values were calculated using Kruskal-Wallis analysis of variance or Pearson s χ -test. c Diabetes, physical activity in leisure time, alcohol consumption, and lipid-lowering therapy were self-reported, dichotomized, and defined as diabetes (self-reported disease, use of insulin, use of anti-diabetic medication, and/or non-fasting plasma glucose >. mmol/l) versus no diabetes, physical activity (four hours or more per week of light physical activity in leisure time versus less than four hours), alcohol consumption (>4/ versus 4/ units per week in women/men; unit=g alcohol), and use of lipid-lowering drugs (yes/no), mainly statins (>97%). Nature Genetics: doi:.38/ng.9
Supplementary Table 6. Primers used for amplication using the polymerase chain reaction Sequence Amplified Forward Primer Reverse Primer TM6SF-rs585496 GCATGGCACCAGCAGGTA CCTGCACCATGGAAGGCAAATA Mouse TM6SF cdna 3 CCTCGGTGGTGGACCTTGT 4 TCCTTGGTGTAGAAATCCATGAAG Human TM6SF cdna 5 GGCTGCCTATGCTCTCACCTT 6 TGCCTCCAGCAAACACCAA Nature Genetics: doi:.38/ng.9