Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant cytoplasm and clefting around nests of melanocytes and between melanocytes (20x). (c) Towards the base of the melanoma, individual melanocytes are interspersed between collagen bundles and around small nerves (20x, arrow). (d) Whole genome copy number profile demonstrates losses on 6q and 22q, and gains on 7q, 12p and 18. (e) Copy number transitions are present within both fusion partners, with loss of the portion of the genes not participating in the fusions. (f) Integrative genomics viewer demonstrates fusion reads that map to the breakpoints on both genes. Unaligned bases (rainbow-colored) flank the breakpoints. (g) The exon structure of the predicted fusion transcript (top). RT-PCR and sequencing confirmed the sequence and expression of the fusion transcript (bottom).
Supplementary Figure 2. Atypical Spitz tumor with complex rearrangement resulting in TRIM4-MET fusion kinase. (a) Histopathology shows a broad compound melanocytic neoplasm (4x, top). Large nests of melanocytes are present within a fibrotic superficial dermis (4x, lower left). Some of the nests of melanocytes appear to contain myxoid stroma (20x, lower right). (b) Stacks of DNA sequencing reads viewed in Integrative Genomics Viewer with unaligned portions (rainbow colored) flanking one side of the fusion junctions on 7q22 (left panel) and MET intron 14 (right panel). Reads whose mate pair maps to the opposite side of the fusion junction are maroon. (c) Kinome RNASeq statistics (top). Expression of the TRIM4-MET transcript was confirmed by RT-PCR (bottom). (d) Copy number profile of the region of 7q that contains TRIM4 and MET. Gains of the 5 portion of TRIM4, the intergenic region on 7q22 and the 3 portion of MET are present with similar amplitudes.
Supplementary Figure 3. Aggregate array comparative genomic hybridization profiles of tumors. The top panel shows the aggregate copy number profile of tumors with gain of a distal portion of the long arm of chromosome 7 (n=74). The bottom panel shows the aggregate copy number profile of the remaining tumors in the cohort (n=1128).
Supplementary Figure 4. Atypical Spitz Tumor with DCTN1-MET fusion arising from reciprocal translocation. (a) Histopathology demonstrates large nests of spitzoid melanocytes within the epidermis and superficial dermis (left 4x, right 20x). (b) Whole genome acgh profile (top panel) demonstrates gains on chromosomes 2 and 7. Copy number aberrations are present near DCTN1 and MET, but no copy number transitions occur within either gene (bottom panel). (c) Reads spanning both reciprocal fusion junctions map to DCTN1. The unaligned portions (representing sequence from MET, rainbow-colored) flank the breakpoints. Blue reads have mate-pairs that map to MET on chromosome 7.
Supplementary Figure 5. Atypical Spitz tumor with EPS15-MET fusion and signs of chromothripsis. (a) Histopathology demonstrates a dome-shaped exophytic papule with a thinned epidermis (4x). The neoplastic melanocytes are arrayed in large nests and sheets with focal dense inflammation (left). The melanocytes are epithelioid with abundant eosinophilic cytoplasm (right). (b) Copy number profile demonstrates regions of gain on the short arm of chromosome 1 and the long arm of chromosome 7 (top). Copy number oscillation between two copy number states is present in these areas (bottom). (c) Four distinct fusion junctions are identified by DNA sequencing within MET. These fusion junctions are arranged in pairs that appear to arise from the same breakpoint (separated by less than 10 bp, involving opposite sides of the inferred breakpoint). The two breakpoints within MET are separated by 1240 bp. The four fusions within MET occur with 3 distinct regions on the short arm of chromosome
1. (d) The exon structure of the predicted fusion transcript (top). RT-PCR and sequencing confirmed the sequence and expression of the fusion transcript (bottom).
Supplementary Figure 6. Common Nevi have low levels of MET expression and undetectable p-met levels. The MET and p-met immunohistochemistry for 2 common nevi are presented.
Supplementary Figure 7. Expression of TRIM4-MET and ZKSCAN1-MET in 293FT cells activates MAP kinase pathway signaling in contrast to overexpression of wild-type MET. Expression of wild-type MET, TRIM4-MET and ZKSCAN1-MET results in bands at expected molecular weights in the MET blot. All three MET constructs lead to increased levels of p-met, but only the MET fusions result in a detectable increase of p-erk.
Supplementary Figure 8. Full Western blots from Figure 4a.
Supplementary Figure 9. Full Western blots from Figure 4b.
Supplementary Table 1. Clinical characteristics of the cohort. Average Age Median Age male female spitzoid Malignant Ambiguous Benign UCSF Array CGH Database (n=1202) 29 25 41 59 67 30 58 12 TCGA Melanoma Cases Analyzed by Stransky et al. (n=374) 56 57 61 39 NA 100 0 0 Supplementary Table 2. RT-PCR primers. Forward Primer Reverse Primer TRIM4-MET GCCAGATACCATTGATGAAGG CTCCATGTTTCATGTATGGTAGG ZKSCAN1-MET CTTCAAACATTCGTCTCGG CTCCATGTTTCATGTATGGTAGG DCTN1-MET CTTCAGGCATTGCTACTCTGG CTCCATGTTTCATGTATGGTAGG PPFIBP1-MET GTTTGCAAGATGAAAGGAGAAGG CTCCATGTTTCATGTATGGTAGG EPS15-MET TGGTGGAACAGTTGTTGC CTCCATGTTTCATGTATGGTAGG