Genomic structural variation

Size: px
Start display at page:

Download "Genomic structural variation"

Transcription

1 Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural variation has been discovered in the genome of all the studied species, which could have a much bigger biological impact than SNPs 1

2 Overview 1. Types of structural variants (SVs) 2. Methods for detecting SVs 3. Indels and CNVs 4. Inversions 5. Mechanisms of generation 6. Functional effects and examples What are structural variants Genomic alterations other than nucleotide substitutions that change the organization of the DNA molecule Traditionally detection limited by resolution of techniques and considered to be quite large Currently include changes at the base level, although typically are >1kb (no clear size limit) 2

3 Types of structural variants A B C D Reference A B C E D Insertion A B C Deletion CNVs A B C C C D Copy Number Variation A C B D Inversion and traslocations. Methods for detecting SVs New genomic techniques have changed the focus from large to small events and from locus-specific to global studies: Cytogenetic techniques (regular karyotyping, FISH, fiber FISH) Array comparative genomic hybridization (acgh) (BAC arrays, high-density oligo arrays) SNP array genotyping (Afymetrix, Illumina) Pair-end mapping (Sanger or next-generation sequencing) + Throughput + Resolution 3

4 Cytogenetic techniques Karyotyping FISH Chromosome painting Fiber FISH Array CGH Ratio of fluoresecence intensity of the test and the reference DNA indicates the differences in copy number for a particular location in the genome 4

5 Characteristics of acgh arrays BAC arrays High-density oligonucleotide arrays 1 BAC ( kb) per genomic region (Whole-genome tiling path) Good genomic coverage Low resolution (>20-50 kb) Variable oligo spacing (~2-10 kb on Agilent 244K or 1M arrays) Targeted or whole-genome approach Coverage depending on probe density High resolution ( kb) Pair-end mapping (PEM) method High-throughput way of detecting all kind of medium and large sized SVs from an individual: 1. Generation of DNA library of fragments of defined size from sample of interest 2. Sequencing of both ends of a large number of fragments 3. Mapping of both ends to reference genome and computational prediction of SVs 5

6 Pair-end mapping (PEM) methods PEM distribution Normally mapped PEM span > cutoff D Opposite end orientation PEM span < cutoff I Short-fragment PEM: Low coverage/high resolution (500 bp - 3 kb) Long-fragment PEM: High coverage/low resolution (10 kb 40 kb) SV detection methods comparison Feuk et al. Nature Reviews Genetics 7, (February 2006) doi: /nrg1767 6

7 Importance of structural variants Total entries: 89,427 CNVs: 57,829 Inversions: 850 InDels (100 bp - 1 kb): 30,748 Total CNV loci: 14,478 Articles cited: 38 (march 25, 2010) Segmental duplications Inversion breakpoints Copy number variants Timescale of CNVs study (Beckman et al., Nat. Rev. Genet. 2007) CNVs discovery is not that recent! 7

8 Initial large-scale CNV studies Analysis of 20 individuals using low density arrays 76 unique CNV regions of >100 kb ~11 CNVs differing between pair of individuals Analysis of 55 individuals using BAC arrays (1 Mb resolution) 224 unique CNV regions 12.4 CNVs differing between pair of individuals Global analysis of human CNVs CNV map by WGTP BAC arrays and Affymetrix arrays 270 individuals of European, African and Asian ancestry 1447 CNV regions covering 360 Mb (12% of the genome) Comprenhensive CNV map by tiling oligonucleotide arrays (42 million probes) 450 individuals of European, African and Asian ancestry CNVs assayed of >0.5 kb 8

9 Comprehensive human CNV map Overview of Experimental strategy for CNV discovery and genotyping (Conrad et al., Nature 2009) On average: 1098 validated CNVs differ between two individual genomes Detected CNVs ranged from 443 bp to 1.28 Mb (median size 2.9 kb) Validated CNVs cover a total of Mb (3.7% of the genome) Population distribution of CNVs CNV-based phylogenetic tree CNVs across 29 human populations 9

10 CNVs in other species CNVs in other species 10

11 Human polymorphic inversions Chrom. region Size Freq. Detection method Phenotypic effect Origin Reference Xq28 49 Kb 8-72% Southern unknown NAHR Small q Mb 5% FISH/PFGE Williams susceptibility? NAHR Osborne p Mb 15% FISH unknown NAHR? Giglio p Mb 9% FISH unknown NAHR? Giglio q Mb 4% FISH/PFGE unknown - Gimelli p Kb - Comp. map. unknown - Martin q Kb 17% PFGE/genot Increased fertility NAHR Stefansson p q Mb - Cloning unknown DSB? Gilling 2006 Insights from genomic studies 11

12 Insights from genomic studies New genomic techniques have uncovered an unprecedented degree of all types of structural variation, including inversions: Feuk et al., PLOS Genet. 2005: putative inversions between human and chimp genomes (23/27 exp. validated) - Three of those were polymorphic in 10 european individuals Levy et al., PLOS Biol. 2007: - 90 inversions identified by direct comparison of the C. Venter and the HG18 reference genome sequence assemblies Korbel et al., Science 2007: - ~3 kb fragments pair-end mapping in 2 individuals of european and african ancestry inversion brkpts. by genomic comparison with human ref. sequence Tuzun et al., Nat. Genet. 2005; Kidd et al., Nature 2008: - Fosmid pair-end mapping in 9 individuals of different geographic origins inversions validated by FISH, fingerprint analysis or breakpoint sequencing And...: - Several individual genome sequences, 1000 Genomes Project, etc. Current inversion data Total of 850 inversions in the Database of Genomic Variants (but many redundant!) Chromosomal distribution Size distribution Inversions CNVs Frequency of inversions Obs. Dist. Exp. Dist chr1 chr2 chr3 chr4 chr5 chr6 chr7 chr8 chr9 chr10 chr11 chr12 chr13 chr14 chr15 chr16 chr17 chr18 chr19 chr20 chr21 chr22 chrx chry 12

13 INVFEST project (INVersion Functional & Evolutionary Studies) Large-scale genomic information Latest data on human predicted inversions Traditional studies on inversions Functional and evolutionary impact of inversions Objectives and main questions Structural variation data 1 Catalogue of human inversions Human genome sequences HapMap data 2 Evolutionary history of inversions Effect on nucleotide variation 4 Other species genomes Functional annotation Functional consequences of inversions. 3 Gene-expression levels 13

14 Main scientific contributions Complete characterization of human inversions. Biological consequences of structural variants. Determine inversion genetic effects and adaptive value. Evaluate/Develop tools for study of inversions. Catalogue of human inversions Combination of predictions from different studies resulted in 364 independent inversions in humans (354 new): 49 Levy et al (90 indep. inv.) 56 6 (1) (1) 203 (3) Korbel et al (91 indep. inv.) Kidd et al (245 indep. inv.) (Martínez and Cáceres, unpub. data) 14

15 Inversions in other species Drosophila Inversions have been studied for more than 80 years and thousands of inversions have been described as fixed Or polymorphic differences Few inversions are known in other organisms: Mechanisms of generation of SVs SVs are typically generated during DNA break-induced repair, recombination or replication by different possible mechanisms: Non-allelic homologous recombination (NAHR) (duplications, deletions, inversions, translocations ) Non-homologous end joining (NHEJ) and microhomology mediated end joining (MMEJ) (deletions, inversions?) Transposition of transposable elements (insertions, deletions) Fork Stalling and Template Switching (FOsTEs) 15

16 Non-allelic homologous recombination Intra or interchomosomal recombination between copies of a sequence in different genomic positions: Non-homologous end joining Mechanism of repair of double-strand breaks that typically utilizes short homologous DNA sequences (microhomology) to guide repair: 16

17 SV breakpoints examples Inferred mechanisms of SVs Kidd et al., Nature 2008 (Fosmid PEM) Lam et al., Nature Biotech (different methods) 17

18 Biological relevance of SVs Currently identified structural variants comprise many more bases of the human genome than SNPs and could have a much bigger biological impact Functional effects of SVs Altered gene dosage and expression (CNVs) Disruption of gene or regulatory elements (insertion, deletions, inversions) Gene fusion (deletions, inversions) Change in the exon-intron structure (insertion, deletions, CNVs, inversions) Modification of gene regulatory regions (insertion, deletions, CNVs, inversions) Indirect effects though increased susceptibility of genomic rearrangements (CNVs, inversions) 18

19 Functional consequences of SVs Genomic location of SVs Distribution of SVs tends to be biased against genes and other functional elements Functional impact of CNVs by type, frequency and population (Conrad et al., Nature 2010) 19

20 Genomic location of SVs Distribution of breakpoints of 114 precisely located inversions Frequency of inversions % (76 inv.) 22.8% (26 inv.) 12 inversions (10.5%) (7 inv.) (5 inv.) Intergenic Intronic 1 mrna 2 mrna (Martínez and Cáceres, unpub. data) Functional categories enriched in CNVs 20

21 Functional categories enriched in CNVs Cell adhesion Sensory perception Synapse organization Synaptic transmission Nervous system development Defense response Immune response CNVs and complex diseases 21

22 Inversions and genomic disorders CNV example #1: CCL3L1 CCL3L1: chemokine (C-C motif) ligand 3-like 1 (González et al., Science. 2005) 22

23 CNV example #2: Amylase gene (Perry et al., Nat. Genet. 2007) Japanese ind. high starch (14 copies) Biaka ind. low starch (6 copies) Chimpanzee low starch (2 copies) Inversion example #1: Chr17q inversion (Stefansson et al., Nat. Genet. 2005) Inversion originated through NAHR between kb SD blocks Found mainly in Europan populations at ~20% frequency Possibly positively selected through increased fertility of carrier females 23

24 Inversion example #2: ChrX inversion FLNA EMD EMD FLNA 37.4 Kb (Small et al., Nat. Genet. 1997) Inversion example #2: ChrX inversion 24

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

CNV Detection and Interpretation in Genomic Data

CNV Detection and Interpretation in Genomic Data CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What

More information

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G. Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods

More information

Population Genetics of Structural Variation Speaker Dr. Don Conrad

Population Genetics of Structural Variation Speaker Dr. Don Conrad Population Genetics of Structural Variation Dr. Don Conrad Wellcome Trust Sanger Institute Cambridge, UK 1 Overview Ascertainment of CNVs What CNV data is available Humans, chimpanzee, macaque, Drosophila,

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

Agilent s Copy Number Variation (CNV) Portfolio

Agilent s Copy Number Variation (CNV) Portfolio Technical Overview Agilent s Copy Number Variation (CNV) Portfolio Abstract Copy Number Variation (CNV) is now recognized as a prevalent form of structural variation in the genome contributing to human

More information

Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns

Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns جواد کریمزاد حق PhD of Medical Genetics آزمايشگاه پاتوبيولوژي و ژنتيك پارسه

More information

CHROMOSOMAL MICROARRAY (CGH+SNP)

CHROMOSOMAL MICROARRAY (CGH+SNP) Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi

CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi 2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000

More information

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014 Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical

More information

Structural Variants and Susceptibility to Common Human Disorders Dr. Xavier Estivill

Structural Variants and Susceptibility to Common Human Disorders Dr. Xavier Estivill Structural Variants and Susceptibility Genetic Causes of Disease Lab Genes and Disease Program Center for Genomic Regulation (CRG) Barcelona 1 Complex genetic diseases Changes in prevalence (>10 fold)

More information

Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative

Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47

More information

Genome-Wide Analysis of Copy Number Variations in Normal Population Identified by SNP Arrays

Genome-Wide Analysis of Copy Number Variations in Normal Population Identified by SNP Arrays 54 The Open Biology Journal, 2009, 2, 54-65 Open Access Genome-Wide Analysis of Copy Number Variations in Normal Population Identified by SNP Arrays Jian Wang 1,2, Tsz-Kwong Man 1,3,4, Kwong Kwok Wong

More information

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

More information

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016 Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases

More information

and SNPs: Understanding Human Structural Variation in Disease. My

and SNPs: Understanding Human Structural Variation in Disease. My CNVs vs. SNPs: Understanding Human Structural Variation in Disease [0:00:00] Hello and welcome to today s Science/AAAS live webinar entitled, CNVs and SNPs: Understanding Human Structural Variation in

More information

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599

More information

Chapter 1 : Genetics 101

Chapter 1 : Genetics 101 Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: GAIN,

More information

DNA Copy Number Variation in Autism. A Senior Honors Thesis

DNA Copy Number Variation in Autism. A Senior Honors Thesis DNA Copy Number Variation in Autism A Senior Honors Thesis Presented in Partial Fulfillment for the Requirement for graduation with research distinction in Biology in the undergraduate colleges of Biological

More information

Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray

Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray OGT UGM Birmingham 08/09/2016 Dom McMullan Birmingham Women's NHS Trust WM chromosomal microarray (CMA) testing Population of ~6 million (10%)

More information

LTA Analysis of HapMap Genotype Data

LTA Analysis of HapMap Genotype Data LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap

More information

Science. Webinar Series. CNVs vs SNPs: 16 July, Participating Experts: Understanding Human Structural Variation in Disease

Science. Webinar Series. CNVs vs SNPs: 16 July, Participating Experts: Understanding Human Structural Variation in Disease Science Webinar Series CNVs vs SNPs: 16 July, 2008 Understanding Human Structural Variation in Disease Brought to you by the Science/AAAS Business Office Participating Experts: Charles Lee, Ph.D. Harvard

More information

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence

More information

Introduction. 8 These authors contributed equally to this work

Introduction. 8 These authors contributed equally to this work ARTICLE Complete Haplotype Sequence of the Human Immunoglobulin Heavy-Chain Variable, Diversity, and Joining Genes and Characterization of Allelic and Copy-Number Variation Corey T. Watson, 1,7 Karyn M.

More information

Supplementary Information. Supplementary Figures

Supplementary Information. Supplementary Figures Supplementary Information Supplementary Figures.8 57 essential gene density 2 1.5 LTR insert frequency diversity DEL.5 DUP.5 INV.5 TRA 1 2 3 4 5 1 2 3 4 1 2 Supplementary Figure 1. Locations and minor

More information

Introduction to Genetics

Introduction to Genetics Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist

More information

Chromosome Structure & Recombination

Chromosome Structure & Recombination Chromosome Structure & Recombination (CHAPTER 8- Brooker Text) April 4 & 9, 2007 BIO 184 Dr. Tom Peavy Genetic variation refers to differences between members of the same species or those of different

More information

Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016

Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics

More information

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data. Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype

More information

Understanding DNA Copy Number Data

Understanding DNA Copy Number Data Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php

More information

DETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING

DETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING DETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING DANIEL R. SCHRIDER * Department of Biology and School of Informatics and Computing, Indiana University, 1001 E Third

More information

Prenatal Diagnosis: Are There Microarrays in Your Future?

Prenatal Diagnosis: Are There Microarrays in Your Future? Financial Disclosure UCSF Antepartum Intrapartum Management Course June 8 I have no financial relationship with any aspect of private industry Prenatal Diagnosis: Are There Microarrays in Your Future?

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

More information

Determination of Genomic Imbalances by Genome-wide Screening Approaches

Determination of Genomic Imbalances by Genome-wide Screening Approaches Overview Determination of Genomic Imbalances by Genome-wide Screening Approaches Károly Szuhai Introduction/Methodologies Applications/Results Conclusion Approaches Introduction/Methodologies Chromosome

More information

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,

More information

Association for Molecular Pathology Promoting Clinical Practice, Basic Research, and Education in Molecular Pathology

Association for Molecular Pathology Promoting Clinical Practice, Basic Research, and Education in Molecular Pathology Association for Molecular Pathology Promoting Clinical Practice, Basic Research, and Education in Molecular Pathology 9650 Rockville Pike, Bethesda, Maryland 20814 Tel: 301-634-7939 Fax: 301-634-7990 Email:

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

Molecular and Clinical Characterization of Syndromes Associated With Intellectual Disability

Molecular and Clinical Characterization of Syndromes Associated With Intellectual Disability Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 880 Molecular and Clinical Characterization of Syndromes Associated With Intellectual Disability CHRISTIAN WENTZEL

More information

Gene copy-number polymorphism in nature

Gene copy-number polymorphism in nature Gene copy-number polymorphism in nature Daniel R. Schrider and Matthew W. Hahn Proc. R. Soc. B 2010 277, 3213-3221 first published online 30 June 2010 doi: 10.1098/rspb.2010.1180 Supplementary data References

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

Integrated detection and population-genetic analysis. of SNPs and copy number variation

Integrated detection and population-genetic analysis. of SNPs and copy number variation Integrated detection and population-genetic analysis of SNPs and copy number variation Steven A. McCarroll 1,2,*, Finny G. Kuruvilla 1,2,*, Joshua M. Korn 1,SimonCawley 3, James Nemesh 1, Alec Wysoker

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY

THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GENOME-WIDE MICROARRAY ANALYSIS IN A CASE-CONTROL STUDY REVEALS EVELATED LEVEL OF GLOBAL COPY

More information

6.3 DNA Mutations. SBI4U Ms. Ho-Lau

6.3 DNA Mutations. SBI4U Ms. Ho-Lau 6.3 DNA Mutations SBI4U Ms. Ho-Lau DNA Mutations Gene expression can be affected by errors that occur during DNA replication. Some errors are repaired, but others can become mutations (changes in the nucleotide

More information

Variations in Chromosome Structure & Function. Ch. 8

Variations in Chromosome Structure & Function. Ch. 8 Variations in Chromosome Structure & Function Ch. 8 1 INTRODUCTION! Genetic variation refers to differences between members of the same species or those of different species Allelic variations are due

More information

No mutations were identified.

No mutations were identified. Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11

More information

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing

More information

Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters

Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii

More information

Chromosome Abnormalities

Chromosome Abnormalities Chromosome Abnormalities Chromosomal abnormalities vs. molecular mutations Simply a matter of size Chromosomal abnormalities are big errors Two types of abnormalities 1. Constitutional problem present

More information

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant

More information

Identification of regions with common copy-number variations using SNP array

Identification of regions with common copy-number variations using SNP array Identification of regions with common copy-number variations using SNP array Agus Salim Epidemiology and Public Health National University of Singapore Copy Number Variation (CNV) Copy number alteration

More information

Sharan Goobie, MD, MSc, FRCPC

Sharan Goobie, MD, MSc, FRCPC Sharan Goobie, MD, MSc, FRCPC Chromosome testing in 2014 Presenter Disclosure: Sharan Goobie has no potential for conflict of interest with this presentation Objectives Review of standard genetic investigations

More information

Integrated detection and population-genetic analysis of SNPs and copy number variation

Integrated detection and population-genetic analysis of SNPs and copy number variation 8 Nature Publishing Group http://www.nature.com/naturegenetics Integrated detection and population-genetic analysis of SNPs and copy number variation Steven A McCarroll 4,, Finny G Kuruvilla 4,, Joshua

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

Integrated detection and population-genetic analysis of SNPs and copy number variation

Integrated detection and population-genetic analysis of SNPs and copy number variation Integrated detection and population-genetic analysis of SNPs and copy number variation Steven A McCarroll 4,, Finny G Kuruvilla 4,, Joshua M Korn 6, Simon Cawley 7, James Nemesh, Alec Wysoker, Michael

More information

Approach to Mental Retardation and Developmental Delay. SR Ghaffari MSc MD PhD

Approach to Mental Retardation and Developmental Delay. SR Ghaffari MSc MD PhD Approach to Mental Retardation and Developmental Delay SR Ghaffari MSc MD PhD Introduction Objectives Definition of MR and DD Classification Epidemiology (prevalence, recurrence risk, ) Etiology Importance

More information

Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping

Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping RESEARCH ARTICLE Open Access Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping Bujie Zhan 1, João Fadista 1, Bo Thomsen 1, Jakob Hedegaard 1,2, Frank

More information

Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs

Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Joris Vermeesch, Center for Human Genetics K.U.Leuven, Belgium ESHG June 11, 2010 When and

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Genomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy

Genomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Genomic complexity and arrays in CLL Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Clinical relevance of genomic complexity (GC) in CLL GC has been identified as a critical negative

More information

Illuminating the genetics of complex human diseases

Illuminating the genetics of complex human diseases Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.

More information

Associating Copy Number and SNP Variation with Human Disease. Autism Segmental duplication Neurobehavioral, includes social disability

Associating Copy Number and SNP Variation with Human Disease. Autism Segmental duplication Neurobehavioral, includes social disability Technical Note Associating Copy Number and SNP Variation with Human Disease Abstract The Genome-Wide Human SNP Array 6.0 is an affordable tool to examine the role of copy number variation in disease by

More information

Optimizing Copy Number Variation Analysis Using Genome-wide Short Sequence Oligonucleotide Arrays

Optimizing Copy Number Variation Analysis Using Genome-wide Short Sequence Oligonucleotide Arrays Optimizing Copy Number Variation Analysis Using Genome-wide Short Sequence Oligonucleotide Arrays The Harvard community has made this article openly available. Please share how this access benefits you.

More information

GENOMIC SCREENING AND CAUSES OF RARE DISORDERS

GENOMIC SCREENING AND CAUSES OF RARE DISORDERS From the Department of Molecular Medicine and Surgery Karolinska Institutet, Stockholm, Sweden GENOMIC SCREENING AND CAUSES OF RARE DISORDERS Malin Kvarnung Stockholm 2016 Cover: Alexander Calder, The

More information

Genome Structural Variation

Genome Structural Variation Genome Structural Variation Evan Eichler Howard Hughes Medical Institute University of Washington January 11 th, 2016, Genomics Workshop, Český Krumlov Genetic Variation Types Sequence Single base-pair

More information

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences

More information

The questions below refer to the following terms. Each term may be used once, more than once, or not at all.

The questions below refer to the following terms. Each term may be used once, more than once, or not at all. The questions below refer to the following terms. Each term may be used once, more than once, or not at all. a) telophase b) anaphase c) prometaphase d) metaphase e) prophase 1) DNA begins to coil and

More information

Cytogenetics Technologies, Companies & Markets

Cytogenetics Technologies, Companies & Markets Cytogenetics Technologies, Companies & Markets By Prof. K. K. Jain MD, FRACS, FFPM Jain PharmaBiotech Basel, Switzerland November 2018 A Jain PharmaBiotech Report A U T H O R ' S B I O G R A P H Y Professor

More information

Seven cases of intellectual disability analysed by genomewide SNP analysis. Rodney J. Scott

Seven cases of intellectual disability analysed by genomewide SNP analysis. Rodney J. Scott Seven cases of intellectual disability analysed by genomewide SNP analysis Rodney J. Scott Ability to interrogate Genomic Material ~1930 Crude analyses 2012 Highly precise analyses A (very) brief history

More information

An International System for Human Cytogenetic Nomenclature (2013)

An International System for Human Cytogenetic Nomenclature (2013) ISCN 2013 An International System for Human Cytogenetic Nomenclature (2013) Editors Lisa G. Shaffer Jean McGowan-Jordan Michael Schmid Recommendations of the International Standing Committee on Human Cytogenetic

More information

MYC Translocations In Multiple Myeloma Involve Recruitment Of Enhancer Elements Resulting In Over- Expression and Decreased Overall Survival

MYC Translocations In Multiple Myeloma Involve Recruitment Of Enhancer Elements Resulting In Over- Expression and Decreased Overall Survival in partnership with MYC Translocations In Multiple Myeloma Involve Recruitment Of Enhancer Elements Resulting In Over- Expression and Decreased Overall Survival Brian A Walker Centre for Myeloma Research,

More information

Clinical Interpretation of Cancer Genomes

Clinical Interpretation of Cancer Genomes IGENZ Ltd, Auckland, New Zealand Clinical Interpretation of Cancer Genomes Dr Amanda Dixon-McIver www.igenz.co.nz 1992 Slovenia and Croatia gain independence USA and Russia declare the Cold War over Steffi

More information

BIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE

BIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE !! www.clutchprep.com Chromosomal theory of inheritance: chromosomes are the carriers of genetic material. Independent Assortment alleles for different characters sort independently of each other during

More information

MRC-Holland MLPA. Description version 29;

MRC-Holland MLPA. Description version 29; SALSA MLPA KIT P003-B1 MLH1/MSH2 Lot 1209, 0109. As compared to the previous lots 0307 and 1006, one MLH1 probe (exon 19) and four MSH2 probes have been replaced. In addition, one extra MSH2 exon 1 probe,

More information

Mutational and selective effects on copy-number variants in the human genome

Mutational and selective effects on copy-number variants in the human genome Mutational and selective effects on copy-number variants in the human genome Gregory M Cooper, Deborah A Nickerson & Evan E Eichler Comprehensive descriptions of large insertion/deletion or segmental duplication

More information

Clinical Genomics. Ina E. Amarillo, PhD FACMGG

Clinical Genomics. Ina E. Amarillo, PhD FACMGG Clinical Genomics Ina E. Amarillo, PhD FACMGG Associate Medical Director, Cytogenetics Lab (CaTG), Lab and Genomic Medicine Assistant Professor, Pathology and Immunology Outline Clinical Genomics Testing

More information

What s the Human Genome Project Got to Do with Developmental Disabilities?

What s the Human Genome Project Got to Do with Developmental Disabilities? What s the Human Genome Project Got to Do with Developmental Disabilities? Disclosures Neither speaker has anything to disclose. Phase Two: Interpretation Officially started in October 1990 Goals of the

More information

Role of FISH in Hematological Cancers

Role of FISH in Hematological Cancers Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk

More information

0.1% variance attributed to scattered single base-pair changes SNPs

0.1% variance attributed to scattered single base-pair changes SNPs April 2003, human genome project completed: 99.9% of genome identical in all humans 0.1% variance attributed to scattered single base-pair changes SNPs It has been long recognized that variation in the

More information

BIOL2005 WORKSHEET 2008

BIOL2005 WORKSHEET 2008 BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your

More information

Genome Structural Variation

Genome Structural Variation Genome Structural Variation Evan Eichler Howard Hughes Medical Institute University of Washington January 18 th, 2013, Comparative Genomics, Český Krumlov Disclosure: EEE was a member of the Pacific Biosciences

More information

Introduction to Genetics and Genomics

Introduction to Genetics and Genomics 2016 Introduction to enetics and enomics 3. ssociation Studies ggibson.gt@gmail.com http://www.cig.gatech.edu Outline eneral overview of association studies Sample results hree steps to WS: primary scan,

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

Benefits and pitfalls of new genetic tests

Benefits and pitfalls of new genetic tests Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,

More information

22q11.2 DELETION SYNDROME. Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona)

22q11.2 DELETION SYNDROME. Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona) 22q11.2 DELETION SYNDROME Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona) Genomic disorders GENOMICS DISORDERS refers to those diseases

More information

Genetics and Genomics in Medicine Chapter 8 Questions

Genetics and Genomics in Medicine Chapter 8 Questions Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional

More information

Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination. May 4, 2010

Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination. May 4, 2010 Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination May 4, 2010 Examination Length = 3 hours Total Marks = 100 (7 questions) Total Pages = 8 (including cover sheet and 2 pages of prints)

More information