Genomic structural variation
|
|
- Amy Dickerson
- 5 years ago
- Views:
Transcription
1 Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural variation has been discovered in the genome of all the studied species, which could have a much bigger biological impact than SNPs 1
2 Overview 1. Types of structural variants (SVs) 2. Methods for detecting SVs 3. Indels and CNVs 4. Inversions 5. Mechanisms of generation 6. Functional effects and examples What are structural variants Genomic alterations other than nucleotide substitutions that change the organization of the DNA molecule Traditionally detection limited by resolution of techniques and considered to be quite large Currently include changes at the base level, although typically are >1kb (no clear size limit) 2
3 Types of structural variants A B C D Reference A B C E D Insertion A B C Deletion CNVs A B C C C D Copy Number Variation A C B D Inversion and traslocations. Methods for detecting SVs New genomic techniques have changed the focus from large to small events and from locus-specific to global studies: Cytogenetic techniques (regular karyotyping, FISH, fiber FISH) Array comparative genomic hybridization (acgh) (BAC arrays, high-density oligo arrays) SNP array genotyping (Afymetrix, Illumina) Pair-end mapping (Sanger or next-generation sequencing) + Throughput + Resolution 3
4 Cytogenetic techniques Karyotyping FISH Chromosome painting Fiber FISH Array CGH Ratio of fluoresecence intensity of the test and the reference DNA indicates the differences in copy number for a particular location in the genome 4
5 Characteristics of acgh arrays BAC arrays High-density oligonucleotide arrays 1 BAC ( kb) per genomic region (Whole-genome tiling path) Good genomic coverage Low resolution (>20-50 kb) Variable oligo spacing (~2-10 kb on Agilent 244K or 1M arrays) Targeted or whole-genome approach Coverage depending on probe density High resolution ( kb) Pair-end mapping (PEM) method High-throughput way of detecting all kind of medium and large sized SVs from an individual: 1. Generation of DNA library of fragments of defined size from sample of interest 2. Sequencing of both ends of a large number of fragments 3. Mapping of both ends to reference genome and computational prediction of SVs 5
6 Pair-end mapping (PEM) methods PEM distribution Normally mapped PEM span > cutoff D Opposite end orientation PEM span < cutoff I Short-fragment PEM: Low coverage/high resolution (500 bp - 3 kb) Long-fragment PEM: High coverage/low resolution (10 kb 40 kb) SV detection methods comparison Feuk et al. Nature Reviews Genetics 7, (February 2006) doi: /nrg1767 6
7 Importance of structural variants Total entries: 89,427 CNVs: 57,829 Inversions: 850 InDels (100 bp - 1 kb): 30,748 Total CNV loci: 14,478 Articles cited: 38 (march 25, 2010) Segmental duplications Inversion breakpoints Copy number variants Timescale of CNVs study (Beckman et al., Nat. Rev. Genet. 2007) CNVs discovery is not that recent! 7
8 Initial large-scale CNV studies Analysis of 20 individuals using low density arrays 76 unique CNV regions of >100 kb ~11 CNVs differing between pair of individuals Analysis of 55 individuals using BAC arrays (1 Mb resolution) 224 unique CNV regions 12.4 CNVs differing between pair of individuals Global analysis of human CNVs CNV map by WGTP BAC arrays and Affymetrix arrays 270 individuals of European, African and Asian ancestry 1447 CNV regions covering 360 Mb (12% of the genome) Comprenhensive CNV map by tiling oligonucleotide arrays (42 million probes) 450 individuals of European, African and Asian ancestry CNVs assayed of >0.5 kb 8
9 Comprehensive human CNV map Overview of Experimental strategy for CNV discovery and genotyping (Conrad et al., Nature 2009) On average: 1098 validated CNVs differ between two individual genomes Detected CNVs ranged from 443 bp to 1.28 Mb (median size 2.9 kb) Validated CNVs cover a total of Mb (3.7% of the genome) Population distribution of CNVs CNV-based phylogenetic tree CNVs across 29 human populations 9
10 CNVs in other species CNVs in other species 10
11 Human polymorphic inversions Chrom. region Size Freq. Detection method Phenotypic effect Origin Reference Xq28 49 Kb 8-72% Southern unknown NAHR Small q Mb 5% FISH/PFGE Williams susceptibility? NAHR Osborne p Mb 15% FISH unknown NAHR? Giglio p Mb 9% FISH unknown NAHR? Giglio q Mb 4% FISH/PFGE unknown - Gimelli p Kb - Comp. map. unknown - Martin q Kb 17% PFGE/genot Increased fertility NAHR Stefansson p q Mb - Cloning unknown DSB? Gilling 2006 Insights from genomic studies 11
12 Insights from genomic studies New genomic techniques have uncovered an unprecedented degree of all types of structural variation, including inversions: Feuk et al., PLOS Genet. 2005: putative inversions between human and chimp genomes (23/27 exp. validated) - Three of those were polymorphic in 10 european individuals Levy et al., PLOS Biol. 2007: - 90 inversions identified by direct comparison of the C. Venter and the HG18 reference genome sequence assemblies Korbel et al., Science 2007: - ~3 kb fragments pair-end mapping in 2 individuals of european and african ancestry inversion brkpts. by genomic comparison with human ref. sequence Tuzun et al., Nat. Genet. 2005; Kidd et al., Nature 2008: - Fosmid pair-end mapping in 9 individuals of different geographic origins inversions validated by FISH, fingerprint analysis or breakpoint sequencing And...: - Several individual genome sequences, 1000 Genomes Project, etc. Current inversion data Total of 850 inversions in the Database of Genomic Variants (but many redundant!) Chromosomal distribution Size distribution Inversions CNVs Frequency of inversions Obs. Dist. Exp. Dist chr1 chr2 chr3 chr4 chr5 chr6 chr7 chr8 chr9 chr10 chr11 chr12 chr13 chr14 chr15 chr16 chr17 chr18 chr19 chr20 chr21 chr22 chrx chry 12
13 INVFEST project (INVersion Functional & Evolutionary Studies) Large-scale genomic information Latest data on human predicted inversions Traditional studies on inversions Functional and evolutionary impact of inversions Objectives and main questions Structural variation data 1 Catalogue of human inversions Human genome sequences HapMap data 2 Evolutionary history of inversions Effect on nucleotide variation 4 Other species genomes Functional annotation Functional consequences of inversions. 3 Gene-expression levels 13
14 Main scientific contributions Complete characterization of human inversions. Biological consequences of structural variants. Determine inversion genetic effects and adaptive value. Evaluate/Develop tools for study of inversions. Catalogue of human inversions Combination of predictions from different studies resulted in 364 independent inversions in humans (354 new): 49 Levy et al (90 indep. inv.) 56 6 (1) (1) 203 (3) Korbel et al (91 indep. inv.) Kidd et al (245 indep. inv.) (Martínez and Cáceres, unpub. data) 14
15 Inversions in other species Drosophila Inversions have been studied for more than 80 years and thousands of inversions have been described as fixed Or polymorphic differences Few inversions are known in other organisms: Mechanisms of generation of SVs SVs are typically generated during DNA break-induced repair, recombination or replication by different possible mechanisms: Non-allelic homologous recombination (NAHR) (duplications, deletions, inversions, translocations ) Non-homologous end joining (NHEJ) and microhomology mediated end joining (MMEJ) (deletions, inversions?) Transposition of transposable elements (insertions, deletions) Fork Stalling and Template Switching (FOsTEs) 15
16 Non-allelic homologous recombination Intra or interchomosomal recombination between copies of a sequence in different genomic positions: Non-homologous end joining Mechanism of repair of double-strand breaks that typically utilizes short homologous DNA sequences (microhomology) to guide repair: 16
17 SV breakpoints examples Inferred mechanisms of SVs Kidd et al., Nature 2008 (Fosmid PEM) Lam et al., Nature Biotech (different methods) 17
18 Biological relevance of SVs Currently identified structural variants comprise many more bases of the human genome than SNPs and could have a much bigger biological impact Functional effects of SVs Altered gene dosage and expression (CNVs) Disruption of gene or regulatory elements (insertion, deletions, inversions) Gene fusion (deletions, inversions) Change in the exon-intron structure (insertion, deletions, CNVs, inversions) Modification of gene regulatory regions (insertion, deletions, CNVs, inversions) Indirect effects though increased susceptibility of genomic rearrangements (CNVs, inversions) 18
19 Functional consequences of SVs Genomic location of SVs Distribution of SVs tends to be biased against genes and other functional elements Functional impact of CNVs by type, frequency and population (Conrad et al., Nature 2010) 19
20 Genomic location of SVs Distribution of breakpoints of 114 precisely located inversions Frequency of inversions % (76 inv.) 22.8% (26 inv.) 12 inversions (10.5%) (7 inv.) (5 inv.) Intergenic Intronic 1 mrna 2 mrna (Martínez and Cáceres, unpub. data) Functional categories enriched in CNVs 20
21 Functional categories enriched in CNVs Cell adhesion Sensory perception Synapse organization Synaptic transmission Nervous system development Defense response Immune response CNVs and complex diseases 21
22 Inversions and genomic disorders CNV example #1: CCL3L1 CCL3L1: chemokine (C-C motif) ligand 3-like 1 (González et al., Science. 2005) 22
23 CNV example #2: Amylase gene (Perry et al., Nat. Genet. 2007) Japanese ind. high starch (14 copies) Biaka ind. low starch (6 copies) Chimpanzee low starch (2 copies) Inversion example #1: Chr17q inversion (Stefansson et al., Nat. Genet. 2005) Inversion originated through NAHR between kb SD blocks Found mainly in Europan populations at ~20% frequency Possibly positively selected through increased fertility of carrier females 23
24 Inversion example #2: ChrX inversion FLNA EMD EMD FLNA 37.4 Kb (Small et al., Nat. Genet. 1997) Inversion example #2: ChrX inversion 24
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationCNV Detection and Interpretation in Genomic Data
CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What
More informationCNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.
Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods
More informationPopulation Genetics of Structural Variation Speaker Dr. Don Conrad
Population Genetics of Structural Variation Dr. Don Conrad Wellcome Trust Sanger Institute Cambridge, UK 1 Overview Ascertainment of CNVs What CNV data is available Humans, chimpanzee, macaque, Drosophila,
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationAgilent s Copy Number Variation (CNV) Portfolio
Technical Overview Agilent s Copy Number Variation (CNV) Portfolio Abstract Copy Number Variation (CNV) is now recognized as a prevalent form of structural variation in the genome contributing to human
More informationApplications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns
Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns جواد کریمزاد حق PhD of Medical Genetics آزمايشگاه پاتوبيولوژي و ژنتيك پارسه
More informationCHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationCURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationStructural Variants and Susceptibility to Common Human Disorders Dr. Xavier Estivill
Structural Variants and Susceptibility Genetic Causes of Disease Lab Genes and Disease Program Center for Genomic Regulation (CRG) Barcelona 1 Complex genetic diseases Changes in prevalence (>10 fold)
More informationAssociation mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative
Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47
More informationGenome-Wide Analysis of Copy Number Variations in Normal Population Identified by SNP Arrays
54 The Open Biology Journal, 2009, 2, 54-65 Open Access Genome-Wide Analysis of Copy Number Variations in Normal Population Identified by SNP Arrays Jian Wang 1,2, Tsz-Kwong Man 1,3,4, Kwong Kwok Wong
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationand SNPs: Understanding Human Structural Variation in Disease. My
CNVs vs. SNPs: Understanding Human Structural Variation in Disease [0:00:00] Hello and welcome to today s Science/AAAS live webinar entitled, CNVs and SNPs: Understanding Human Structural Variation in
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
More informationChapter 1 : Genetics 101
Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: GAIN,
More informationDNA Copy Number Variation in Autism. A Senior Honors Thesis
DNA Copy Number Variation in Autism A Senior Honors Thesis Presented in Partial Fulfillment for the Requirement for graduation with research distinction in Biology in the undergraduate colleges of Biological
More informationImplementation of the DDD/ClinGen OGT (CytoSure v3) Microarray
Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray OGT UGM Birmingham 08/09/2016 Dom McMullan Birmingham Women's NHS Trust WM chromosomal microarray (CMA) testing Population of ~6 million (10%)
More informationLTA Analysis of HapMap Genotype Data
LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap
More informationScience. Webinar Series. CNVs vs SNPs: 16 July, Participating Experts: Understanding Human Structural Variation in Disease
Science Webinar Series CNVs vs SNPs: 16 July, 2008 Understanding Human Structural Variation in Disease Brought to you by the Science/AAAS Business Office Participating Experts: Charles Lee, Ph.D. Harvard
More informationDOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
More informationIntroduction. 8 These authors contributed equally to this work
ARTICLE Complete Haplotype Sequence of the Human Immunoglobulin Heavy-Chain Variable, Diversity, and Joining Genes and Characterization of Allelic and Copy-Number Variation Corey T. Watson, 1,7 Karyn M.
More informationSupplementary Information. Supplementary Figures
Supplementary Information Supplementary Figures.8 57 essential gene density 2 1.5 LTR insert frequency diversity DEL.5 DUP.5 INV.5 TRA 1 2 3 4 5 1 2 3 4 1 2 Supplementary Figure 1. Locations and minor
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationChromosome Structure & Recombination
Chromosome Structure & Recombination (CHAPTER 8- Brooker Text) April 4 & 9, 2007 BIO 184 Dr. Tom Peavy Genetic variation refers to differences between members of the same species or those of different
More informationMultiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016
Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics
More informationNature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
More informationUnderstanding DNA Copy Number Data
Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php
More informationDETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING
DETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING DANIEL R. SCHRIDER * Department of Biology and School of Informatics and Computing, Indiana University, 1001 E Third
More informationPrenatal Diagnosis: Are There Microarrays in Your Future?
Financial Disclosure UCSF Antepartum Intrapartum Management Course June 8 I have no financial relationship with any aspect of private industry Prenatal Diagnosis: Are There Microarrays in Your Future?
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationDetermination of Genomic Imbalances by Genome-wide Screening Approaches
Overview Determination of Genomic Imbalances by Genome-wide Screening Approaches Károly Szuhai Introduction/Methodologies Applications/Results Conclusion Approaches Introduction/Methodologies Chromosome
More informationChromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011
Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,
More informationAssociation for Molecular Pathology Promoting Clinical Practice, Basic Research, and Education in Molecular Pathology
Association for Molecular Pathology Promoting Clinical Practice, Basic Research, and Education in Molecular Pathology 9650 Rockville Pike, Bethesda, Maryland 20814 Tel: 301-634-7939 Fax: 301-634-7990 Email:
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationMolecular and Clinical Characterization of Syndromes Associated With Intellectual Disability
Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 880 Molecular and Clinical Characterization of Syndromes Associated With Intellectual Disability CHRISTIAN WENTZEL
More informationGene copy-number polymorphism in nature
Gene copy-number polymorphism in nature Daniel R. Schrider and Matthew W. Hahn Proc. R. Soc. B 2010 277, 3213-3221 first published online 30 June 2010 doi: 10.1098/rspb.2010.1180 Supplementary data References
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationIntegrated detection and population-genetic analysis. of SNPs and copy number variation
Integrated detection and population-genetic analysis of SNPs and copy number variation Steven A. McCarroll 1,2,*, Finny G. Kuruvilla 1,2,*, Joshua M. Korn 1,SimonCawley 3, James Nemesh 1, Alec Wysoker
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationTHE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY
THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GENOME-WIDE MICROARRAY ANALYSIS IN A CASE-CONTROL STUDY REVEALS EVELATED LEVEL OF GLOBAL COPY
More information6.3 DNA Mutations. SBI4U Ms. Ho-Lau
6.3 DNA Mutations SBI4U Ms. Ho-Lau DNA Mutations Gene expression can be affected by errors that occur during DNA replication. Some errors are repaired, but others can become mutations (changes in the nucleotide
More informationVariations in Chromosome Structure & Function. Ch. 8
Variations in Chromosome Structure & Function Ch. 8 1 INTRODUCTION! Genetic variation refers to differences between members of the same species or those of different species Allelic variations are due
More informationNo mutations were identified.
Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationNext Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii
More informationChromosome Abnormalities
Chromosome Abnormalities Chromosomal abnormalities vs. molecular mutations Simply a matter of size Chromosomal abnormalities are big errors Two types of abnormalities 1. Constitutional problem present
More informationSupplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant
More informationIdentification of regions with common copy-number variations using SNP array
Identification of regions with common copy-number variations using SNP array Agus Salim Epidemiology and Public Health National University of Singapore Copy Number Variation (CNV) Copy number alteration
More informationSharan Goobie, MD, MSc, FRCPC
Sharan Goobie, MD, MSc, FRCPC Chromosome testing in 2014 Presenter Disclosure: Sharan Goobie has no potential for conflict of interest with this presentation Objectives Review of standard genetic investigations
More informationIntegrated detection and population-genetic analysis of SNPs and copy number variation
8 Nature Publishing Group http://www.nature.com/naturegenetics Integrated detection and population-genetic analysis of SNPs and copy number variation Steven A McCarroll 4,, Finny G Kuruvilla 4,, Joshua
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationIntegrated detection and population-genetic analysis of SNPs and copy number variation
Integrated detection and population-genetic analysis of SNPs and copy number variation Steven A McCarroll 4,, Finny G Kuruvilla 4,, Joshua M Korn 6, Simon Cawley 7, James Nemesh, Alec Wysoker, Michael
More informationApproach to Mental Retardation and Developmental Delay. SR Ghaffari MSc MD PhD
Approach to Mental Retardation and Developmental Delay SR Ghaffari MSc MD PhD Introduction Objectives Definition of MR and DD Classification Epidemiology (prevalence, recurrence risk, ) Etiology Importance
More informationGlobal assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping
RESEARCH ARTICLE Open Access Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping Bujie Zhan 1, João Fadista 1, Bo Thomsen 1, Jakob Hedegaard 1,2, Frank
More informationPractical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs
Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Joris Vermeesch, Center for Human Genetics K.U.Leuven, Belgium ESHG June 11, 2010 When and
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationGenomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy
Genomic complexity and arrays in CLL Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Clinical relevance of genomic complexity (GC) in CLL GC has been identified as a critical negative
More informationIlluminating the genetics of complex human diseases
Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.
More informationAssociating Copy Number and SNP Variation with Human Disease. Autism Segmental duplication Neurobehavioral, includes social disability
Technical Note Associating Copy Number and SNP Variation with Human Disease Abstract The Genome-Wide Human SNP Array 6.0 is an affordable tool to examine the role of copy number variation in disease by
More informationOptimizing Copy Number Variation Analysis Using Genome-wide Short Sequence Oligonucleotide Arrays
Optimizing Copy Number Variation Analysis Using Genome-wide Short Sequence Oligonucleotide Arrays The Harvard community has made this article openly available. Please share how this access benefits you.
More informationGENOMIC SCREENING AND CAUSES OF RARE DISORDERS
From the Department of Molecular Medicine and Surgery Karolinska Institutet, Stockholm, Sweden GENOMIC SCREENING AND CAUSES OF RARE DISORDERS Malin Kvarnung Stockholm 2016 Cover: Alexander Calder, The
More informationGenome Structural Variation
Genome Structural Variation Evan Eichler Howard Hughes Medical Institute University of Washington January 11 th, 2016, Genomics Workshop, Český Krumlov Genetic Variation Types Sequence Single base-pair
More informationCRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
More informationThe questions below refer to the following terms. Each term may be used once, more than once, or not at all.
The questions below refer to the following terms. Each term may be used once, more than once, or not at all. a) telophase b) anaphase c) prometaphase d) metaphase e) prophase 1) DNA begins to coil and
More informationCytogenetics Technologies, Companies & Markets
Cytogenetics Technologies, Companies & Markets By Prof. K. K. Jain MD, FRACS, FFPM Jain PharmaBiotech Basel, Switzerland November 2018 A Jain PharmaBiotech Report A U T H O R ' S B I O G R A P H Y Professor
More informationSeven cases of intellectual disability analysed by genomewide SNP analysis. Rodney J. Scott
Seven cases of intellectual disability analysed by genomewide SNP analysis Rodney J. Scott Ability to interrogate Genomic Material ~1930 Crude analyses 2012 Highly precise analyses A (very) brief history
More informationAn International System for Human Cytogenetic Nomenclature (2013)
ISCN 2013 An International System for Human Cytogenetic Nomenclature (2013) Editors Lisa G. Shaffer Jean McGowan-Jordan Michael Schmid Recommendations of the International Standing Committee on Human Cytogenetic
More informationMYC Translocations In Multiple Myeloma Involve Recruitment Of Enhancer Elements Resulting In Over- Expression and Decreased Overall Survival
in partnership with MYC Translocations In Multiple Myeloma Involve Recruitment Of Enhancer Elements Resulting In Over- Expression and Decreased Overall Survival Brian A Walker Centre for Myeloma Research,
More informationClinical Interpretation of Cancer Genomes
IGENZ Ltd, Auckland, New Zealand Clinical Interpretation of Cancer Genomes Dr Amanda Dixon-McIver www.igenz.co.nz 1992 Slovenia and Croatia gain independence USA and Russia declare the Cold War over Steffi
More informationBIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE
!! www.clutchprep.com Chromosomal theory of inheritance: chromosomes are the carriers of genetic material. Independent Assortment alleles for different characters sort independently of each other during
More informationMRC-Holland MLPA. Description version 29;
SALSA MLPA KIT P003-B1 MLH1/MSH2 Lot 1209, 0109. As compared to the previous lots 0307 and 1006, one MLH1 probe (exon 19) and four MSH2 probes have been replaced. In addition, one extra MSH2 exon 1 probe,
More informationMutational and selective effects on copy-number variants in the human genome
Mutational and selective effects on copy-number variants in the human genome Gregory M Cooper, Deborah A Nickerson & Evan E Eichler Comprehensive descriptions of large insertion/deletion or segmental duplication
More informationClinical Genomics. Ina E. Amarillo, PhD FACMGG
Clinical Genomics Ina E. Amarillo, PhD FACMGG Associate Medical Director, Cytogenetics Lab (CaTG), Lab and Genomic Medicine Assistant Professor, Pathology and Immunology Outline Clinical Genomics Testing
More informationWhat s the Human Genome Project Got to Do with Developmental Disabilities?
What s the Human Genome Project Got to Do with Developmental Disabilities? Disclosures Neither speaker has anything to disclose. Phase Two: Interpretation Officially started in October 1990 Goals of the
More informationRole of FISH in Hematological Cancers
Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk
More information0.1% variance attributed to scattered single base-pair changes SNPs
April 2003, human genome project completed: 99.9% of genome identical in all humans 0.1% variance attributed to scattered single base-pair changes SNPs It has been long recognized that variation in the
More informationBIOL2005 WORKSHEET 2008
BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your
More informationGenome Structural Variation
Genome Structural Variation Evan Eichler Howard Hughes Medical Institute University of Washington January 18 th, 2013, Comparative Genomics, Český Krumlov Disclosure: EEE was a member of the Pacific Biosciences
More informationIntroduction to Genetics and Genomics
2016 Introduction to enetics and enomics 3. ssociation Studies ggibson.gt@gmail.com http://www.cig.gatech.edu Outline eneral overview of association studies Sample results hree steps to WS: primary scan,
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationBenefits and pitfalls of new genetic tests
Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,
More information22q11.2 DELETION SYNDROME. Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona)
22q11.2 DELETION SYNDROME Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona) Genomic disorders GENOMICS DISORDERS refers to those diseases
More informationGenetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
More informationCanadian College of Medical Geneticists (CCMG) Cytogenetics Examination. May 4, 2010
Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination May 4, 2010 Examination Length = 3 hours Total Marks = 100 (7 questions) Total Pages = 8 (including cover sheet and 2 pages of prints)
More information