prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein. Top: Schematic of the red flourescent protein minigene containing a single intron (prfp) used for the exogenous delivery of mirnas (mir-93 or mir- 124). Bottom: Fluorescence-microscopy of prfp-transfected HEK293 cells.
A. B. microrna mir-16 mir-17 mir-19 mir-25 mir-34 mir-92 mir-93 Mammalian 10% 10% 4.9% 5.5% 4.0% 6.5% 6.6% Avian 0.2% 2.5% 0.01% nd nd 0.01% nd Human Murine Dcr -/- Canine 1 2 3 4 mir-93 U6 C. D. 293 A549 Jurkat U373 DC Let-7a mir-155 mir-16 mir-93 mir-181 mir-21 tubulin GENEPAINT Set ID: EH2524 Gene: Mcm7/miR-93 Accession number: NM_008568 Entrez Gene ID: 17220 RNA probe: 2458 Orientation: Antisense Hybridization Temp.: 64.0 Washing Temp.: 62.0 Stage: E14.5 Strain: C57BL/6 Sectioning Plane: sagittal Resolution: 1.6 µm/pixel 1 2 3 4 5 Supplementary Fig. 2. Identification of species-specific mirnas. (A) In silico analysis of species-specific mirnas generated from massively parallel sequencing data of Gallus gallus, Homo sapiens, and Mus musculus. nd denotes not detected. Percentages represent the number of specific reads over number of total reads. (B) Northern blot for mir-93 from human lung (A549), murine lung (primary cells), Dicer (Dcr) knockout fibroblasts, and canine (MDCK) cells. Probes for mir-93 and U6 snrna loading control are depicted. (C) In situ hybridization profiling of MCM7/miR-93 transcripts in embryonic mice, as obtained from Genpaint (http://www.genepaint.org). (D) RT-PCR of human mirna-containing transcripts. Unstimulated total cellular RNA derived from human embryonic kidney (293), lung epithelial (A549), T lymphocyte (jurkat), and astrocyte (U373) cell lines as well as primary dendritic cells (DC). mirna expression determined by PCR amplification. Tubulin used as RNA loading control.
Nucleocapsid Site 1 Site 2 ACAAUAGAGAGAAUGGUGCUCUCU UUUCUGGCACGGUCUGCACUCAUA Consensus base % Consensus a.a. T62 Consensus base % Consensus a.a. U 98.9% F258 A 99.3% A 99.9% I63 C 39.0% U 89.8% G 95.2% L259** E64 A 99.7% A260 G 88.1% A 98.7% R65* C 34.9% G 36.2% R261*** M66 U 99.4% T262 G 92.5% V67 A 99.7% A263 C 99.8% L68 C 40.7% C 31.1% L264 **** U 99.8% S69 A 99.6% A 99.5% I265 * Arginine 65 also encoded as a lysine (AAA) in H3N2 strains **Leucine 259 is encoded by UUG in H3N2 *** Arginine 261 encoded by AGA in H3N2 strains ****Leucine 264 encoded by UUA in H3N2 strains Supplementary Fig. 3. Influenza A virus Nucleoprotein conservation. Sequence alignment of nucleotide and amino acid composition for sites one and two of 931/2. Consensus sequences derived from sequenced H1N1, H3N2, and H5N1 as recorded by Biohealthbase.org (n=3005).
WT Fibroblasts Dicer -/- Fibroblasts A/PR/8/34 A/PR/8/34 931 931 0 12 24 48 0 12 24 48 1 2 3 4 5 6 7 8 Supplementary Fig. 4. In Vitro infections with MRE-seeded 931 H1N1 virus. Western blot of influenza A/PR/8/34 931 infection in wild type (WT) and Dicer -/- murine fibroblasts at times indicated. Immunoblots depict and protein levels.
931/2 0 24 48 72 96 24 48 72 96 hpi 1 2 3 4 5 6 7 8 9 3000 1200 2500 1000 / (RNA) 2000 1500 1000 500 800 600 400 200 / (protein) 0 0 24 48 72 96 24 48 72 96 931/2 0 Supplementary Fig. 5. in vivo mir-93-mediated translational repression of MRE-seeded. Western blot analysis of Balb/c mice intranasally inoculated with 10e3 PFU of influenza A/PR/8/34 and 931/2 viruses at indicated times. Immunoblots of and are shown. Left axis: RNA levels determined by quantitative RT-PCR, standardized to, and represented as copy number; error bars represent +/- SD. Right axis: quantification of protein levels by densitometry; levels standardized to and represented in arbitrary units.
A. PBS 932 931/2 B. 931/2 (+) CTRL WT (-) CTRL IRF7 IFNβ Heart Protein RNA IL6 HPRT IRF1 STAT1 ISG54 Spleen Brain 931/2 (+) CTRL WT (-) CTRL 931/2 (+) CTRL WT (-) CTRL 1 2 3 4 C. ex vivo in vivo Site 1 Site 2 932 Passage 0 UUCCUUGCACGGACAGCACUUUUA 932 Passage 1 UUCCUUGCACGGACAGCACUUUUA 932 Passage 10 UUCCUUGCACGGACAGCACUUUUA 931/2 Passage 0 ACACUUGAACGAAUGGUACUUUCU UUCCUUGCACGGACAGCACUUUUA 931/2 Passage 1 ACACUUGAACGAAUGGUACUUUCU UUCCUUGCACGGACAGCACUUUUA 931/2 Passage 10 ACACUUGAACGAAUGGUACUUUCU UUCCUUGCACGGACAGCACUUUUA 932 Day 5 UUCCUUGCACGGACAGCACUUUUA 931/2 Day 5 ACACUUGAACGAAUGGUACUUUCU UUCCUUGCACGGACAGCACUUUUA 932 931/2 932 1 1 1 10 10 10 931/2 Passage No. Tubulin 1 2 3 4 5 6 Supplementary Fig. 6. in vivo characterization of MRE-attenuated influenza A virus infections. (A) RNA and whole cell extract from primary lung. (Top panels) RT-PCR analysis of infected lung 5dpi. Viruses include, 932, and 931/2. Primers specific for Interferon Regulatory Factor 7 (IRF7), Interferon beta (IFNβ), Interleukin 6 (IL6), and Hypoxanthine-guanine phosphoribosyltransferase (HPRT) are shown. (Bottom panels) Western blot of murine infections as described above depicting IRF1, STAT1, Interferon Stimulated Gene 54 (ISG54), and protein levels. (B) Western blot analysis from heart, brain, and spleen tissue from mice infected with 10e3 WT, 932, or 931/2 and sacrificed 10 days post infection. Blots depict and protein levels. (+) and (-) controls (CTRL) are infected and uninfected lung tissue respectively harvested 5 days post infection (C) Representative sequences of influenza A virus clones isolated following ten passages in vitro or five days post infection in vivo.
A. WT Fibroblasts 932 931/2 0 12 24 48 12 24 48 12 24 48 hpi -/- Dicer Fibroblasts 932 931/2 0 12 24 48 12 24 48 12 24 48 hpi M M 11 12 13 14 15 16 17 18 19 20 B. in vitro in vivo 12 hpi 24 hpi 5 dpi 5 dpi WT WT WT WT M C. 1 2 3 4 5 Anti-miR-93 Scrambled 932 931/2 932 931/2 6 D. 7 8 9 10 932 931/2 0 12 24 0 12 24 0 12 24 11 hpi 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 9 Supplementary Fig. 7. Characterization of mirna-mediated attenuation (Full length blots). Nature Biotechnology: Experiments as doi:10.1038/nbt.1542 performed in figures 2 and 3, illustrating non-cropped, full-sized autoradioragrams