Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of TRIM33 bound to β-catenin was determined using an immunoblot with an anti-β-catenin antibody. c, FLAG-TRIM33 was co-expressed with the C- terminal domain of β-catenin-myc in 293T cells. The cells were subjected to immunoprecipitation with an anti-flag antibody followed by immunoblotting with anti-myc antibodies. d, FLAG-TRIM33 was co-expressed with β-catenin-myc in HEK 293T cells. The cells were subjected to immunoprecipitation with an anti-flag antibody and the immunoprecipitates (IPs) were then treated with or without lambda ( ) phosphatase for 30 min at 30 C and washed four times. 1
2
Supplementary Figure 2.TRIM33 reduces nuclear β-catenin protein abundance. a, Western blot of nuclear β-catenin in control-sirna or TRIM33-siRNA U87/EGFRvIII cells as indicated. b, Expression levels of TRIM33 in SW480 and DLD-1 cells were analysed by immunoblot analyses. Lamin B and tubulin served as loading controls and cell fraction markers. c, IF assays showing that TRIM33 decreased the level of native β-catenin. SW480 cells were transiently transfected with FLAG-tagged TRIM33, and 48 h after transfection the cells were subjected to immunofluorescence analysis with anti-β-catenin and anti-flag antibody, which was followed by FITC-conjugated anti-mouse antibody and rhodamine anti-rabbit antibody, respectively. The nuclei were visualized with DAPI. Scale bars: 20 μm. d, β-catenin gene expression was detected by qrt-pcr in control-shrna or TRIM33-shRNA U87 cells as indicated. Values are mean ± SD for triplicate samples from a representative experiment. Significance was determined by Student s t-test. e, Depletion of TRIM33 stabilized the β-catenin levels in HEK 293T cells. IB was performed with nuclear lysates of HEK 293T cells treated with 100 ng of Wnt3a ligand at the indicated times. f, Cellular levels of Cyclin D1 and Axin2 in DLD-1 cells depleted of endogenous TRIM33 were analysed by immunoblot analyses. Columns #1 and #2 indicate two different shrnas targeting TRIM33. g, Expression of Cyclin D1 or Axin2 mrna was determined by qrt-pcr from control-shrna or TRIM33-shRNA U87 cells. Values are mean ± SD for triplicate samples from a representative experiment. Significance was determined by Student s t-test. h, TRIM33 reduces the cytosolic and nuclear β-catenin protein abundance in SW480 cells. Cells were transfected with an empty vector or FLAG-tagged TRIM33 expression vector and cell fractions were prepared. Lamin B, tubulin, and Na-K-ATPase served as loading controls and cell fraction markers. 3
Supplementary Figure 3.Cytosolic TRIM33 is deficient in degrading β-catenin. a, HEK 293T cells were transfected by FLAG-TRIM33 or NES-FLAG-TRIM33. The N-terminal fusion NES- FLAG-TRIM33 was generated using 5'- TTTGGATCCACCATGGAGTTGCCGCCGCTGGAGAGGCTGACGCTGGACTACAAAGA CGATGACGACAAG-3' and 5'-TTTGCGGCCGCTTACTCATCTGACTTTAGG-3' and then cloning the fragment into a pcdna3.1 vector using BamHI/NotI. Cells were then immunostained with anti-flag antibody (red) or DAPI (blue). Scale bars: 20 μm. b, U87 cells transfected with the indicated plasmids were transfected with TOP-FLASH or FOP-FLASH, which was followed 4
by Wnt3a treatment for 4 h. Each error bar indicates the variation between the means of 3 independent experiments. c, Cytosolic TRIM33 is deficient in degrading β-catenin. U87/EGFRvIII cells were transfected with FLAG-tagged TRIM33 or NES-FLAG-tagged TRIM33 as indicated and the cell fractions were prepared. Lamin B and tubulin served as loading controls and cell fraction markers. d, U87/EGFRvIII cells with or without TRIM33 or NES-TRIM33 overexpression were intracranially injected into athymic nude mice. After 2 weeks, the mice were sacrificed and tumour growth was examined. Top panel, H&E-stained coronal brain sections show representative tumour xenografts. Bottom panel, quantification of tumour volume based on H&E staining. Data represent results of 5 mice per group of two independent experiments. Error bars ± SD. Significance was determined by Mann Whitney U- test. e, Wnt-3a stimulation induces β-catenin Ser715 phosphorylation in the nucleus but not in the cytosol. IB was performed with U87 cells in the absence or presence of Wnt3a. Lamin B and tubulin served as loading controls and cell fraction markers. 5
Supplementary Figure 4.Endogenous β-trcp suppression did not affect TRIM33-induced degradation or ubiquitination of nuclear β-catenin in U87 cells. a, U87 cells with or without TRIM33 depletion were transfected with sirnas targeting β-trcp. Cell lysates were collected at 48 h post-transfection and subjected to immunoblot analyses using the indicated antibodies. b, U87 cells with or without TRIM33 depletion were transfected with sirnas targeting β-trcp and indicated plasmids. Experiments were performed as described for Fig. 4a. c, U87 cells transfected with or without β-trcp were transfected with TOP-FLASH or FOP-FLASH, which was followed by EGF treatment for 10 h. Each error bar indicates the variation between the 6
means of 3 independent experiments. d, U87 cells with or without TRIM33 depletion were transfected as indicated. Experiments were performed as described for Fig. 4a. 7
Supplementary Figure 5. β-trcp degraded β-catenin in Wnt-off phase and TRIM33 targeted degradation of β-catenin in Wnt-on phase. a & b, Control, shtrim33, or siβ-trcp U87 cells were incubated in medium containing 35 S-Met for 1 h; the medium was replaced with complete medium and collected at the indicated time points with Wnt-3a (Wnt-on; a) or DKK1 (Wnt-off; b) treatment. Cell fractions were prepared and β-catenin was immunoprecipitated, subjected to SDS-PAGE, detected on an autoradiograph and the label intensity was quantified. c & d, U87 cells with or without TRIM33 depletion were transfected with sirnas targeting β-trcp or 8
control sirna. Cells were treated for 8 h with 100 ng/ml Wnt-3a (Wnt-on) or with 100 ng/ml DKK1 (Wnt-off). Experiments were performed as described for Fig. 4a. 9
Supplementary Figure 6. The turnover rate of β-catenin S715A did not change regardless of TRIM33 overexpression. HEK 293T cells were transfected with the indicated mutants. Cells were incubated with cyclohexamide (CHX) for the indicated times, collected, and analysed by IB as indicated. Right panel, the amount of β-catenin (WT or mutant) is represented relative to the amount at time 0. 10
Supplementary Figure 7. PKC is the upstream component of TRIM33-induced β-catenin degradation. a, U87 cells with or without TRIM33 depletion were transfected with sirnas targeting PKC and indicated plasmids. Experiments were performed as described for Fig. 4a. b, Depletion of PKC stabilized the β-catenin levels in HEK 293T cells. IB was performed with nuclear lysates of HEK 293T cells treated with 100 ng/ml of Wnt3a ligand at indicated times. c, Detection of β-catenin Ser715 phosphorylation in WT β-catenin but not β-catenin S715 mutant. HEK 293T cells were transfected with indicated plasmids cells with Wnt3a treatment for 8 h. The cells were subjected to immunoprecipitation with an anti-myc antibody followed by immunoblotting with indicated antibodies. 11
Supplementary Figure 8. Level of TRIM33 inversely correlates with β-catenin expression. a, Brain tumours produced by U87 cells with or without depleted TRIM33 and shβ-catenin in nude mice were processed and sectioned for immunostaining with specific antibodies against TRIM33 and active β-catenin. Scale bars: 200 μm. b, Quantification of TRIM33 and active β- catenin IHC based on the staining intensity. c, IHC staining with anti-trim33 and anti-β-catenin Ser715 phosphorylation antibodies was carried out on 40 human GBM specimens. Photographs 12
of two representative tumours are shown. Scale bars: 200 μm. d, Semi-quantitative scoring was carried out (r= 0.556, P<0.001, Pearson correlation coefficient) with all 40 specimens. Note that some of the dots on the graphs represent more than one specimen (i.e., some scores overlapped). 13
14
15
16
17
Supplementary Figure 9. Full scans of Western blots. 18