Neocortex Zbtb20 / NFIA / Sox9

Similar documents
SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURES

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplementary Figure 1

supplementary information

Control of CNS Cell-Fate Decisions by SHP-2 and Its Dysregulation in Noonan Syndrome

Supplementary information. Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic

Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Supplemental information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

SUPPLEMENTARY FIGURES AND TABLE

Supplementary Information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Sirt1 Hmg20b Gm (0.17) 24 (17.3) 877 (857)

SUPPLEMENTARY FIGURE LEGENDS

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Prss56, a novel marker of adult neurogenesis in the mouse brain. - Supplemental Figures 1 to 5- Brain Structure and Function

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Primary Mouse Cerebral Cortex Neurons V: 80% TE: 70%

Supplementary Information

SUPPLEMENTARY INFORMATION

Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated

SUPPLEMENTARY INFORMATION

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons

Supplementary Table 1. List of primers used in this study

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

SUPPLEMENTARY INFORMATION

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!

SUPPLEMENTARY INFORMATION

Supplementary Fig. 1 Blocking shh function at the protein level confirms its role as a guidance cue for postcommissural axons.

effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Supplementary Figure 1

Ophthalmology, Radiation Oncology,

Address: Department of Biomedical Genetics, University of Rochester Medical Center, 601 Elmwood Avenue, Rochester, NY 14642, USA.

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Metformin Activates an Atypical PKC-CBP Pathway to Promote Neurogenesis and Enhance Spatial Memory Formation

Supplementary Figure 1. Chimeric analysis of inner ears. (A-H) Chimeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears.

Supplementary Information

SUPPLEMENTARY FIGURES

Supplementary Information and Figure legends

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.

Supplementary Figure 1. mir124 does not change neuron morphology and synaptic

OSVZ progenitors of human and ferret neocortex are epithelial-like and

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

SUPPLEMENTARY INFORMATION

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Visualization of embryonic neural stem cells using Hes promoters in transgenic mice

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.

Supplementary Figures

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

In vivo reprogramming reactive glia into ipscs to produce new neurons in the

Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols

Supplementary Information

A new subtype of progenitor cell in the mouse embryonic neocortex. Xiaoqun Wang, Jin-Wu Tsai, Bridget LaMonica & Arnold R.

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin

Nature Neuroscience: doi: /nn Supplementary Figure 1. Splenic atrophy and leucopenia caused by T3 SCI.

Supplementary Materials for

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY INFORMATION

Cord blood monocytes as a source of cell therapy products for treatment of brain injuries ISCT/CBA 2015 Cord Blood Workshop Wednesday, May 27, 2015

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Fragile X Mental Retardation Protein Regulates Proliferation and Differentiation of Adult Neural Stem/ Progenitor Cells

TISSUE-SPECIFIC STEM CELLS

SUPPLEMENTARY LEGENDS...

Nature Medicine: doi: /nm.4322

Supplementary Figure S1

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

supplementary information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURES

Supplementary Materials for

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

Zhu et al, page 1. Supplementary Figures

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

TISSUE-SPECIFIC STEM CELLS

Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.

Transcription:

Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive cells. Scale ars, 5 and 25 μm in the main panel and higher magnification images, respectively. 5 μm

Forerain Higher-magnification Forerain Higher-magnification / S1β Sep Sep / FoxJ1 Sep Sep c GFP / FoxJ1 / Hoechst Sep GFP / FoxJ1 / Hoechst Sep Supplementary Figure 2. Expression of in ependymal cells. (a) Coexpression of and either S1β or FoxJ1 in the and adult forerain. Right panels of each pair are higher magnification views of the oxed areas. (, c) Expression plasmids for GFP alone (control) or for oth GFP and were injected into the lateral ventricle of the E15.5 mouse forerain in utero and were introduced into the dorsolateral region of the neocortex () and the medial dorsoventral oundary of rains (c) y electroporation. The rain was isolated at and sujected to immunostaining for FoxJ1 and GFP., lateral ventricle; Sep, septum. Arrowheads indicate doule-positive cells (a, c). Scale ars, 5 μm (a, c), 1 μm (), and 25 μm (higher magnification images in a).

Neocortex Neocortex / HuC/D P3 / NeuN a / NeuN / NeuN Supplementary Figure 3. Transient expression of in NeuN+ neurons and HuC/D+ immature neurons. (a) Coexpression of and NeuN in the P3,, and adult neocortex. () Coexpression of and HuC/D in the neocortex. Arrowheads indicate doule-positive cells. Scale ars, 5 μm.

GFP / Sox9 GFP / GFAP GFP / TuJ1 8 6 4 2 TuJ1 GFAP O4 Sox9 c d e GFP / EdU GFP / cl-casp3 EdU + cells among GFP + cells (%) 4 3 2 1 NS cl-casp3 + cells among GFP + cells (%) 2. 1.5 1..5. NS Supplementary Figure 4. Effects of on the proliferation, survival, and differentiation of NPCs in vitro. (a, ) NPCs derived from E16.5 mouse forerain were infected with retroviruses encoding GFP alone (control) or oth GFP and. Two days after infection, the cells were induced to differentiate for 6 days and then stained for TuJ1, GFAP, O4, Sox9, and GFP (a). Arrows indicate marker + /GFP + cells. The percentages of marker + cells among total GFP + cells were determined as means ± s.d. (n = 3) (). (c e) E16.5 NPCs infected with control or retroviruses were laeled with EdU for 2 h in the presence of FGF2 and EGF. The cells were stained for EdU and cleaved caspase 3 (cl-casp3) 1 day after plating (c). Arrows indicate EdU + /GFP + cells or cleaved caspase 3 + /GFP + cells. The percentages of EdU + (d) or cleaved caspase 3 + (e) cells among GFP + cells were determined as means ± s.d. (n = 3). P <.1 versus the corresponding control value; NS, non-significant; P =.45 (d) and.53 (e) versus corresponding control value. Scale ars, 5 μm.

GFP / TuJ1 / GFAP GFP / GalC / TuJ1 GFP / GalC / GFAP NA NO AO 1 8 6 4 2 N NA A c 1 8 6 4 2 N NO O d 1 8 6 4 2 A AO O e Cell numer / clone 14 12 1 8 6 4 2 NS f 1 (sh-luc) sh- #1 g 1 (sh-luc) sh- #1 h 1 (sh-luc) sh- #1 i 14 8 6 4 2 N NA A NS 8 6 4 2 N NS NO O 8 6 4 2 A AO O Cell numer / clone 12 1 8 6 4 2 NS sh- (sh-luc) #1 Supplementary Figure 5. Clonal analysis of -overexpressing and knockdown cells. (a i) The control, -overexpressing or knockdown cells were plated at a clonal density and cultured with FGF2 for 3 days and without FGF2 for 4 days. The percentages of neuron clones (N) which contain TuJ1 + cells and do not contain GFAP + cells, neuron and astrocyte clones (NA) which contain oth TuJ1 + cells and GFAP + cells, or astrocyte clones (A) which contain GFAP + cells and do not contain TuJ1 + cells among total clones were quantified (, f). The percentages of neuron clones (N) which contain TuJ1 + cells and do not contain GalC + cells, neuron and oligodendrocyte clones (NO) which contain oth TuJ1 + cells and GalC + cells, or oligodendrocyte clones (O) which contain GalC + cells and do not contain TuJ1 + cells among total clones were quantified (c, g). The percentages of astrocyte clones (A) which contain GFAP + cells and do not contain GalC + cells, astrocyte and oligodendrocyte clones (AO) which contain oth GFAP + cells and GalC + cells, or oligodendrocyte clones (O) which contain GalC + cells and do not contain GFAP + cells among total clones were quantified (d, h). The cell numer per clone was also determined (e, i). Data are means ± s.d. (n = 3). P <.1, P <.5 versus corresponding control value; NS, non-significant; P =.92 (e),.19 (f),.15 (g) and.75 (i) versus corresponding control value. Scale ar, 5 μm.

VZ/SVZ GFP / Hoechst VZ/SVZ Forerain E18.5 GFP / Hoechst VZ/SVZ Supplementary Figure 6. The distriution pattern of -overexpressing cells around the VZ/SVZ and in the neocortex. (a, ) Expression plasmids for GFP alone (control) or for oth GFP and were injected into the lateral ventricle of E15.5 mouse forerain in utero and were introduced into the dorsolateral region of the neocortex y electroporation. The rains were isolated at (a) or E18.5 () and sujected to immunostaining for GFP., lateral ventricle; SVZ, suventricular zone; VZ, ventricular zone. Scale ars, 75 μm (a) and 1 μm ().

1 8 6 4 2 TuJ1 # E11.5 NPC culture GFAP + sh-sox9 #1 # O4 1 8 6 4 2 TuJ1 # E11.5 NPC culture GFAP + sh-nfia #1 # O4 # Supplementary Figure 7. Effects of knockdown of Sox9 or NFIA on the promotion of astrocyte differentiation y. (a, ) E11.5 NPCs were infected with control,, or plus either sh-sox9 #1 (a) or sh-nfia #1 () retroviruses, cultured without FGF2 and EGF for 6 days, and sujected to immunostaining for TuJ1, GFAP, O4, and GFP. The percentages of marker + cells among total GFP + cells were determined as means ± s.d. (n = 3). P <.1 versus corresponding control value; #P <.1 versus value for alone.

1 8 6 4 2 TuJ1 GFAP NICD CNTF NICD + CNTF NICD + sh- #1 NICD + CNTF + sh- #1 Supplementary Figure 8. Effect of knockdown on astrocyte differentiation induced y NICD and CNTF. E16.5 NPCs were infected with control, NICD, or NICD plus sh- #1 retroviruses, cultured without or with CNTF for 6 days, and then stained for TuJ1, GFAP, and GFP for determination of the percentages of marker + cells among total GFP + cells (means ± s.d., n = 3). P <.1 versus corresponding control value.

4. E11.5 NPC culture GFAP promoter-luc Luciferase activity (fold) 3. 2. 1..1.3.5.7.7 STAT3-C (μg) Supplementary Figure 9. Effect of on the activity of the Gfap promoter. Luciferase reporter assay of relative Gfap promoter activity in NPCs transfected with the indicated amounts of expression plasmids for or STAT3-C (positive control). Data are means ± s.d. (n = 3). P <.1 versus corresponding control.

Astrocytic genes Aldh1L1 Aldoc CNTFR FGFR3 GFAP GLAST GLT-1 gp13 NFIA NFIX S1β Sox9 STAT1 STAT3 Fold change (/).95.85 1.5 1. 1.29.94 1..87.82.98 1.55.87.97.98 Downregulated neuronal genes Brn2 (Pou3f2) Brn4 (Pou3f4) NFIB Sox4 Sox11 Fold change (/).56.78.72.7.64 Supplementary Figure 1. Microarray analysis of -overexpressing NPCs. (a, ) E11.5 NPCs were infected with control or viruses. The virus-infected NPCs were isolated 3 days after infection and sujected to microarray analysis. Fold changes in the expression level of the indicated astrocytic (a) and neuronal () genes in -overexpressing NPCs relative to control are shown.

FLAG- FLAG- NFIA Sox9 NFIA IP: FLAG- Sox9 IP: FLAG- FLAG- FLAG- NFIA WCL Sox9 WCL FLAG- FLAG- Supplementary Figure 11. interacts with NFIA. (a, ) 293T cells were transfected with plasmids for FLAG-tagged, Sox9, or NFIA, as indicated. The cell lysates were sujected to co-immunoprecipitation and western lot analysis. IP, immunoprecipitation; WCL, whole cell lysate.

Ventral forerain Hippocampus Spinal cord GM Spinal cord WM / Aldh1L1 P14 CA1 P14 P14 P14 Ventral forerain Hippocampus Spinal cord GM Spinal cord WM CA1 / GFAP c Ventral forerain Hippocampus Spinal cord GM Spinal cord WM CA1 / S1β Supplementary Figure 12. Expression of in the CNS regions other than neocortex. (a) Doule staining for and Aldh1L1-GFP in the P14 ventral forerain, hippocampus, and spinal cord. (, c) Doule staining for and either GFAP () or S1β (c) in the adult ventral forerain, hippocampus, and spinal cord. CA1, hippocampal CA1 sector; GM, gray matter; WM, white matter. Arrowheads indicate doule-positive cells. Scale ars, 5 μm.

E11.5 NPC culture E11.5 NPC culture GFP / GalC GFP / GFAP GFP / TuJ1 8 6 4 2 TuJ1 GFAP GalC Supplementary Figure 13. Effects of on the differentiation of spinal cord NPCs in vitro. (a, ) NPCs derived from E11.5 mouse spinal cord were infected with retroviruses encoding GFP alone (control) or oth GFP and. Two days after infection, the cells were induced to differentiate for 6 days and then stained for TuJ1, GFAP, GalC, and GFP (a). Arrows indicate marker + /GFP + cells. The percentages of marker + cells among total GFP + cells were determined as means ± s.d. (n = 3) (). P <.1 versus the corresponding control value. Scale ar, 5 μm.

E11.5 NPC culture 1.2 c Sox1 mrna / GAPDH mrna 1..8.6.4.2 GFP / Sox1 Sox1 + cells among GFP + cells (%) 15 1 5 d. Forerain Higher-magnification e Day 1 Day 2 GFP / Sox1 / Hoechst f Fold enrichment 6 5 4 3 2 P3 SVZ E11.5 NPC culture, mouse IgG, TY1 A TY1-, mouse IgG TY1-, TY1 A Sox1 + cells among GFP + cells (%) 15 1 5 1-639 ~ -6259-2183 ~ -2133-523 ~ -473-231 ~ -181 Sox1 gene region (p) -11 ~ +43 +32 ~ +37 Supplementary Figure 14. suppresses oligodendrocyte differentiation. (a) Quantitative RT-PCR analysis of relative Sox1 mrna aundance in -overexpressing and control NPCs. Data are means ± s.d. (n = 3). (, c) E16.5 NPCs were infected with retroviruses encoding GFP alone (control) or oth GFP and. Two days after infection, the cells were induced to differentiate for 1 or 2 days and then stained for Sox1 and GFP (). The percentages of Sox1 + cells among total GFP + cells were determined as means ± s.d. (n = 3) (c). (d, e) Expression plasmids for GFP alone (control) or for oth GFP and were injected into the lateral ventricle of the E15.5 mouse forerain in utero and were introduced into the lateral dorsoventral oundary of rains y electroporation. The rain was isolated at P3 and sujected to immunostaining for Sox1 and GFP (d). The percentages of Sox1 + cells among total GFP + cells were determined as means ± s.d. (n = 1) (e). (f) ChIP analysis of inding to the Sox1 gene region in NPCs. Six different regions of the Sox1 locus were tested in control cells and cells expressing TY1-tagged. Data are expressed as fold enrichment relative to the corresponding value for control cells and normal mouse immunogloulin G (IgG). Data are means ± s.d. (n = 3). SVZ, suventricular zone; p, ase pair; A, antiody. The oxed region in d is shown at higher magnification in the right-most panel. Arrows indicate Sox1 + /GFP + cells (, d). Scale ars, 5 μm (d) and 25 μm ( and higher magnification image in d). P <.1 versus the corresponding control value.

Forerain / Sox1 / Olig2 Neocortex / Ki67 / Olig2 P3 P3 CC SVZ Supplementary Figure 15. + /Olig2 + cells are astrocyte precursors in the developing neocortex. (a) + /Olig2 + /Sox1 cells (arrowheads) and /Olig2 + /Sox1 + cells (arrows) in the P3 neocortex. () + /Olig2 + /Ki67 + cells (arrowheads) and /Olig2 + /Ki67 + cells (arrows) in the P3 neocortex. CC, corpus callosum;, lateral ventricle; SVZ, suventricular zone. The lower panels are higher magnification views of the oxed areas. Scale ars, 5 μm or 25 μm (higher magnification images).

8 Zt16 mrna / GAPDH mrna 2 16 12 8 4 Zt16 6 4 2 TuJ1 GFAP O4 sh- #1 Zt16 sh- #1 + Zt16 Nestin ## c d 8 Zt45 mrna / GAPDH mrna 1 8 6 4 2 Zt45 6 4 2 TuJ1 GFAP sh- #1 Zt45 sh- #1 + Zt45 O4 Supplementary Figure 16. Zt16 and Zt45 fail to rescue the knockdown phenotypes in NPC cultures. (a, c) E16.5 NPCs were infected with retroviruses encoding GFP alone (control) or GFP plus either Zt16 (a) or Zt45 (c). The expression level of Zt16 (a) or Zt45 (c) mrna was determined y quantitative RT-PCR analysis. Data are expressed relative to the control value and are means ± s.d. (n = 3). (, d) E16.5 NPCs were infected with retroviruses for control, sh- #1, Zt16, or sh- #1 plus Zt16 (), or for control, sh- #1, Zt45, or sh- #1 plus Zt45 (d). The cells were induced to differentiate for 6 days, after which the cells were immunostained for TuJ1, GFAP, O4, nestin, and GFP. The percentages of marker + cells among total GFP + cells were quantified as means ± s.d. (n = 3). P <.1, P <.5 versus corresponding control value; ##P <.5 versus value for sh- #1 alone.