Cord blood monocytes as a source of cell therapy products for treatment of brain injuries ISCT/CBA 2015 Cord Blood Workshop Wednesday, May 27, 2015
|
|
|
- Sheena Shaw
- 6 years ago
- Views:
Transcription
1 Cord blood monocytes as a source of cell therapy products for treatment of brain injuries ISCT/CBA 2015 Cord Blood Workshop Wednesday, May 27, 2015 Andrew E. Balber, PhD Senior Scientific Advisor CT 2, Duke University Translational Medicine Institute
2 Two potential CB monocyte derived products to treat acquired brain injury CB CD14+ cells Protect and/or effect repair of brain neurons tissue subjected to hypoxic/ischemic damage OGD model: Early effects of HI injury Treatment time may be critical Manufactured by selection, but not manipulated DUOC-01 Potentiates remyelination of damaged CNS neurons Removed from initial insult Cuprizone model: Repair of established injury Manufactured by cultivation for 3 weeks
3 More details J. Kurtzberg et al, Cytotherapy 17, DUOC-01 5:30PM Friday, May 29 ISCT poster session Saha, A. et al Poster #189 DUOC-01 Storms, R.A. et al Poster #191 DUOC-01 Patel, S. et al Poster #195 CB CD14+
4 Hypoxic/Ischemic injury model: Brain slice cultures deprived of oxygen & glucose (OGD) 11 days 45 minutes of OGD Assess impact of OGD/cells on brain tissue structure 3 days Restore to normal conditions +/- cell therapy population
5 OGD kills brain neurons & activates astrocytes 72h Control- No OGD 72-hr post OGD Patel, S. et al, ISCT Poster #195. GFAP, NeuN, Iba1
6 OGD kills brain neurons Average # cells /hpf Control 72h post-ogd
7 CB-MNC protect brain slices from OGD No OGD OGD OGD + CB MNC PI = cell death DAPI = nuclei
8 % Dead cells compared to OGD Identification of CB populations that protect brain neurons from OGD in slice cultures Slice cultures exposed to OGD added CB cells +PB MNC -CD3 -CD14 -CD19 MNC CB MNC are neuroprotective PB MNC are not neuroprotective Protective activity of CB MNCs is in CD14+ monocytes
9 Effects of CB CD14+ monocytes on OGD in brain slice cultures 72h Control- No OGD 72-hr post OGD 72h post OGD CB CD14 (+) Patel, S. et al, ISCT Poster #195. GFAP, NeuN, Iba1
10 CB CD14+ monocytes protect neurons from OGD
11 Hypoxic/Ischemic injury model: Brain slice cultures deprived of oxygen & glucose (OGD) 11 days 45 minutes of OGD Assess impact of OGD/cells on brain tissue structure 3 days Restore to normal conditions +/- cell therapy population
12 Cell death as % of OGD control Neuroprotective effect of CB cells OGD is largely mediated by soluble factors no cell normoxic control no cell OGD control OGD -direct MNC OGD -indirect MNC Activity can be concentrated from CD14+ monocyte supernatants
13 What neuroprotective mediators? Whole genome expression analysis of active CB population vs inactive PB CD14+ populations CANDIDATE EFFECTOR MOLECULES Test for importance in protection from OGD model
14 Gene expression analysis of CB and PB CD14+ monocytes p< fold difference
15 Expression of candidate effector genes by CD14+ CB and PB cells Fold expression increase CB/PB Experiment CTH THBS1 INHBA MMP9 IL10 CHI3L1 GAPDH Q-PCR confirmation of microarray data.
16 Western blot analysis of candidate effector molecules CB MMP9 CD14+ PB CB CD14- PB TSP1 CTH IL10 GAPDH CHI3L1 GAPDH CB PB CB PB INHBA GAPDH
17 CB monocytes as potential early intervention for HI injury Account for most of neuroprotective activity of CB MNCs in the OGD model Are more neuroprotective than PB monocytes Secrete soluble neuroprotective factors Express many different transcripts than PB monocytes Identifying mediators appears tractable Suitable for rapid translation to clinic [Panel]
18 DUOC Background Kurtzberg, J. et al (2015) Cytotherapy, 17: Manufactured by culturing cryopreserved CB unit for 21 days Express CD45, M1, and M2 macrophage markers Secrete IL-10, IL-6 and TGF-beta Actively phagocytic Change morphology reversibly, resembling macrophage/microglia Cultures contain many proliferating cells Actively promote myelination of damaged CNS nerves Saha, A. et al, ISCT Poster # 189.
19 Reversible demyelination of corpus callosum of NSG mice following feeding: Protocol Milled chow 0.2% CPZ Remove CPZ Harvest brain tissues Demyelination Repair WEEK DUOC-01 or Ringer s into CC region 1 day after switch
20 Normal chow + 0.2% Cuprizone DUOC-01 treatment accelerates myelination after cuprizone treatment: Luxol fast blue Normal chow Ringer s DUOC-01 Myelination score ** p < 3.25 x 10E X 400X
21 DUOC-01 Ringers DUOC-01 treatment accelerates formation of myelinated nerve fibers after cuprizone treatment MBP and NFH i iii MBP Normal control Cuprizone treated ii Ringer s Control CZ iv vi Ringers DUOC-1 cells v CZ/DUOC-01 CZ/Ringer s DUOC-01
22 Electron microscopic analysis of remyelination status one week after DUOC-01 treatment Ringers DUOC-01 Blue arrows indicate un-myelinated axons. Red arrow-heads indicate mitochondria. Scale bar =1.0 micrometer
23 DUOC-01 treatment reverses cuprizone induced changes in axonal myelination Ringer s DUOC-01 Higher proportion of myelinated axons More turns per axon Higher g ratio Reverses giant mitochondrial formation One week after cell treatment. Magnification= 35000x.
24 % area covered by Iba1 % area covered by GFAP DUOC-1 Ringers control DUOC-01 treatment reduces astrogliosis and microglial infiltration Cellularity score R D R D Iba1(blue), GFAP (pink), MBP(green), CC region, 40x
25 DUOC-01 Ringer s DUOC-01 promotes oligodendrocyte lineage cell proliferation Olig2 Ki67 Merge 100 p Olig2+ cells/hpf Ringer s (left) DUOC-01 (right) 15 p Olig2+ Ki67+cells/HPF Ringer s (left) DUOC-01 (right)
26 DUOC-01 repairs LPC demyelinated mouse cerebellar axons in vitro NFSMi312 MAP2 MBP MBP Control LPC treated LPC, then DUOC
27 On-going studies CD14+ CB monocytes are not active in CPZ model DUOC-01 is not active in the OGD model
28 DUOC-01 arises from CD14+ cord blood cells CD14+ MNC CD34+ CD14- CD14 + selected DUOC-01 Products made from CB MNC & CD14+ monocytes differ (p<0.05, 2- fold) in only 22 genes on expression analysis CD14 depleted
29 DUOC-01 and CB CD14+ monocytes differ in gene expression >2-fold p<0.05
30 Potential mechanisms of DUOC-01 action Clean up Cytokine secretion: Modulate inflammation [IL10, IL6, TGF-beta] Drive oligodendrocyte development & myelination Gene name Fold change Mean ±SEM P-value PDGF-α 32.3± IGF-1 799± SCF ± MMP9 632± MMP ± TREM2 1634± Fold increase DUOC-01 relative to CB CD14+ by RTqPCR. N>3
31 Understanding monocyte biology to make cellular therapeutics Adult PB CD14 + cells Not active in OGD? Birth?? Post natal life DUOC-01 Not active in OGD model Active in Cz model Manufacturing CB CD14 + cells Active in OGD model Not active in Cz model
32 CT2 Specialized Cell Team Arjun Saha Sachit Patel Susan Buntz Paula Scotland Li Xu Robert Storms Marcia Bentz Aruni Gunaratne Joanne Kurtzberg Robertson Foundation Marcus Foundation Tracy Gentry Pamela Noeldner Benjamin Rusche April Ozamiz CCBB staff Neil Medvitz Zhengzheng Wei Mike Cook Glenn Matsushima
33 THANK YOU
M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination
Supplemental Information Title: M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination Authors: Veronique E. Miron, Amanda Boyd, Jing-Wei Zhao, Tracy J. Yuen, Julia M.
SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
Supplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
TITLE: Harnessing GPR17 Biology for Treating Demyelinating Disease
AD Award Number: W81XWH-10-1-0723 TITLE: Harnessing GPR17 Biology for Treating Demyelinating Disease PRINCIPAL INVESTIGATOR: Qing Lu, Ph.D. CONTRACTING ORGANIZATION: University of Texas Southwestern Medical
The anti-inflammatory enzyme A20 in the neuropathology of Multiple Sclerosis
More Than Neurons, 1-3 December, Turin The anti-inflammatory enzyme A20 in the neuropathology of Multiple Sclerosis Dr. Simona Perga, PhD Neuroscience Institute Cavalieri Ottolenghi (NICO) & Multiple Sclerosis
Microglia-derived extracellular vesicles regulate the proliferation and differentiation of oligodendrocyte precursor cells
University of Turin CNR Institute of Neuroscience Microglia-derived extracellular vesicles regulate the proliferation and differentiation of oligodendrocyte precursor cells Roberta Parolisi Turin, December
Neocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
Neurodegeneration and macrophages; a beneficial or harmful role for macrophages and microglia in neuronal damage during multiple sclerosis
Neurodegeneration and macrophages; a beneficial or harmful role for macrophages and microglia in neuronal damage during multiple sclerosis Marlijn van der Poel Writing assignment: literature review October
Contribution of microglia to tissue injury and repair in MS
Contribution of microglia to tissue injury and repair in MS MS disease course histologic features Courtesy of Samuel Ludwin I ACUTE CHRONIC s ACTIVE CHRONIC Clinical Course Intra CNS Extra CNS Imaging
Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A.
UvA-DARE (Digital Academic Repository) Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A. Link to publication Citation for published
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Anatomy of a Neuron. Copyright 2000 by BSCS and Videodiscovery, Inc. Permission granted for classroom use. Updated Master 2.
Anatomy of a Neuron Master 2.1 Neurons Interact with Other Neurons through Synapses Master 2.2 Name Date Due Cells of the Nervous System Learning Target: Identify and state the function of the components
Microglia, Inflammation, and FTD
FTD Minicourse April, 2009 Microglia, Inflammation, and FTD Li Gan, Ph.D Gladstone Institute of Neurological Disease University of California, San Francisco Outline Why study inflammation in neurodegeneration?
Chemokine Regulation of Oligodendrocyte Development in the Spinal Cord. Bob Avino Saint Louis University Senior Honors Thesis April 19, 2011
Chemokine Regulation of Oligodendrocyte Development in the Spinal Cord Bob Avino Saint Louis University Senior Honors Thesis April 19, 2011 Richard J. Miller, PhD Northwestern University Feinberg School
B-cell. Astrocyte SCI SCI. T-cell
RF #2015 P-01 PI: Azizul Haque, PhD Grant Title: Targeting Enolase in Spinal Cord Injury 12-month Technical Progress Report Progress Report (First Six Months): Enolase is one of the most abundantly expressed
Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of
SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI
Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences
Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences Walter Royal, III, MD Professor of Neurology University of Maryland School of Medicine
Receptor-interacting Protein Kinases Mediate Necroptosis In Neural Tissue Damage After Spinal Cord Injury
Receptor-interacting Protein Kinases Mediate Necroptosis In Neural Tissue Damage After Spinal Cord Injury Haruo Kanno, M.D., Ph.D., Hiroshi Ozawa, M.D., Ph.D., Satoshi Tateda, M.D., Kenichiro Yahata, M.D.,
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Adult Nervous System
Adult Nervous System What is the capacity of the PNS and CNS for repair? WHY? Why discuss this now? Potential for repair depends on cellular properties of nerve and glial cells. http://neuroscience.uth.tmc.edu/s1/chapter09.html
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AWARD NUMBER: W81XWH-14-1-0524 TITLE:Oligodendroglial MCT1 and Metabolic Support of Axons in Multiple Sclerosis PRINCIPAL INVESTIGATOR: Jeffrey D. Rothstein MD, PhD CONTRACTING ORGANIZATION: Johns Hopkins
Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
Microglia preconditioning (priming) in central nervous system pathologies
Microglia preconditioning (priming) in central nervous system pathologies Florence Perrin florence.perrin@umontpellier.fr Montpellier, October 2018 1 Spanish anatomists Glia = glue in Greek Santiago Ramon
In vivo reprogramming reactive glia into ipscs to produce new neurons in the
In vivo reprogramming reactive glia into ipscs to produce new neurons in the cortex following traumatic brain injury Xiang Gao 1, Xiaoting Wang 1, Wenhui Xiong 1, Jinhui Chen 1, * 1 Spinal Cord and Brain
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
SCIRF Award #2016 I-03 PI: Azizul Haque, PhD Grant Title: Neuron-specific Enolase and SCI
SCIRF Award #2016 I-03 PI: Azizul Haque, PhD Grant Title: Neuron-specific Enolase and SCI 10-month Technical Progress Report Enolase is a multifunctional glycolytic enzyme involved in growth control, hypoxia,
Nature Neuroscience: doi: /nn.2275
Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.
Nerve Cells and Behavior
Nerve Cells and Behavior 27 th September, 2016 Touqeer Ahmed Ph.D. Atta-ur-Rahman School of Applied Biosciences National University of Sciences and Technology Nervous System and Behavior Nervous system
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
Supplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
Primary oligodendropathy is not a trigger of CNS autoimmunity
Primary oligodendropathy is not a trigger of CNS autoimmunity Ari Waisman Institute for Molecular Medicine University Medical Center, JGU Mainz 1 How is an anti-myelin immune response initiated? Secondary
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Diabetic Complications Consortium
Diabetic Complications Consortium Application Title: Cathepsin S inhibition and diabetic neuropathy Principal Investigator: Nigel A Calcutt 1. Project Accomplishments: We investigated the efficacy of cathepsin
NG2 + CNS Glial Progenitors Remain Committed to the Oligodendrocyte Lineage in Postnatal Life and following Neurodegeneration
Article NG2 + CNS Glial Progenitors Remain Committed to the Oligodendrocyte Lineage in Postnatal Life and following Neurodegeneration Shin H. Kang, 1 Masahiro Fukaya, 2,4 Jason K. Yang, 1 Jeffrey D. Rothstein,
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and
PROPOSAL: Translational Safety Biomarker Assessment of Neurotoxicity
PROPOSAL: Translational Safety Biomarker Assessment of Neurotoxicity Andreas Jeromin, PhD Chief Scientific Officer NextGen Sciences DX Boston, MA Emerging Issues Session HESI Annual Meeting 12 June 2012
Supplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
! BIOL 2401! Week 5. Nervous System. Nervous System
Collin County Community College! BIOL 2401! Week 5 Nervous System 1 Nervous System The process of homeostasis makes sure that the activities that occur in the body are maintained within normal physiological
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Inhibition of DYRK1A stimulates human beta-cell proliferation
Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns
Supplementary Materials
Supplementary Materials Fig. S1. Weights of full-dose treatment groups comparing 1 st, 2 nd, and 3 rd generation gene replacement therapy. Mice were treated at p1 with 4x10 11 GC of the three different
Rina Zilkha-Falb 3, Nathali Kaushansky 1, Naoto Kawakami 2 and Avraham Ben-Nun 1*
Zilkha-Falb et al. Journal of Neuroinflammation (2016) 13:7 DOI 10.1186/s12974-015-0468-4 RESEARCH Post-CNS-inflammation expression of CXCL12 promotes the endogenous myelin/ neuronal repair capacity following
label the basement membrane). Different fixation methods of EB-perfused P8 mice to optimize the combination
Supplementary Figure 1 Optimization of the tissue fixation protocol to combine EB perfusion and IB4 endothelial tip cell staining in the postnatal mouse brain. a-l Labeling of EB-perfused P8 mice with
Dietary cholesterol promotes repair of demyelinated lesions in the adult brain
Received Apr 16 Accepted 1 Dec 16 Published Jan 17 DOI: 1.138/ncomms11 Dietary cholesterol promotes repair of demyelinated lesions in the adult brain OPEN Stefan A. Berghoff 1, Nina Gerndt 1, Jan Winchenbach
The role of complement anaphylatoxins in CNS pathology and glial cell function
University of Iowa Iowa Research Online Theses and Dissertations Fall 2010 The role of complement anaphylatoxins in CNS pathology and glial cell function Sarah Ingersoll University of Iowa Copyright 2010
NURSE-UP INTRODUCTION TO THE NERVOUS SYSTEM
NURSE-UP INTRODUCTION TO THE NERVOUS SYSTEM FUNCTIONS OF THE NERVOUS SYSTEM Body s primary communication and control system. Integrates and regulates body function Collects information specialized nervous
Macrophages and Exosomes Employ Brain Inflammation for CNS Delivery of Therapeutics A. Kabanov
Macrophages and Exosomes Employ Brain Inflammation for CNS Delivery of Therapeutics A. Kabanov Targeting Brain Inflammation in Disease Biochemical studies of brains from individuals with many neurologic
Chapter 12 The Nervous System INTRODUCTION TO THE NERVOUS SYSTEM. Central Nervous System (CNS): STRUCTURE BRAIN SPINAL CORD NERVES
Chapter 12 The Nervous System PowerPoint by John McGill Supplemental Notes by Beth Wyatt INTRODUCTION TO THE NERVOUS SYSTEM STRUCTURE BRAIN SPINAL CORD NERVES Central Nervous System (CNS): Brain Spinal
Supplemental Figures Supplemental Figure 1:
Supplemental Figures Supplemental Figure 1: Representative FACS data showing Concurrent Brain cell type Acquisition using either Percoll PLUS (top row) or myelin removal beads (bottom two rows). Debris
The pathogenesis of nervous distemper
Veterinary Sciences Tomorrow - 2004 The pathogenesis of nervous distemper Marc Vandevelde Canine distemper is a highly contagious viral disease of dogs and of all animals in the Canidae, Mustellidae and
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
BRAIN ENERGY: Why Lactate Protects the Brain
BRAIN ENERGY: Why Lactate Protects the Brain Johanne Egge Rinholm Brain and Muscle Energy Group lead by Linda H. Bergersen Dept of Anatomy and Centre for Molecular Biology and Neuroscience (CMBN) University
Research Development: Bedside to Bench and Back
Research Development: Bedside to Bench and Back Matt Bellizzi, MD PhD Department of Neurology University of Rochester School of Medicine and Dentistry Rochester, NY "I can walk down the hall just fine,
Relevant Disclosures
6/18/215 Therapeutic developments for autoimmune demyelinating diseases: Musings from a MD (Mouse Doctor) Michael K. Racke, M.D. May 28, 215 Relevant Disclosures Editorial Boards for Journal of Neuroimmunology,
Neuroimmunology. Innervation of lymphoid organs. Neurotransmitters. Neuroendocrine hormones. Cytokines. Autoimmunity
Neuroimmunology Innervation of lymphoid organs Neurotransmitters Neuroendocrine hormones Cytokines Autoimmunity CNS has two ways of contacting and regulating structures in the periphery Autonomic
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
(3) Chemical synapse ---structure
(3) Chemical synapse ---structure LM: in silver preparation dark brown color button-liked on the surface of cell body and dendrites called synaptic button LM: synaptic button (3) Chemical synapse ---structure
Effective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
Disease of Myelin. Reid R. Heffner, MD Distinguished Teaching Professor Emeritus Department of Pathology and Anatomy January 9, 2019
Disease of Myelin Reid R. Heffner, MD Distinguished Teaching Professor Emeritus Department of Pathology and Anatomy January 9, 2019 1 I HAVE NO CONFLICTS OF INTEREST OR DISCLOSURES TO DECLARE. I HAVE NO
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
Remyelination in the CNS: from biology to therapy
NeuroN Glia interactions Remyelination in the CNS: from biology to therapy Robin J. M. Franklin* and Charles ffrench-constant Abstract Remyelination involves reinvesting demyelinated axons with new myelin
Human Anatomy and Physiology- Problem Drill 04: Tissues of the Body
Human Anatomy and Physiology- Problem Drill 04: Tissues of the Body Question No. 1 of 10 A biopsy sample is obtained from a lesion on the right cheek of a male patient. A technician in the histology lab
Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
SUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
MYELINATION, DEVELOPMENT AND MULTIPLE SCLEROSIS 1
MYELINATION, DEVELOPMENT AND MULTIPLE SCLEROSIS 1 Myelination, development and Multiple Sclerosis Randy Christensen Salt Lake Community College MYELINATION, DEVELOPMENT AND MULTIPLE SCLEROSIS 2 Myelination,
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Collin County Community College BIOL Week 5. Nervous System. Nervous System
Collin County Community College BIOL 2401 Week 5 Nervous System 1 Nervous System The process of homeostasis makes sure that the activities that occur in the body are maintained within normal physiological
The Nervous System. PowerPoint Lecture Slides C H A P T E R 7. Prepared by Patty Bostwick-Taylor, Florence-Darlington Technical College
PowerPoint Lecture Slides Prepared by Patty Bostwick-Taylor, Florence-Darlington Technical College C H A P T E R 7 The Nervous System NERVOUS SYSTEM OVERVIEW Essential Question: What are the primary functions
Edinburgh Research Explorer
Edinburgh Research Explorer Fingolimod (FTY720) Enhances Remyelination Following Demyelination of Organotypic Cerebellar Slices Citation for published version: Miron, VE, Ludwin, SK, Darlington, PJ, Jarjour,
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Supplemental Figure 1. Characterization of CNS lysosomal pathology in 2-month-old IDS-deficient mice. (A) Measurement of IDS activity in brain
Supplemental Figure 1. Characterization of CNS lysosomal pathology in 2-month-old IDS-deficient mice. (A) Measurement of IDS activity in brain extracts from wild-type (WT) and IDS-deficient males. IDS
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal
Primary Mouse Cerebral Cortex Neurons V: 80% TE: 70%
Primary Mouse Cerebral Cortex Neurons V: 80% TE: 70% Pictures: 9 days after electroporation Red: MAP2 Blue: GFAP Green: GFP The cells were from Embryonic Day 14 Mouse Cerebral Cortex Primary Mouse Hippocampal
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
effect on the upregulation of these cell surface markers. The mean peak fluorescence intensity
SUPPLEMENTARY FIGURE 1 Supplementary Figure 1 ASIC1 disruption or blockade does not effect in vitro and in vivo antigen-presenting cell activation. (a) Flow cytometric analysis of cell surface molecules
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
Cells of the Nervous System
Cells of the Nervous System Layout of the Nervous System Central Nervous System (CNS) Brain (in the skull) Spinal Cord (in the spine) Interprets sensory input, initiates movement, and mediates complex
Multiple sclerosis: experimental models and reality
Acta Neuropathol (2017) 133:223 244 DOI 10.1007/s00401-016-1631-4 REVIEW Multiple sclerosis: experimental models and reality Hans Lassmann 1 Monika Bradl 1 Received: 9 September 2016 / Revised: 5 October
CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices
45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing
Demyelination arrest and remyelination induced by glatiramer acetate treatment of experimental autoimmune encephalomyelitis
Demyelination arrest and remyelination induced by glatiramer acetate treatment of experimental autoimmune encephalomyelitis Rina Aharoni*, Avia Herschkovitz*, Raya Eilam, Michal Blumberg-Hazan, Michael
Address: Department of Biomedical Genetics, University of Rochester Medical Center, 601 Elmwood Avenue, Rochester, NY 14642, USA.
Journal of Biology BioMed Central Research article CNS progenitor cells and oligodendrocytes are targets of chemotherapeutic agents in vitro and in vivo Joerg Dietrich, Ruolan Han, Yin Yang, Margot Mayer-Pröschel
3rd International Conference on Neurology & Therapeutics.
3rd International Conference on Neurology & Therapeutics www.neuroimmunology.ca Multiple sclerosis is a devastating disease The first description of the disease was mentioned in 14th century In 1838 Dr.
Nervous Tissue. Prof. Zhou Li Dept. of Histology and Embryology
Nervous Tissue Prof. Zhou Li Dept. of Histology and Embryology Organization: neurons (nerve cells) neuroglial cells Function: Ⅰ Neurons 1. structure of neuron soma neurite a. dendrite b. axon 1.1 soma
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
Potency & Release Testing for unrelated donor cord blood units
Potency & Release Testing for unrelated donor cord blood units Joanne Kurtzberg, MD Robertson Cell and Translational Therapy Program Pediatric Blood and Marrow Transplant Program Carolinas Cord Blood Bank
removed replaced inflammation scar tissue
HOMEOSTASIS Normal maintenance and renewal of differentiated cells in many tissues This does NOT involve leukocytes. Leukocytes and inflammation occurs in response to damage NEED FOR REPAIR When tissue
Subject Index. neuronal survival promotion by insulinlike growth factor-i , 162 regulatory proteins 148, 162
Subject Index Acid-labile subunit (ALS) evaluation 84 function 84 growth hormone activity marker 91 growth hormone insensitivity levels 102, 104 Alzheimer s disease, insulin-like growth factor-i neuroprotection
April 29, Neurophysiology. Chul-Kyu Park, Ph.D. Assistant Professor Department of Physiology, Graduate School of Medicine, Gachon University,
April 29, 2016 Neurophysiology Chul-Kyu Park, Ph.D. Assistant Professor Department of Physiology, Graduate School of Medicine, Gachon University, Cells in the brain Neurons glia 1. Astrocytes 2. Microglia