Supplementary Figure 1

Similar documents
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ

SUPPLEMENTARY INFORMATION

A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples

SUPPLEMENTARY INFORMATION. Rare independent mutations in renal salt handling genes contribute to blood pressure variation

Next Generation Sequencing in Haematological Malignancy: A European Perspective. Wolfgang Kern, Munich Leukemia Laboratory

Vertical Magnetic Separation of Circulating Tumor Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients

Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each

To test the possible source of the HBV infection outside the study family, we searched the Genbank

NeoTYPE Cancer Profiles

Next generation sequencing analysis - A UK perspective. Nicholas Lea

Accel-Amplicon Panels

Laboratory Service Report

NeoTYPE Cancer Profiles

Susanne Schnittger. Workflow of molecular investigations in JAK2-negative MPNs - the Munich experience

Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E,

Please Silence Your Cell Phones. Thank You

Introduction of an NGS gene panel into the Haemato-Oncology MPN service

NGS in tissue and liquid biopsy

TP53 mutational profile in CLL : A retrospective study of the FILO group.

Laboratory Service Report

modified dye uptake assay including formazan test EC 90 not tested plaque reduction assay

Clinical Utility of Droplet ddpcr, moving to diagnostics. Koen De Gelas, PhD, CRIG ddpcr mini symposium, 15/05/2018

Sample Metrics. Allele Frequency (%) Read Depth Ploidy. Gene CDS Effect Protein Effect. LN Metastasis Tumor Purity Computational Pathology 80% 60%

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R

Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP

Importance of minor TP53 mutated clones in the clinic

Supplementary Information

Variant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18

Blastic Plasmacytoid Dendritic Cell Neoplasm with DNMT3A and TET2 mutations (SH )

Supplementary Figure 1 Weight and body temperature of ferrets inoculated with

The Center for PERSONALIZED DIAGNOSTICS

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Reporting TP53 gene analysis results in CLL

Relative activity (%) SC35M

Supporting Information

Identification and clinical detection of genetic alterations of pre-neoplastic lesions Time for the PML ome? David Sidransky MD Johns Hopkins

NC bp. b 1481 bp

Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.

p.arg119gly p.arg119his p.ala179thr c.540+1g>a c.617_633+6del Prediction basis structure

SureSelect Cancer All-In-One Custom and Catalog NGS Assays

Supplementary information to:

Aplastic Anaemia Genomics: Current data and interpretation

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

Nature Genetics: doi: /ng Supplementary Figure 1. Mutational signatures in BCC compared to melanoma.

Supplementary. presence of the. (c) mrna expression. Error. in naive or

7/12/2016 TESTING. Objectives. New Directions in Aplastic Anemia: What's on the Horizon? Better way to evaluate clonal evolution?

Supplementary Tables. Supplementary Figures

Nature Immunology: doi: /ni.3412

HD1 (FLU) HD2 (EBV) HD2 (FLU)

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

Mutational Impact on Diagnostic and Prognostic Evaluation of MDS

Clonal hematopoiesis of indeterminate potential and MDS. Siddhartha Jaiswal AAMDS Meeting 3/17/16

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Performance Characteristics BRCA MASTR Plus Dx

Comprehensive Analyses of Circulating Cell- Free Tumor DNA

SUPPLEMENTAL MATERIAL

Nature Genetics: doi: /ng Supplementary Figure 1. Clinical timeline for the discovery WES cases.

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

Fig S1. ZNF697-NOTCH2 rearrangement: Diagram of the ZNF697-NOTCH2 fusion and

MET skipping mutation, EGFR

CHAPTER 8 ONCOGENIC MARKER DETECTION FROM P53 MUTANT AMINO-ACID SUBSTITUTIONS

SUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation.

Supplemental material Mutant DNMT3A: A Marker of Poor Prognosis in Acute Myeloid Leukemia Ana Flávia Tibúrcio Ribeiro, Marta Pratcorona, Claudia

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Next generation histopathological diagnosis for precision medicine in solid cancers

Clinical molecular profiling of archival tumor tissue and cell-free DNA from patients with Erdheim-Chester disease

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues

Discovering Rare Hematopoietic Clones Harboring Leukemia-Associated Mutations Using Error-Corrected Sequencing

Acute leukemia and myelodysplastic syndromes

LIPOPROTEINE ATEROGENE E ANTI-ATEROGENE ATEROGENE

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)

Fabry Disease X-linked genetic, multi-organ disorder. Fabry disease screening program in Hypertrophic p Cardiomyopathy: preliminary results.

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).

Case Presentation. Pei Lin, M. D.

Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:

The preclinical efficacy of a novel telomerase inhibitor, imetelstat, in AML: A randomized trial in patient-derived xenografts

Pharmacogenomics in Rare Diseases: Development Strategy for Ivacaftor as a Therapy for Cystic Fibrosis

Molecular profiling in confirming the diagnosis of early myelodysplastic syndrome

Pediatric Oncology & Pathology Services

Spectrum of somatically acquired mutations identified by combining WES and genome-wide DNA array analysis in the discovery cohort of 30 JMML cases.

Click to edit Master /tle style

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Molecular Genetic Testing for the Diagnosis of Haematological Malignancies

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE

Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Bio 111 Study Guide Chapter 17 From Gene to Protein

Supplementary Table e1. Clinical and genetic data on the 37 participants from the WUSM

SUPPLEMENTARY FIGURE S1: nlp-22 is expressed in the RIA interneurons and is secreted. (a) An animal expressing both the RIA specific reporter

Juvenile and Chronic Myelo-Monocytic Leukemia

Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing

Nature Getetics: doi: /ng.3471

La biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro

Transcription:

Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the capture panel. a, Histogram of ECCS coverage for all amplicons. b, Histogram of ECCS coverage in amplicons in which a variant was detected. a 2 Coverage Per Amplicon 15 1 5 b 25 2 4 6 8 Coverage per Amplicon Coverage per Amplicon with Called Variant 2 15 1 5 2 4 6 8 Coverage per Amplicon

Tareget Space (bp) Target Space (bp) Supplementary Figure 2 Number of mutations detected per gene in exons (top panel) and introns (bottom panel) relative to the capture space (bp = base pairs) targeting that gene in the panel. 125 Detected Exonic SNVs Relative to Capture Space per Gene CUX1 1 75 KDM6A STAG2 BCOR BCORL1 TET2 ATRX DNMT3A 5 25 ASXL1 RAD21 NOTCH1 TP53 IKZF1 ETV6 SMC3 MYD88 CBL KRAS 1 2 3 4 Detected SNVs 125 Detected Intronic SNVs Relative to Capture Space per Gene CUX1 1 TET2 STAG2 KDM6A 75 ATRX DNMT3A 5 EZH2 25 IKZF1 ETV6 FBXW7 MYD88 KRAS 2 4 Detected SNVs 6

probe fluorescence (A.U.) Supplementary Figure 3 Representative droplet digital PCR (ddpcr) results from NHS participant 12 for the detected DNMT3A G543A clonal variant. The wild-type probe intensity in arbitrary units (A.U.) was plotted relative to the DNMT3A G543A (mutant) probe intensity for each droplet. a-d, Variant quantification at the first time point for a, all cells; b, B lymphocytes; c, T lymphocytes; and d, myeloid cells. e-h, Variant quantification at the second time point for e, all cells; f, B lymphocytes; g, T lymphocytes; and h, myeloid cells. i, The DNMT3A G543A variant was not detected in the negative control sample from participant 2, time point 2. j, DNMT3A G543A positive (or empty) droplets were detected in the gblock positive control. a 11,79 e 92,45 i 96,848 8 8 8 4 58 155,655 4 197 149,79 4 15,131 4 8 4 8 4 8 b 885 f 2,3 j 8 8 8 4 78,97 4 3 87,257 4 25 3,75 c 8 4 8 5,196 g 8 4 8 8,679 4 8 4 22 84,757 4 12 78,864 d 8 4 8 23,24 h 8 4 8 42,632 4 97 67,745 4 38 52,676 4 8 4 8 probe fluorescence (A.U.)

VAF by ddpcr Supplementary Figure 4. Several mutations identified by error-corrected sequencing (ECS) were verified using droplet digital PCR (ddpcr). The variant allele fractions (VAFs) identified ECS and ddpcr were highly correlated (R 2 =.98)..1.1.1.1.1.1 VAF by ECS

Supplementary Figure 5 Heat map depicting the number of exonic single nucleotide variants (SNVs) detected in each gene per study participant. Gene DNMT3A TET2 STAG2 BCORL1 TP53 KRAS ASXL1 SMC3 RAD21 CBL BCOR NOTCH1 MYD88 KDM6A IKZF1 ETV6 CUX1 ATRX Detected Clonal Exonic SNVs per Individual SNVs 9 7 5 3 1 9 13 7 2 11 17 18 2 8 15 4 14 12 5 16 19 6 1 1 Participant ID

K67E S129X Q231X Q249X E283X V296M R31W G32C W314X R32X S337X R379H E482X C494F G498V L58P C537F G543S G543A A572D R635W R635Q L637P L639F E667X T691I I75T S714C F731S F732S H739P A741E R749H S775_E2splice P799S H821R T834A T835A S839P W86R R882H R899G P94L Supplementary Figure 6 Detected exonic clonal single nucleotide variants (SNVs) in DNMT3A. The detected SNVs were predominantly nonsense mutations (blue) in the first half of the gene or missense mutations (red) in the three functional domains a proline-tryptophan-tryptophan-proline (PWWP) chromatin targeting domain, a zinc finger nuclease (ZFN) domain and a S-adenosylmethionine (SAM) dependent methyltransferase (MTase) domain. Exons AA Residue 3 4 5 6 7 8 9 1 11 1213 14 15 16 17 18 19 2 21 22 23 1 2 3 4 5 6 7 8 912 DNMT3A PWWP domain ZFN domain SAM-dependent MTase Missense Nonsense Splice

L446X W954X E1137_E3splice R1216G A1217A G1288S F139L Y1337X R1359H S1486X E1513_E1splice Y1589X T1793I Supplementary Figure 7 Detected exonic clonal single nucleotide variants in TET2. Exons 4 6 8 1 AA Residue 2 4 6 8 1 12 14 16 18 22 TET2 Oxygenase domain Silent Missense Nonsense Splice

DNMT3A KDM6A ATRX STAG2 CUX1 ETV6 EZH2 FBXW7 IKZF1 KRAS MYD88 TET2 Detected Clonal Intronic SNVs Supplementary Figure 8 Number of intronic clonal single nucleotide variants (SNVs) detected by gene. 6 Detected Intronic SNVs by Gene 4 2 Gene

7 6 11 18 9 19 12 1 1 2 Gene Supplementary Figure 9 Heat map depicting the number of intronic single nucleotide variants (SNVs) detected in each gene per individual. DNMT3A KDM6A STAG2 Detected Clonal Intronic SNVs per Individual ATRX TET2 MYD88 KRAS IKZF1 FBXW7 EZH2 ETV6 CUX1 Count 5 3 1 Participant ID

CD19 SSC SSC SSC Supplementary Figure 1 Representative flow cytometry gating strategy from NHS participant 5, time point 1 to isolate B lymphocytes, T lymphocytes and myeloid cells. Myeloid Cells FSC CD45 CD33 B Cells T Cells CD3

Supplementary Table 1 Sequenced reads and error-corrected consensus sequences generated for each library. Collection 1 Replicate 1 Collection 1 Replicate 2 Collection 2 Replicate 1 Collection 2 Replicate 2 Participant ID Raw Reads ECCS Raw Reads ECCS Raw Reads ECCS Raw Reads ECCS 1 38,483,255 3,333,626 33,448,218 2,84,567 35,427,539 2,987,274 33,392,978 2,784,229 2 39,268,72 3,318,173 41,984,812 3,558,516 35,157,811 3,27,67 33,657,29 2,86,18 3 32,63,819 2,581,39 36,17,671 2,959,152 48,998,142 3,584,46 4,599,238 3,291,215 4 3,932,163 2,212,764 3,623,846 2,51,632 39,579,433 3,254,544 48,529,452 3,53,765 5 35,11,143 2,727,3 34,151,27 2,411,821 52,32,285 3,759,16 55,49,72 4,17,37 6 34,27,169 2,863,69 35,84,657 2,946,669 5,852,817 3,682,33 48,351,486 3,514,19 7 41,658,678 2,663,917 42,58,68 2,714,869 45,885,262 3,233,3 44,468,353 3,548,78 8 44,771,597 2,734,288 41,632,517 2,528,357 5,72,31 3,399,553 5,378,471 3,698,27 9 39,449,116 2,531,229 41,67,14 2,599,127 6,14,462 4,197,532 5,347,145 3,993,77 1 4,492,765 2,554,6 38,729,489 2,4,5 59,87,612 4,34,423 58,962,293 3,996,55 11 48,94,33 3,684,38 44,34,692 3,456,949 64,52,183 4,96,893 56,51,287 3,797,44 12 57,115,177 4,245,185 48,446,875 3,692,857 61,813,583 4,322,748 59,452,7 4,11,288 13 39,368,839 3,59,66 41,269,631 3,343,48 59,327,495 4,213,628 52,689,35 4,173,8 14 38,837,743 3,76,61 37,36,17 2,976,419 6,366,37 4,53,326 58,19,532 4,51,213 15 54,65,75 3,47,283 44,547,457 2,49,226 58,11,11 3,98,542 51,539,869 4,14,14 16 52,226,742 2,986,829 6,744,391 3,97,372 45,532,881 3,414,68 6,632,143 4,27,633 17 57,985,852 4,79,429 51,835,232 3,373,746 55,355,241 3,721,52 59,51,527 4,96,858 18 54,185,217 3,337,38 54,495,83 3,388,54 57,117,288 4,147,18 58,64,485 3,999,74 19 52,213,946 2,947,31 51,28,264 3,343,682 53,983,868 3,723,161 48,268,843 3,796,565 2 51,521,626 3,376,26 41,417,619 2,86,99 58,651,16 4,92,482 56,692,728 3,793,691

Supplementary Table 2 Clonal SNVs detected by error-corrected sequencing. Participant ID Chr Start End Ref Alt Gene Amino Acid COSMIC VAF1.1 VAF1.2 VAF2.1 VAF2.2 1 7 5444517 5444517 T C IKZF1 intronic.922 -.121.2929 1 X 123185174 123185174 G T STAG2 V376L.2824.1194.1821.16985 2 2 25463271 25463271 G T DNMT3A A741E.1124 -.988.111 2 2 25463277 25463277 T G DNMT3A H739P.1713.284.365.533 2 2 25466793 25466793 A G DNMT3A L637P.136.3425.3549.5639 2 2 25468153 25468153 A G DNMT3A L58P -.1168.7558.856 2 2 2547573 2547573 G A DNMT3A R31W - -.261.3542 2 4 16164778 16164778 C G TET2 R1216G - -.16.138 2 4 16164783 16164783 T A TET2 A1217A - -.153.132 2 12 118316 118316 G C ETV6 intronic.1224.567 - - 4 2 2547516 2547516 G A DNMT3A R32X 133724.363.358.5249.262 4 9 139391179 139391179 G A NOTCH1 Q2338X.1138.967 - - 4 X 12318456 12318456 G T STAG2 R35L 254953.9143.7774.14936.18524 5 2 25466799 25466799 C T DNMT3A R635Q 158388 - -.1517.2674 6 2 25471183 25471183 C G DNMT3A intronic.1627.1534 - - 6 3 38181952 38181952 C T MYD88 I192I - -.177.1559 6 4 1618899 1618899 T G TET2 F139L.1359.1286.91.766 6 7 11843537 11843537 T G CUX1 intronic.412.4168.174.5179 6 11 119148929 119148929 A G CBL I383M.1394.438 - - 7 2 25457176 25457176 G A DNMT3A P94L 877.2364 -.8514.141 7 2 25458673 25458673 T C DNMT3A T834A.2895.3496.2633.3961 7 2 2546212 2546212 G A DNMT3A P799S - -.2258.4782 7 2 25463372 25463372 G A DNMT3A intronic.4215.3861.3416-7 2 25463384 25463384 G A DNMT3A intronic.6557.82.2896-7 2 25463385 25463385 C G DNMT3A intronic - -.6618.8666 7 2 25463387 25463387 C G DNMT3A intronic.6654.7867.3217-7 2 25463389 25463389 G A DNMT3A intronic.6822.7738.3792-7 2 25464441 25464441 G A DNMT3A T691I - -.358.2517 7 2 25464514 25464514 C A DNMT3A E667X - -.178.3162 7 2 25466788 25466788 G A DNMT3A L639F.21615.2599.4688.29481 7 2 25467449 25467449 C T DNMT3A G543S - -.4758.3253 7 4 1615859 1615859 G A TET2 splicing 87117 - -.124.159 7 4 153249632 153249632 T C FBXW7 intronic.35.329 - - 7 7 5367256 5367256 C T IKZF1 S21S.3464.461.214-7 X 76874262 76874262 A T ATRX intronic - -.46.325 7 X 123199914 123199914 G T STAG2 intronic - -.751.892 8 2 25468919 25468919 C A DNMT3A E482X - -.35.47 8 4 1618834 1618834 G A TET2 G1288S 1178.1193.2377.1991.114 9 2 25459821 25459821 T C DNMT3A H821R -.2221.1677.252 9 2 2546286 2546286 T C DNMT3A splicing.2556 -.1467.156 9 2 25463247 25463247 C T DNMT3A R749H.2272.17677.33274.35612 9 2 25463541 25463541 G C DNMT3A S714C 8711.27327.3296.4122.3413 9 2 254668 254668 G A DNMT3A R635W 8712.1896.369 -.1227 9 2 2546716 2546716 G T DNMT3A A572D - -.13.211 9 2 25469632 25469632 C T DNMT3A R379H - -.2941.577 9 2 2547588 2547588 C T DNMT3A V296M - -.3471.3189 9 2 2547116 2547116 G A DNMT3A Q249X.142 -.1329.1299 9 4 16193995 16193995 C G TET2 S1486X 211625 - -.495.588 9 2 312391 312391 A G ASXL1 N859S.457.2914.438.3188 9 X 44733267 44733267 T G KDM6A intronic - -.1671.1338 1 12 2538459 2538459 G C KRAS intronic - -.12.86 1 X 129162659 129162659 C G BCORL1 H1376Q.4852.2344.182-11 2 25458595 25458595 A G DNMT3A W86R 231568.861.15.219.2493 11 2 2547914 2547914 C A DNMT3A E283X.4158.5587.12941.14349 11 2 2555372 2555372 G C DNMT3A S129X - -.727.548 11 3 38182245 38182245 T A MYD88 intronic - -.1872.2152 11 17 7577129 7577129 A G TP53 F27S 1135 - -.734.1649 11 2 312366 312366 A T ASXL1 K131X.673.843 - - 11 X 39933358 39933358 G A BCOR A414V - -.583.915 11 X 44733249 44733249 G T KDM6A intronic - -.883.815 11 X 7681415 7681415 A T ATRX F2165Y.715.746 - - 11 X 129148158 129148158 A G BCORL1 L47L - -.251.59 12 2 25467448 25467448 C G DNMT3A G543A 25633.1365 -.3789.3858 12 4 1615548 1615548 C G TET2 intronic - -.993.1965 12 1 112342324 112342324 C T SMC3 S243F - -.1413.1779 13 2 25457192 25457192 G C DNMT3A R899G.2495.15.1342.1758 13 2 25457242 25457242 C T DNMT3A R882H 52944 - -.1847.1692 13 2 25458658 25458658 A G DNMT3A S839P.346 -.194.638 13 2 25463298 25463298 A G DNMT3A F732S.1517 -.2979.3191 13 2 25467466 25467466 C A DNMT3A C537F - -.1861.3427 13 2 25468183 25468183 C A DNMT3A G498V.97 -.374.633 13 2 25468195 25468195 C A DNMT3A C494F.97 -.376.641 13 2 2547532 2547532 C T DNMT3A W314X - -.278.2564 13 2 254757 254757 C A DNMT3A G32C - -.1633.994 13 8 117859842 117859842 T C RAD21 Y598C - -.57.562 14 2 2547464 2547464 G C DNMT3A S337X.25249.23997.42269.44835 14 12 253826 253826 T G KRAS A66A - -.628.554 14 12 2538263 2538263 A G KRAS S65S - -.6442.5566 14 X 4491115 4491115 C T KDM6A A239V - -.4325.5592 15 2 2545867 2545867 T C DNMT3A T835A - -.534.511 15 1 112342321 112342321 T C SMC3 L242P.2797.341.3635.4656 15 17 757715 757715 G T TP53 P278H 43755.16175.16297.31688.39548 15 2 312485 312485 G T ASXL1 R119S - -.119.538 15 X 12323454 12323454 T A STAG2 UTR3 - -.661.639 16 2 25463568 25463568 A G DNMT3A I75T 158312.66263.78765.45716.58166 17 2 2546331 2546331 A G DNMT3A F731S.1212 -.1883.2564 17 4 16156436 16156436 T G TET2 L446X - -.747.934 17 4 1619745 1619745 C T TET2 T1793I - -.138.1864 17 X 39932643 39932643 G A BCOR P652P.559.5769.1855.2876 17 X 123224536 123224536 A T STAG2 K113I.814.899.919.98 17 X 12917323 12917323 G A BCORL1 G1522S - -.448.444 18 2 254717 254717 G A DNMT3A Q231X.1527.1449.1864.894 18 4 16157961 16157961 G A TET2 W954X 8711 - -.2327.871 18 4 16182972 16182972 T A TET2 Y1337X 87145 - -.1537.134 18 7 1184496 1184496 G A CUX1 R62H.147878.142414.82825.6929 18 7 148515272 148515272 A G EZH2 intronic - -.1265.1335 18 X 44938634 44938634 A G KDM6A intronic.13796.1284.14613.13679 18 X 12914998 12914998 C T BCORL1 R784X 1319521 - -.18627.17259 19 4 16196434 16196434 T G TET2 Y1589X -.2147.2257.2473 19 11 119148922 119148922 G A CBL C381Y 3473.134.1371.1124.1829 19 17 7578427 7578427 T C TP53 H168R 43545.75.16.3275.3164 19 X 7681317 7681317 A G ATRX intronic - -.688.11 19 X 123179344 123179344 C T STAG2 intronic.1895.15979.2188.2219 2 2 2555559 2555559 T C DNMT3A K67E.5155.84.765.11 2 4 1619798 1619798 G A TET2 R1359H.3494.3217 - - 2 4 1619476 1619476 G A TET2 splicing - -.145.1679 2 8 117878873 117878873 C A RAD21 V32V.4314.3977.754.797 2 12 1222854 1222854 C A ETV6 V32V - -.138.1637 2 12 25398284 25398284 C T KRAS G12D 521 - -.946.1437

Supplementary Table 3 Clonal insertion/deletion variants detected by error-corrected sequencing. Participant ID Chr Start End Ref Alt Gene AA_Change VAF1.1 VAF1.2 VAF2.1 VAF2.2 7 2 25463381 25463381 - GTG DNMT3A intronic.6769.71.321-7 4 16155858 16155861 CAGT - TET2 N253fs.631.6283.1326.12641 7 4 16164895 16164895 - A TET2 Y1255_G1256delinsX.7199.5162.7387.8972 9 2 25463567 25463567 A - DNMT3A I75fs.33141.2285.662.859 9 2 25467528 25467547 AGCAGCGGGAAGGGTCAGAA - DNMT3A intronic - -.3843.493 11 2 25468168 25468168 - T DNMT3A T53fs - -.298.3126 15 8 117862892 117862895 TCTC - RAD21 E528fs.6811.6486.14212.12793 18 X 12317931 123179318 ATTAATTTT - STAG2 intronic.2772.25452.11935.1273 2 4 1619864 1619864 C - TET2 A1381fs.5228.325.3998.2561

Supplementary Table 4 Summary of droplet digital PCR validation experiments. Participant ID Gene AA_Change Cosmic Wells ECS VAF Replicate 1 Collection 1 Collection 2 ECS VAF ddpcr ECS VAF Replicate VAF Replicate 1 2 ECS VAF Replicate 2 ddpcr VAF ddpcr Control UPN.Collection 4 DNMT3A R32X 133724 16.363.358.682.5249.262.6283 11678.2. 4 STAG2 R35L 254953 8.9143.7774.177.14936.18524.17639 11678.1. 5 DNMT3A R635Q 158388 32 - -.938.1517.2674.1993 1819476.1.6 7 DNMT3A P94L 877 16.2364 -.243.8514.141.882 138614.1.25 7 TET2 splice 87117 24 - -.856.124.159.1363 138614.2. 8 TET2 G1288S 1178 16.1193.2377.172.1991.114.1615 11785A.1.14 9 DNMT3A S714C 8711 8.27327.3296.28169.4122.3413.38544 11785A.2.24 9 DNMT3A R635W 8712 16.1896.369.3453 -.1227.1991 181785.2. 9 TET2 S1486X 211625 24 - - -.495.588.438 16647.1. 11 TP53 F27S 1135 24 - -.457.734.1649.586 11785A.1. 11 DNMT3A W86R 231568 24.861.15.689.219.2493.2193 16647.2. 12 DNMT3A G543A 25633 16.1365 -.74.3789.3858.2741 11785A.2. 13 DNMT3A R882H 52944 24 - -.216.1847.1692.211 1115442.1.9 15 TP53 P278H 43755 8.16175.16297.14296.31688.39548.3782 181785.2.74 16 DNMT3A I75T 158312 8.66263.78765.7539.45716.58166.54531 1115442.1. 18 TET2 W954X 8711 16 - -.162.2327.871.1183 181785.1. 18 TET2 Y1337X 87145 16 - -.14.1537.134.1173 16647.1. 18 BCORL1 R784X 1319521 8 - -.38.18627.17259.17138 1115442.2. 19 CBL C381Y 3473 24.134.1371.135.1124.1829.1252 2974576.2. 19 TP53 H168R 43545 24.75.16.789.3275.3164.2926 16647.2. 2 KRAS G12D 521 24 - -.142.946.1437.974 2974576.1. 2 TET2 A1381fs - 8.5228.325.3524.3998.2561.3566 118362.1. Control VAF

Supplementary Table 5 Summary of variant VAFs detected by droplet digital PCR in sorted hematopoietic compartments. Participant ID Gene Amino Acid COSMIC Collection Bulk B T M 4 DNMT3A R32X 133724 1.68.48.5.19 2.63.63.12.39 5 DNMT3A R635Q 158388 1.9.6.5.5 2.2.2.15.18 7 DNMT3A P94L 877 1.2.25.1.9 2.88.135.18.37 8 TET2 G1288S 1178 1.17...6 2.16...1 9 DNMT3A S714C 8711 1.282.6.18.28 2.385.66.44.58 11 DNMT3A W86R 231568 1.7...1 2.22...19 12 DNMT3A G543A 25633 1.7..43.48 2.27.15.123.121 13 DNMT3A R882H 52944 1.2...1 2.2.18..2 15 TP53 P278H 43755 1.143.234.46.35 2.378.231.358.84 16 DNMT3A I75T 158312 1.753.76.84.35 2.545.71.218.48 18 TET2 W954X 8711 1.2... 2.12.33.4.3 19 TP53 H168R 43545 1.8.7.. 2.29.27.6. 2 KRAS G12D 521 1.1..2.7 2.1.37.1.36

Supplementary Table 6 Primer sequences for library preparation. Primer Name Sequence i5 16N Random AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT P5 AATGATACGGCGACCACCGA P7 CAAGCAGAAGACGGCATACGA

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback