CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE
|
|
- Rodger King
- 5 years ago
- Views:
Transcription
1 CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr G C heterozygous DDX11L1 chr A G Homozygous rs ISG15 chr A G heterozygous rs C1orf159 chr A AC heterozygous clinical rs ABCA4 chr T - Homozygous rs HRNR chr C CAGCTCT heterozygous rs LCE4A chr A G heterozygous 36 probable-pathogenic clinical rs699 mito AGT chr T C heterozygous AGAP11;AGAP11,BC chr G C heterozygous SMG6 1 CHR Name of the reference contig/chromosome where the variant occurs 2 POS Position in the reference contig/chromosome where the variant occurs 3 REF Reference base at the variant site 4 OBS Observed/alternate base in the samples at the variant site 5 ALLELE Genotype of the sample. Genotypes: homozygous and heterozygous 6 BUILD Gene ID associated with the locaation of the variant call 7 CLINICAL_SIGNIFICANCE SNP clinical significance. Possible values are unknown, non-pathogenic,probable-nonpathogenic, probable-patogenic, pathogenic, drug-response, histocompatibility, other. Information from dbsnp 8 is_clinical SNP is clinical. Information from dbsnp 9 dbsnp dbsnp identifier. If the observed variant exists in the dbsnp the rs identifier is shown 10 MITO If protein is predicted to target the mitochondria 11 GENE Gene ID associated with the location of the variant call
2 DESCRIPTION VARIANT_FUNC TION EXONIC_FUNCTION AA_CHANGES AA_CHANGE - ncrna_exonic Ubiquitin-like protein ISG15 exonic synonymous ISG15:uc001acj.3:exon2:c.A294G:p.V98V, V => V Uncharacterized protein C1orf159 exonic synonymous C1orf159:uc001acn.2:exon5:c.T357C:p.I119I,C1or I => I Retinal-specific ATP-binding cassette transporter intronic Hornerin exonic frameshift deletion HRNR:uc001ezt.1:exon2:c.1delA:p.M1fs, - Late cornified envelope protein 4A exonic nonframeshift substitution LCE4A:uc001fak.2:exon1:c.129_129delinsCAGCTC TGGGGGCTGCTGT, - Angiotensinogen exonic nonsynonymous AGT:uc009xff.2:exon3:c.T719C:p.M240T,AGT:uc0 M => T Arf-GAP with GTPase, ANK repeat and PH domain-containing protein 11 exonic;splicing nonsynonymous AGAP11:uc009xnf.2:exon4:c.A395G:p.H132R, H => R Telomerase-binding protein EST1A exonic nonsynonymous SMG6:uc010vqv.1:exon5:c.C569G:p.S190W,SMG 6:uc002fub.1:exon13:c.C3293G:p.S1098W, S => W 12 DESCRIPTION Gene ID description VARIANT_FUNCT ION EXONIC_FUNCTI ON Annotation of the variant with respect to its genomic context. Possible annotations are exonic, UTR5, UTR3, intronic, intergenic, splicing, downstream, upstream. When several protein splice variants overlap Annotation of the functional class of the variant. Possible annotations are synonymous, nonsynonymous, framshift deletion, frameshift substitution 15 AA_CHANGES Aminoacid change produced in the different transcripts. c = cdna, p = protein 16 AA_CHANGE Aminoacid change produced: REFERENCE => MUTATION
3 SIFT PP2 LRT OMIM OMIM_DESC PATHWAY GO GO_DESC UBIQUITIN-LIKE RIG-I-like receptor signaling GO: protein binding GO: membrane integral to ,601718, STARGARDT DISEASE 1; ABC transporters GO: nucleotide binding cornified envelope GO: LATE CORNIFIED - GO: keratinization tolerated benign neutral ANGIOTENSINOGEN; Hypertrophic cardiomyopathy GO: ovarian follicle rupture damaging GO: ARF GTPase activator damaging probably damaging deleterius SMG6, C. ELEGANS, - GO: nuclear-transcribed COLUMN NAME COLUMN NAME 17 SIFT 18 PP2 19 LRT Prediction whether the aminoacid substitution affects protein function. SIFT is based on the degree of cosnervation of aminoa amino acid residues in sequence alignments derived from closely related sequences. Possible values are tolater, damaging Prediction of the possible impact of the amino acid substitution on the structure and function of the protein using straightforward physical and comparative considerations. Possible values are probably damaging, possibly damaging and benign Prediction of deletetious mutations that disrupt highly conserved amino acid residues through a likelihood ratio test. Possible values are deleterious, neutral and unknown 20 OMIM OMIM IDs that are related to the corresponding gene. Information from the OMIM database 21 OMIM_DESC Description of the OMIM Ids 22 PATHWAY Functional pathway to which the corresponding gene belongs to. Information taken from the KEGG pathway database 23 GO Gene ontology IDs that are related to the correspondin gene. Information from GO.org 24 GO_DESC Description of the GO Ids
4 CONSERVE D SCORE FILTER DP A C G T conserved StdFilter PASS conserved PASS StdFilter conserved StdFilter PASS PASS conserved StdFilter conserved PASS CONSERVED Conserved elements produce by the phastcons program based on a whole-genome alignment of 46 vertebrates. Information taken from UCSC 26 SCORE Probability that REF/ALT polymorphism exists at this site given the sequencing data. In phred scale 27 FILTER Default filters for SNPs: StdFilter (QUAL<50.0 AB >0.75 FS > QD < 5.0 HRun > 5.0), LowD (DP < 6.0), Hard2Validate (MQ0 >= 4.0 && MQ0/DP> 0.1) Default filters for Indels: StdFilter (QUAL<50.0 FS > QD < 2.0), LowD (DP <6 ) Variant passing the default filters will be tagged as PASS 28 DP Total depth of reads 29 A A s observed at the variant position 30 C C s observed at the variant position 31 G G s observed at the variant position 32 T T s observed at the variant position FS QD MQ AB GT GQ LKH /1 99 0:1:0
5 /1 99 0:0: /1 99 0:1: /1 99 0:1: /1 99 0:0: /1 99 0:1: /1 99 0:1: /1 99 0:1: /1 99 0:1:0 33 FS Strand Bias. Evidence for the variation of the reads to be seen only on the forward or only in te reverse strand. Higher values denote more bias and therfore are more likely to indicate fasle positive calls 34 QD Quality by depth. Variant confidence. Low scores are indicative of fals positive calls and artifacts 35 MQ Mapping quality 36 AB Allele balance of REF/ALT in heterozygous 37 GT The genotype of this sample. Possible values are heterozygous (0/1: 1 REF and 1 ALT) and homozygous (1/1: 2 ALT alleles) 38 GQ Genotype quality. In Phred scale 39 LKH Likelihoods of the 3 genotypes.
Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationVariant Annotation and Functional Prediction
Variant Annotation and Functional Prediction Copyrighted 2018 Isabelle Schrauwen and Suzanne M. Leal This exercise touches on several functionalities of the program ANNOVAR to annotate and interpret candidate
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationReporting TP53 gene analysis results in CLL
Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review
More information6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels
Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA
More informationHome Brewed Personalized Genomics
Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome
More informationConcurrent Practical Session ACMG Classification
Variant Effect Prediction Training Course 6-8 November 2017 Prague, Czech Republic Concurrent Practical Session ACMG Classification Andreas Laner / Anna Benet-Pagès 1 Content 1. Background... 3 2. Aim
More informationClinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues
Clinical Genetics Leading the way in genetic issues Functional validation in a diagnostic context Robert Hofstra Clinical Genetics Leading the way in genetic issues Future application of exome sequencing
More informationp.arg119gly p.arg119his p.ala179thr c.540+1g>a c.617_633+6del Prediction basis structure
a Missense ATG p.arg119gly p.arg119his p.ala179thr p.ala189val p.gly206trp p.gly206arg p.arg251his p.ala257thr TGA 5 UTR 1 2 3 4 5 6 7 3 UTR Splice Site, Frameshift b Mutation p.gly206trp p.gly4fsx50 c.138+1g>a
More informationCITATION FILE CONTENT/FORMAT
CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined
More informationGenome Summary. Sequencing Coverage: Variation Counts: Known Phenotype Summary: 131 disease or trait variations are found in this genome
Report Date: August 2, 215 Software Annotation Version: 8 Genome Summary Name: Greg Mendel Genome ID: genome_greg_mendel_dad Sequencing Provider: 23andMe Sequencing Type: Genotyping SNP Array Sequencing
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationProtein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies
Protein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies Dr. Maricel G. Kann Assistant Professor Dept of Biological Sciences UMBC 2 The term protein domain
More informationUsing SuSPect to Predict the Phenotypic Effects of Missense Variants. Chris Yates UCL Cancer Institute
Using SuSPect to Predict the Phenotypic Effects of Missense Variants Chris Yates UCL Cancer Institute c.yates@ucl.ac.uk Outline SAVs and Disease Development of SuSPect Features included Feature selection
More informationShashikant Kulkarni, M.S (Medicine)., Ph.D., FACMG Associate Professor of Pathology & Immunology Associate Professor of Pediatrics and Genetics
Shashikant Kulkarni, M.S (Medicine)., Ph.D., FACMG Associate Professor of Pathology & Immunology Associate Professor of Pediatrics and Genetics Director of Cytogenomics and Molecular Pathology Evidence-based
More informationSupplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
More informationData mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationMODULE 3: TRANSCRIPTION PART II
MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationCHAPTER IV RESULTS Microcephaly General description
47 CHAPTER IV RESULTS 4.1. Microcephaly 4.1.1. General description This study found that from a previous study of 527 individuals with MR, 48 (23 female and 25 male) unrelated individuals were identified
More informationGenetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT
GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes
More informationSTATISTICAL METHODS IN BIOLOGY
STATISTICAL METHODS IN BIOLOGY JOANNA SZYDA MAGDALENA FRĄSZCZAK INTRODUCTION 1. Statistical methods in biology??? 2. The Biostatistic Group current projects 3. Course contents 4. Contact 5. Literature
More informationSpliceDB: database of canonical and non-canonical mammalian splice sites
2001 Oxford University Press Nucleic Acids Research, 2001, Vol. 29, No. 1 255 259 SpliceDB: database of canonical and non-canonical mammalian splice sites M.Burset,I.A.Seledtsov 1 and V. V. Solovyev* The
More informationMutationTaster & RegulationSpotter
MutationTaster & RegulationSpotter Pathogenicity Prediction of Sequence Variants: Past, Present and Future Dr. rer. nat. Jana Marie Schwarz Klinik für Pädiatrie m. S. Neurologie Exzellenzcluster NeuroCure
More informationAnnotation of Drosophila mojavensis fosmid 8 Priya Srikanth Bio 434W
Annotation of Drosophila mojavensis fosmid 8 Priya Srikanth Bio 434W 5.1.2007 Overview High-quality finished sequence is much more useful for research once it is annotated. Annotation is a fundamental
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Missense damaging predictions as a function of allele frequency
Supplementary Figure 1 Missense damaging predictions as a function of allele frequency Percentage of missense variants classified as damaging by eight different classifiers and a classifier consisting
More informationVariant Detection & Interpretation in a diagnostic context. Christian Gilissen
Variant Detection & Interpretation in a diagnostic context Christian Gilissen c.gilissen@gen.umcn.nl 28-05-2013 So far Sequencing Johan den Dunnen Marja Jakobs Ewart de Bruijn Mapping Victor Guryev Variant
More informationWelcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm
Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease
More informationColorspace & Matching
Colorspace & Matching Outline Color space and 2-base-encoding Quality Values and filtering Mapping algorithm and considerations Estimate accuracy Coverage 2 2008 Applied Biosystems Color Space Properties
More informationSupplementary Information
1 Supplementary Information MATERIALS AND METHODS Study subjects Exome-sequenced HBOC patients Clinical characteristics of 24 exome-sequenced HBOC patients are presented in Table 1. Table 1. Clinical characteristics
More informationTP53 mutational profile in CLL : A retrospective study of the FILO group.
TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationWHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS
WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS SUMMARY Tran Thi Bich Ngoc 1 ; Ho Viet Hoanh 2 ; Vu Phuong Nhung 1 ; Nguyen Hai Ha 1 Nguyen Van Ba 2 ; Nguyen
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationWhole exome sequencing identifies a novel DFNA9 mutation, C162Y
Clin Genet 2013: 83: 477 481 Printed in Singapore. All rights reserved Short Report 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd CLINICAL GENETICS doi: 10.1111/cge.12006 Whole exome
More informationSupplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
More informationDeliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing
GA N 668353 H2020 Research and Innovation Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing WP N and Title: WP2 - Towards shared European Guidelines for PGx Lead beneficiary:
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationVariant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18
Variant interpretation exercise ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Format of exercise Compile a list of tricky variants across solid cancer and haematological malignancy.
More informationEIGEN: A SPECTRAL APPROACH TO THE INTEGRATION OF FUNCTIONAL GENOMICS ANNOTATIONS FOR BOTH CODING AND NONCODING SEQUENCE VARIANTS
EIGEN: A SPECTRAL APPROACH TO THE INTEGRATION OF FUNCTIONAL GENOMICS ANNOTATIONS FOR BOTH CODING AND NONCODING SEQUENCE VARIANTS IULIANA IONITA-LAZA 1,7,, KENNETH MCCALLUM 1,7, BIN XU 2, JOSEPH BUXBAUM
More informationPALB2 c g>c is. VARIANT OF UNCERTAIN SIGNIFICANCE (VUS) CGI s summary of the available evidence is in Appendices A-C.
Consultation sponsor (may not be the patient): First LastName [Patient identity withheld] Date received by CGI: 2 Sept 2017 Variant Fact Checker Report ID: 0000001.5 Date Variant Fact Checker issued: 12
More informationMolecular Diagnosis of Genetic Diseases: From 1 Gene to 1000s
ROMA, 23 GIUGNO 2011 Molecular Diagnosis of Genetic Diseases: From 1 Gene to 1000s USSD Lab Genetica Medica Ospedali Riuniti Bergamo The problem What does the clinician/patient want to know?? Diagnosis,
More informationA guide to understanding variant classification
White paper A guide to understanding variant classification In a diagnostic setting, variant classification forms the basis for clinical judgment, making proper classification of variants critical to your
More informationAnnotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009
Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009 1 Abstract A stretch of chimpanzee DNA was annotated using tools including BLAST, BLAT, and Genscan. Analysis of Genscan predicted genes revealed
More informationSupplementary information to:
Supplementary information to: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin Embedded Tumors by Next Generation Sequencing Authors
More informationSUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation.
SUPPLEMENTARY INFORMATION Intron retention is a widespread mechanism of tumor suppressor inactivation. Hyunchul Jung 1,2,3, Donghoon Lee 1,4, Jongkeun Lee 1,5, Donghyun Park 2,6, Yeon Jeong Kim 2,6, Woong-Yang
More informationMSI positive MSI negative
Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden
More informationSupplementary Figure 1. Estimation of tumour content
Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent
More informationIdentification of genomic alterations in cervical cancer biopsies by exome sequencing
Chapter- 4 Identification of genomic alterations in cervical cancer biopsies by exome sequencing 105 4.1 INTRODUCTION Athough HPV has been identified as the prime etiological factor for cervical cancer,
More informationNGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht
NGS panels in clinical diagnostics: Utrecht experience Van Gijn ME PhD Genome Diagnostics UMCUtrecht 93 Gene panels UMC Utrecht Cardiovascular disease (CAR) (5 panels) Epilepsy (EPI) (11 panels) Hereditary
More informationSpectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals
Bansal et al. BMC Medicine (2017) 15:213 DOI 10.1186/s12916-017-0977-3 RESEARCH ARTICLE Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationFunctional analysis of DNA variants
Functional analysis of DNA variants GS011143, Introduction to Bioinformatics The University of Texas GSBS program, Fall 2012 Ken Chen, Ph.D. Department of Bioinformatics and Computational Biology UT MD
More informationCardiology Genetics Report Long QT Syndrome (LQTS) Panel
Patient Name: Test(s) Requested: The ordered test and the genes analyzed are Genes Evaluated (Disease): Result: Only mutations detected appear here KCNQ1 (LQT1 and Jervell and LangeNielsen syndrome), KCNH2
More informationA rare variant in MYH6 confers high risk of sick sinus syndrome. Hilma Hólm ESC Congress 2011 Paris, France
A rare variant in MYH6 confers high risk of sick sinus syndrome Hilma Hólm ESC Congress 2011 Paris, France Disclosures I am an employee of decode genetics, Reykjavik, Iceland. Sick sinus syndrome SSS is
More informationRare Variant Burden Tests. Biostatistics 666
Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls
More informationFor all of the following, you will have to use this website to determine the answers:
For all of the following, you will have to use this website to determine the answers: http://blast.ncbi.nlm.nih.gov/blast.cgi We are going to be using the programs under this heading: Answer the following
More informationSCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab
SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline
More informationViral and Host Factors in Vulvar Disease DR MICHELLE ETHERSON 26 TH OF APRIL 2016
Viral and Host Factors in Vulvar Disease DR MICHELLE ETHERSON 26 TH OF APRIL 2016 Human Papillomavirus (HPV) Small non-enveloped Double stranded DNA Virus Genome 8000 basepairs 8 coding genes, Early (E)
More informationAuthor's response to reviews
Author's response to reviews Title: EPHB2 germline variants in patients with colorectal cancer or hyperplastic polyposis Authors: Antti Kokko (antti.kokko@helsinki.fi) Paivi Laiho (paivi.laiho@helsinki.fi)
More informationMolecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report of Four Novel Mutations
Korean J Lab Med 2010;30:190-4 DOI 10.3343/kjlm.2010.30.2.190 Original Article Diagnostic Genetics Molecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report
More informationFINAL ANNOTATION REPORT: Drosophila virilis Fosmid 11 (48P14) Robert Carrasquillo Bio 4342
FINAL ANNOTATION REPORT: Drosophila virilis Fosmid 11 (48P14) Robert Carrasquillo Bio 4342 2006 TABLE OF CONTENTS I. Overview... 3 II. Genes... 4 III. Clustal Analysis... 15 IV. Repeat Analysis... 17 V.
More informationvariant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still
157 Neurological disorders primarily affect and impair the functioning of the brain and/or neurological system. Structural, electrical or metabolic abnormalities in the brain or neurological system can
More informationTITLE: - Whole Genome Sequencing of High-Risk Families to Identify New Mutational Mechanisms of Breast Cancer Predisposition
AD Award Number: W81XWH-13-1-0336 TITLE: - Whole Genome Sequencing of High-Risk Families to Identify New Mutational Mechanisms of Breast Cancer Predisposition PRINCIPAL INVESTIGATOR: Mary-Claire King,
More informationCRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
More informationLecture 20. Disease Genetics
Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying
More informationCase Report Intermediate MCAD Deficiency Associated with a Novel Mutation of the ACADM Gene: c.1052c>t
Case Reports in Genetics Volume 215, Article ID 5329, 4 pages http://dx.doi.org/1.1155/215/5329 Case Report Intermediate MCAD Deficiency Associated with a Novel Mutation of the ACADM Gene: c.152c>t Holli
More informationNext generation sequencing of BRCA1 and BRCA2 in breast cancer patients and control subjects
MOLECULAR AND CLINICAL ONCOLOGY 2: 435-439, 2014 Next generation sequencing of BRCA1 and BRCA2 in breast cancer patients and control subjects LUBOMIR BALABANSKI 1*, GEORGI ANTOV 2*, IVANKA DIMOVA 3, SAMUIL
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Systematic investigation of cancer-associated somatic point mutations in SNP databases HyunChul Jung 1,2, Thomas Bleazard 3, Jongkeun Lee 1 and Dongwan Hong 1 1. Cancer Genomics
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationSUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more
More informationNature Genetics: doi: /ng Supplementary Figure 1. Country distribution of GME samples and designation of geographical subregions.
Supplementary Figure 1 Country distribution of GME samples and designation of geographical subregions. GME samples collected across 20 countries and territories from the GME. Pie size corresponds to the
More informationMutational and phenotypical spectrum of phenylalanine hydroxylase deficiency in Denmark
Clin Genet 2016: 90: 247 251 Printed in Singapore. All rights reserved Short Report 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12692 Mutational and
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationThe coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation
The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation Anita Becker-Heck#, Irene Zohn#, Noriko Okabe#, Andrew Pollock#, Kari Baker Lenhart,
More informationBio 312, Spring 2017 Exam 3 ( 1 ) Name:
Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Please write the first letter of your last name in the box; 5 points will be deducted if your name is hard to read or the box does not contain the correct letter.
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationBio 111 Study Guide Chapter 17 From Gene to Protein
Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and
More informationTHE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS. Pr. Thierry Soussi
THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS Pr. Thierry Soussi thierry.soussi@ki.se thierry.soussi@upmc.fr TP53: 33 YEARS AND COUNTING STRUCTURE FUNCTION RELATIONSHIP OF WILD AND MUTANT TP53 1984
More informationNature Genetics: doi: /ng Supplementary Figure 1. Brain magnetic resonance imaging in patient 9 at age 3.6 years.
Supplementary Figure 1 Brain magnetic resonance imaging in patient 9 at age 3.6 years. (a d) Axial T2-weighted images show a marked degree of ventriculomegaly. Note the diencephalic mesencephalic junction
More informationA total of 2,822 Mexican dyslipidemic cases and controls were recruited at INCMNSZ in
Supplemental Material The N342S MYLIP polymorphism is associated with high total cholesterol and increased LDL-receptor degradation in humans by Daphna Weissglas-Volkov et al. Supplementary Methods Mexican
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency
More informationBRCA1 and BRCA2 germline muta-ons in Moroccan breast/ovarian cancer families
BRCA1 and BRCA2 germline muta-ons in Moroccan breast/ovarian cancer families A Tazzite a, H Jouhadi b, A Benider b, K Hamzi a and S Nadifi a a Genetics and Molecular Pathology Laboratory, Medical School
More informationiplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
More informationPirna Sequence Variants Associated With Prostate Cancer In African Americans And Caucasians
Yale University EliScholar A Digital Platform for Scholarly Publishing at Yale Public Health Theses School of Public Health January 2015 Pirna Sequence Variants Associated With Prostate Cancer In African
More informationGenome Summary. Sequencing Coverage: Variation Counts: Known Phenotype Summary: 106 disease or trait variations are found in this genome
Report Date: August 24, 2016 Software Annotation Version: 8 Genome Summary Name: (unknown) Genome ID: GFG_filtered_unphased_genotypes Sequencing Provider: (unknown) Sequencing Type: (unknown) Sequencing
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10643 Supplementary Table 1. Identification of hecw-1 coding polymorphisms at amino acid positions 322 and 325 in 162 strains of C. elegans. WWW.NATURE.COM/NATURE 1 Supplementary Figure
More informationVARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN
VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN Email: apatwardhan@personalis.com MICHAEL CLARK Email: michael.clark@personalis.com ALEX MORGAN Email:
More informationGenetics. Instructor: Dr. Jihad Abdallah Transcription of DNA
Genetics Instructor: Dr. Jihad Abdallah Transcription of DNA 1 3.4 A 2 Expression of Genetic information DNA Double stranded In the nucleus Transcription mrna Single stranded Translation In the cytoplasm
More informationGene Finding in Eukaryotes
Gene Finding in Eukaryotes Jan-Jaap Wesselink jjwesselink@cnio.es Computational and Structural Biology Group, Centro Nacional de Investigaciones Oncológicas Madrid, April 2008 Jan-Jaap Wesselink jjwesselink@cnio.es
More informationBeta Thalassemia Case Study Introduction to Bioinformatics
Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha
More informationGenetic Approaches to Alcoholism, Alcohol Abuse Susceptibility, and Therapeutic Response. Ray White Verona March
Genetic Approaches to Alcoholism, Alcohol Abuse Susceptibility, and Therapeutic Response Ray White Verona March 18. 2008 Craig Venter Genome 2,810,000,000 bases, 7.5-fold coverage 3,213,401 SNPs 85% in
More informationSupplemental Table 1. Components of MDS and AHEI
Supplemental Table 1. Components of MDS and AHEI MDS AHEI Vegetable Fruit SSB & fruit juice Nut Legume Whole grain Fish Red meat MUFA/SAT ratio EPA & DHA PUFA Trans-fat Alcohol Sodium MDS: Mediterranean-style
More informationMolecular Diagnostic Laboratory 18 Sequencing St, Gene Town, ZY Tel: Fax:
Molecular Diagnostic Laboratory 18 Sequencing St, Gene Town, ZY 01234 Tel: 555-920-3333 Fax: 555-920-3334 www.moldxlaboratory.com Patient Name: Jane Doe Specimen type: Blood, peripheral DOB: 04/05/1990
More informationPROGRESS: Beginning to Understand the Genetic Predisposition to PSC
PROGRESS: Beginning to Understand the Genetic Predisposition to PSC Konstantinos N. Lazaridis, MD Associate Professor of Medicine Division of Gastroenterology and Hepatology Associate Director Center for
More information