Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Similar documents
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Supplementary Figure 1. Effect of cellular glycolysis on tumor cell exosome secretion. A549 cells were cultured in medium containing different

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Figure 1

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

SUPPLEMENTARY INFORMATION

CRISPR/Cas9 cleavage of viral DNA efficiently suppresses hepatitis B virus

Supplementary Figure 1

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

SUPPLEMENTARY FIGURES AND TABLE

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

T H E J O U R N A L O F C E L L B I O L O G Y

2.5. AMPK activity

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

Supplementary Figures

Supplemental Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Supplementary Information

Supplementary figures

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion

Auxin-Inducible Degron (AID) System Total Set

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

SUPPLEMENTARY INFORMATION

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary information. The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit

Supporting Information

SUPPLEMENTARY INFORMATION

Supplemental information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

Supplementary information

F-actin VWF Vinculin. F-actin. Vinculin VWF

Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

SUPPLEMENTARY FIGURES

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Materials for

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.

Your Gene ATG GGT. pd1118 EF1a-ORF, Lenti-ElecD 7803 bp

Supplemental Figure 1

SUPPLEMENTARY LEGENDS...

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary Materials for

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

~Lentivirus production~

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression

s u p p l e m e n ta ry i n f o r m at i o n

Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

supplementary information

Supplementary Data Table of Contents:

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

fig. S1 Gene silencing of LC3B by sirna enhances IL-1β secretion. Peritoneal

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Information for. Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling. Marilyn D. Resh 1,2,6*

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

mock! A3AC106S! A3BE255Q! 86.7! 90.1! 88.0! 89.8! 89.0!

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

Supplemental Figures:

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Mesenchymal Stem Cells and Cancer: Their Interplay

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Figure 1 hlrrk2 promotes CAP dependent protein translation.

Supporting Information Table of content

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental Information

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells

Supplementary information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1

Transcription:

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid pcdna 3.1 transfected hmscs (3.1-hMSCs) were used as negative controls. (b) Western blots showed the overexpression of COX-1-10aa-PGIS fusion protein in PGI2-hMSCs. -actin was used as a loading control. (c) PGI2-hMSCs produced significantly higher levels of 6-keto PGF1α than did negative controls. **P<0.01, PGI2-hMSCs vs native hmscs and 3.1-hMSCs. Data are shown as mean±s.e.m from 5 replicates and are representative of 3 independent experiments with similar results. A 1-way ANOVA with Newman Keuls post hoc test was used to determine statistical significance.

Supplementary Figure 2. hmscs were efficiently transduced with the lentiviral vector containing triple fusion reporters. (a) Diagrammatic representation of the lentiviral vector encoding genes for herpes virus 1thymidine kinase (HSV1-tk), mcherry fluorophore, and firefly luciferase genes. (b) Representative photomicrograph and its corresponding florescence image showing the expression of red florescent mcherry protein in lentiviral transduced hmscs. Scale bar, 100 μm. (c) High efficiency of lentiviral transduction in hmsc was confirmed by flow cytometry analysis. (d) Representative in vitro bioluminescent images from hmscs transduced with the lentiviral vector. Cells were consecutively diluted in a 6-well plate. (e) A linear in vitro relationship between bioluminescent signal intensity and cell numbers.

Supplementary Figure 3. Coculturing myoblasts with PGI2-hMSCs reduced cell death under hypoxic conditions. (a) Cell death at 24 and 48 hours was significantly reduced in primary myoblasts that were cocultured with PGI2-hMSCs or 3.1-hMSCs+ILO as compared with those cocultured with 3.1-hMSCs. (b) H19 silencing by sirna (H19 KD) significantly reduced H19 levels in primary myoblasts as compared to control myoblasts (transfected with scrambled sirna). (c) H19 silencing also significantly decreased the number of viable cells and (d) increased cell death. *P<0.05; **P<0.01. Statistical significance was determined by 1-way ANOVA with Newman Keuls post hoc test (a) and a two-tailed t test (b,c,d). Data are shown as mean±s.e.m from 3-4 replicates and are representative of 3 independent experiments with similar results.

Supplementary Figure 4. H19 lncrna promoted C2C12 myoblast survival under hypoxia (1.5% O2). (a) H19 transcripts were significantly increased in C2C12 myoblasts after coculture with PG2-hMSCs or 3.1-hMSCs+ILO in a hypoxic incubator for 24 hours but not for 48 hours as compared to those cocultured with 3.1-hMSCs. (b) At 24 hours, the number of viable C2C12

hmscs 3.1-hMSCs PGI 2 -hmscs hmscs 3.1-hMSCs PGI 2 -hmscs myoblasts was comparable among the 3 cocultured groups, but the number of viable cells increased significantly at 48 hours after coculture with PGI2-hMSCs or 3.1-hMSCs+ILO. (c) H19 lncrna levels were significantly reduced in C2C12 myoblasts after specific knockdown with H19 sirna (H19 KD) when compared with negative control sirna (scrambled sirna). (d) H19 silencing significantly reduced the number of viable cells. (e) The prostacyclin analogue iloprost (ILO) did not stimulate H19 expression in myoblasts under hypoxia. Levels of H19 transcripts were comparable in C2C12 cells not treated with ILO, C2C12 cells treated with ILO, and C2C12 cells cocultured with 3.1-hMSCs in a hypoxic incubator for 24 and 48 hours. **P<0.01. Statistical significance was determined by 1-way ANOVA with Newman Keuls post hoc test (a,b) and a two-tailed t test (c,d). Data are shown as mean±s.e.m from 3-4 replicates and are representative of 3 independent experiments with similar results. kda kda 250 130 100 70 55 35 25 15 COX-1-10aa-PGIS COX-1 250 130 100 70 55 35 25 15 β-actin Supplementary Figure 5. Uncropped western blot images of Supplementary Figure1b. Cyclooxygenase-1 (COX-1) antibody detected the expression of the triple-catalytic enzyme (COX-1-10aa-PGIS) with a molecular mass of 130kDa in PGI2-hMSCs and the ubiquitously expressed form of COX-1 (70kDa) in hmscs, 3.1-hMSCs, and PGI2-hMSCs.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback