Supporting Information Gack et al. 1.173/pnas.8494715 SI Text Cell Culture, Transfection, and Reagents. HEK293T, MEF, Vero, EcoPack2-293 (D iosciences), HeLa, HCT116, Huh7, NHLF, 2fTGH wild-type, U3A, and U6A cells (provided by George Stark, Cleveland Clinic Foundation, Cleveland, OH) were cultured in Dulbecco s Modified Eagle s Medium (DMEM) supplemented with 1% FS, 2 mm l-glutamine, and 1% penicillinstreptomycin (GICO RL). LnCap human prostate cancer cells were cultured in RPMI medium164 supplemented with 1% FS, 2 mm l-glutamine, and 1% penicillin-streptomycin. Lymphatic endothelial cells (LECs) were cultured in endothelial growth medium (EGM-2) supplemented with the microvascular supplement pack (Clonetics). Transient transfections were performed with Lipofectamine (Invitrogen), FuGENE 6 (Roche) or calcium phosphate (Clontech) according to the manufacturer s instructions. RIG-I and knockout MEFs were immortalized as described in ref. 1. To obtain stable RIG-I MEF cells, pabe-puro vector, pabe-puro-rig-i, pabe- Puro-RIG-I T 55 I, or pabe-puro-rig-i retrovirus was produced in Ecopack2-293. After retroviral infection of RIG-I knockout MEFs, cells were selected by using 1 g/ml puromycin. Plasmid Construction. All constructs for transient and stable expression in mammalian cells were derived from peg GST fusion vector, pef-ires-puro, or pabe-puro expression vector. DNA fragments corresponding to the coding sequence of the RIG-I and TRIM genes were amplified from template DNA by PCR and subcloned into plasmid peg between KpnI and NotI, into pef-ires-puro between AflII and NotI or into pabe-puro between amhi and SalI restriction sites. V5-, Flag-, or Myc-tagged TRIM and RIG-I constructs were expressed from a modified pires-puro encoding a C-terminal V5, Flag, or Myc tag, respectively. RIG-I mutants were generated by PCR using site-directed mutagenesis or overlapping PCR. All constructs were sequenced using an AI PRISM 377 automatic DNA sequencer to verify % conformance with the original sequence. RT-PCR. HEK293T cells and LECs were mock-treated, infected with HA units/ml SeV (Cantrell strain; Charles River), or stimulated with 1, units/ml IFN- (Sigma) or 1 M all-trans retinoic acid (Sigma). Furthermore, HCT116, Huh7, HeLa, LnCap, NHLF, 2fTGH wild-type, U3A, and U6A cells were treated with 1, units/ml IFN- (Sigma) or 1, units/ml IFN- (GeneTex). Total cellular RNA was extracted by using the RNeasy Plus mini kit (Qiagen). RNA (1 5 g) was used for cdna synthesis using the SuperScript III First Strand kit (Invitrogen), followed by PCR using RIG-I gene-specific primers. To screen for splice variants of the RIG-I CARDs, the forward primer 5 -(ATAGGATCCATCCTGAGCTACATG- GCCCCCTGG)-3 and the reverse primer 5 -(TTCCACAAC- CTGTAGGAGCACATA)-3 were used. To amplify specifically RIG-I or RIG-I splice variant transcripts, we used the following primer sets: forward 5 -(TGGTTCCGTGGCTTTT- TGGATGCC)-3 and reverse 5 -(TTCCACAACCTGTAG- GAGCACATA)-3 for RIG-I ; forward 5 -(CCCTGGTT- TAGGGAGGGTTATTCT)-3 and reverse 5 -(TTCCACAAC- CTGTAGGAGCACATA)-3 for the RIG-I splice variant. -Actin was amplified by using TGGACATCCGCAAAGACCTG (forward) and CCGATCCACACGGAGTACTT (reverse). Molecular Cloning of RIG-I Splice Variant. HEK293T cells were treated with IFN- (1, units/ml) for 24 h. Total RNA was extracted by using the RNeasy Plus mini kit (Qiagen) and reverse transcribed by using Long Range 2Step RT-PCR kit (Qiagen). From the resulting cdnas, RIG-I and splice variant were amplified by using the following primers: forward 5 - (ATGACCACCGAGCAGCGACGCAGC)-3 and reverse 5 - (TCATTTGGACATTTCTGCTGGATC)-3. The resulting amplicon of 2.7 kb was digested with SacI to specifically digest RIG-I but not RIG-I splice variant transcripts. After cloning into the pgem-teasy vector (Promega), clones were subjected to sequence analysis using an AI PRISM 377 automatic DNA sequencer. GST Pulldown Assay, Immunoprecipitation, and Immunoblot Analysis. HEK293T cells were lysed in Nonidet P-4 buffer [5 mm Hepes (ph 7.4), 15 mm NaCl, 1% (vol/vol) Nonidet P-4, and protease inhibitor mixture (Roche)]. GST pulldown and immunoprecipitations were performed as described in ref. For immunoblotting, proteins were resolved by SDS/PAGE and transferred onto a PVDF membrane. The following primary antibodies were used: anti-v5 (1:5,) (Invitrogen), anti-flag (1:5,) (Sigma), anti-ha (1:5,) (Sigma), anti-myc (1:5,) (Convance), anti- GST (1:1,) (Sigma), anti-actin (1:1,) (Abcam), antiubiquitin (P4D1; Santa Cruz iotechnology), anti-trim (D iosciences), monoclonal anti-rig-i (1:1,) (Alexis), polyclonal anti-rig-i (1:) (IL), anti-irf3 (1:5) (Santa Cruz iotechnology), and anti-phospho-ser 396 -IRF3 (1:) (Upstate iotechnology). The proteins were visualized by an enhanced chemiluminescence reagent (Pierce) and detected by a phospho imager (Fuji LAS-4). Protein Expression, Fluorescence and Anisotropy Measurement. Protein expressions of RIG-I and RIG-I splice variant in insect cells were performed as described in ref. 2. Proteins were purified to homogeneity by using metal affinity (Qiagen), anion exchange and gel filtration chromatography with standard protocols. Fluorescence anisotropy experiments were performed with a FluoroMax-P fluorimeter (Horiba Jobin Yvon), equipped with a Glan Thompson prism polarizer. Typically, 1.2 ml of buffer [ mm Tris HCl (ph 7.5), 15 mm NaCl, 2 mm DTT, and 1 M ZnCl 2 ] and 5 nm RNA (in vitro-transcribed ppprvl with incorporated Alexa Fluor 488 5-UTP) were preequilibrated in a quartz cuvette at 12 C. Protein samples were added in a stepwise manner and briefly mixed by magnetic stirring. After 3 min of reequilibration, the anisotropy data were measured in triplets for each titration step by using an excitation wavelength of 492 nm and monitoring the emission 516 nm. The band pass was 5 nm for excitation and 5 nm for emission. Luciferase Reporter Assay. HEK293T, HCT116, Huh7, and HeLa cells were seeded into six-well plates. At 24 h, the cells were transfected with an IFN- or NF- luciferase construct together with constitutive -gal-expressing pgk- -gal. At 24 h after transfection, the cells were mock-treated or infected with SeV (5 HA units/ml) for 16 h. s were prepared and subjected to a luciferase assay (Promega). Luciferase values were normalized to -galactosidase to measure transfection efficiency. IFN- ELISA and V replication. HEK293T cells were seeded into a 12-well plate and mock-infected or infected with SeV (5 HA Gack et al. www.pnas.org/cgi/content/short/8494715 1of11
units/ml) for h. The supernatants were collected and analyzed for IFN- production by using enzyme-linked immunosorbent assays (PL iomedical Laboratories). For viral replication assays, stable HEK293T or RIG-I knockout MEFs were seeded into six-well plates and infected with V-eGFP at MOI.5. At 24 48 h after infection, the culture medium was harvested and the virus yield determined by plaque assay on Vero cells. 1. Gack MU, et al. (7) TRIM RING-finger E3 ubiquitin ligase is essential for RIG-Imediated antiviral activity. Nature 446:916 9. 2. Cui S, et al. (8) The C-terminal regulatory domain is the RNA 5 -triphosphate sensor of RIG-I. Mol Cell 29:169 179. Gack et al. www.pnas.org/cgi/content/short/8494715 2of11
2CARD 1 st CARD 2 nd CARD tor + - + - + - TRIM-V5 - + - + - + NF-κ luciferase activity 5 37 I: αgst I: αub 5 4 3 1 TRIM - + - + - + - + GST 2CARD 1 st CARD 2 nd CARD Fig. S1. The intact tandem CARD of RIG-I is required for TRIM-mediated RIG-I ubiquitination and downstream signaling. (A) oth CARDs are required for TRIM-mediated RIG-I ubiquitination. HEK293T cells were transfected with GST-RIG-I 2CARD, GST-RIG-I first CARD, or GST-RIG-I second CARD with or without V5-tagged TRIM. s were used for GST pull down (GST-PD), followed by I with -GST (Top)or -Ub (Middle) to show the ubiquitination of RIG-I constructs. s were used for immunoblotting (I) with -V5 (ottom). Arrows indicate the ubiquitinated bands. () oth CARDs are necessary for TRIM-induced RIG-I NF- activation. HEK293T were transfected with GST, GST-RIG-I 2CARD, GST-RIG-I first CARD, or GST-RIG-I second CARD with or without TRIM together with NF- luciferase and constitutive -gal-expressing pgk- -gal reporter. Luciferase values were determined and normalized to -galactosidase. Data represent the mean SD (n 3). Gack et al. www.pnas.org/cgi/content/short/8494715 3of11
GST T 55I I: αtrim RIG-I 2CARD-Flag GST + - GST-MAVS-CARD-PRD - + 5 37 I: αgst I: αtrim I: αgst C TRIM shrna GST + - - - - GST-RIG-I 2CARD - + + + + MAVS CARD-PRD-Flag + + + + + 5 37 I: αgst I: αub I: αtrim I: αactin (%) 8 6 4 14.9% 85.1% total RIG-I () ubiquitinated ubiquitinated non-ubiquitinated nonubiquitinated 49.8% 5.92% RIG-I bound to MAVS (GST-PD) Fig. S2. TRIM-mediated RIG-I ubiquitination is critical for RIG-I-MAVS interaction. (A) T 55 I mutation of RIG-I abolishes TRIM binding. At 48 h after transfection with GST, GST-RIG-I 2CARD, or GST-RIG-I 2CARD T 55 I mutant, s were used for GST-PD, followed by I with -TRIM (Top)or -GST (Middle). s were immunoblotted with -TRIM (ottom). Arrows indicate the ubiquitinated bands. () MAVS preferentially interacts with ubiquitinated RIG-I. (Upper) At 48 h after transfection with GST or GST-MAVS-CARD-PRD together with Flag-tagged RIG-I 2CARD, HEK293T s were used for GST-PD, followed by I with -Flag (Top) or -GST (Middle). s were used for I with -Flag to determine the expression of RIG-I 2CARD (ottom). Arrows indicate the ubiquitinated bands. (Lower) The quantitation of ubiquitinated and nonubiquitinated RIG-I bands in the s and in the GST-MAVS-CARD-PRD complex by using a Fuji phospho imager. (C) TRIM-mediated ubiquitination is necessary for efficient RIG-I-MAVS interaction. At 48 h after transfection with GST or GST-RIG-I 2CARD together with MAVS-CARD-PRD-Flag and increasing amount of TRIM shrna-specific retroviral psuper vector, HEK293T s were used for GST-PD, followed by I with -Flag, -GST, or -Ub. Arrows indicate the ubiquitinated bands. s were used for I with -TRIM or -Flag to show the expression of TRIM and MAVS-CARD-PRD, respectively. Loading control was determined by using an -actin antibody. Gack et al. www.pnas.org/cgi/content/short/8494715 4of11
IFN-β luciferase activity 5 37 GST T 55S T 55W T 55V I: αgst 16 14 1 8 6 4 GST T 55S T 55W T 55V I: αub NF-κ luciferase activity I: αtrim I: αtrim 6 5 4 3 1 GST T 55S T 55W T 55V Fig. S3. Mutation of T 55 to hydrophobic residues abolishes RIG-I CARD ubiquitination, TRIM binding, and RIG-I signaling. (A) Mutation of T 55 to hydrophobic residues abolishes RIG-I CARD ubiquitination and TRIM binding. At 48 h after transfection with GST, GST-RIG-I 2CARD, GST-RIG-I 2CARD T 55 S, GST-RIG-I 2CARD T 55 W, or GST-RIG-I 2CARD T 55 V, HEK293T s were subjected to GST-PD, followed by I with -GST, -Ub or -TRIM. To determine endogenous TRIM expression, s were subjected to I with -TRIM. Arrows indicate the ubiquitinated bands. () RIG-I T 55 W and T 55 V mutants show a near complete loss of downstream signaling activity. GST, GST-RIG-I 2CARD, GST-RIG-I 2CARD T 55 S, GST-RIG-I 2CARD T 55 W, or GST-RIG-I 2CARD T 55 V was expressed in HEK293T together with IFN- or NF- luciferase and pgk- -gal. At 36 h after transfection, the cells were harvested and the luciferase and -galactosidase values determined. Luciferase values, normalized to -galactosidase activity, are presented as. Data represent the mean SD (n 3). Gack et al. www.pnas.org/cgi/content/short/8494715 5of11
735 bp 63 bp - SeV 12 h 24 h 48 h - IFN-β RA 12 h 24 h 48 h 48 h 72 h 588 bp 588 bp 65 bp 65 bp actin - Flag - Flag actin IP: αrig-i I: αrig-i C I αrig-i (helicase) αrig-i (1 st CARD) IP: αrig-i Fig. S4. RIG-I splice variant transcript and protein. (A) RIG-I and splice variant transcripts and proteins in HEK293T upon SeV infection. HEK293T were mock-infected or infected with HA units/ml SeV for the indicated number of hours. To identify potential splice variants of the RIG-I CARDs, total cellular RNA was isolated and subjected to RT-PCR to amplify the RIG-I CARDs (exon 1 3) (Top). Transcript levels of RIG-I and the splice variant () were determined using primers specific for each isoform (Second and Third images). Actin transcripts were determined as control. Endogenous protein levels of RIG-I and upon SeV infection were evaluated by IP with -RIG-I followed by I with -RIG-I (ottom). Flag-tagged RIG-I and were loaded as controls. () RIG-I and splice variant transcript levels in LECs. LECs were mock-treated, treated with 1, units/ml IFN-, or1 all-trans retinoic acid (RA) for the indicated hours. Total cellular RNA was isolated and subjected to RT-PCR with primers specific for RIG-I or, respectively. Actin transcripts were determined as control.(c) Control IP for the RIG-I splice variant. s of HEK293T cells, treated with IFN- (1, U/ml) for 24 h, were used for immunoprecipitation with an -RIG-I antibody recognizing the central helicase domain (residues 1 713). Precipitated endogenous RIG-I and splice variant were determined by I with RIG-I antibodies, recognizing the helicase domain (residues 1 713) or first CARD (residues 37 55), respectively. Arrows indicate RIG-I or the splice variant. Gack et al. www.pnas.org/cgi/content/short/8494715 6of11
Fig. S5. IFN-dependent expression of RIG-I splice variant in various cell lines. (A) HeLa, HCT116, Huh7, LnCap, and NHLF cells were mock-treated or stimulated with 1, units/ml IFN- for 24 h. Total cellular RNA was isolated and subjected to RT-PCR with primers specific for RIG-I or, respectively. Actin transcripts were determined as control. () The 2fTGH wild-type, STAT1-deficient (U3A), and STAT2-deficient (U6A) human fibroblasts were mock-treated or treated with 1, units/ml IFN- or IFN- for 24 h. Total cellular RNA was isolated and subjected to RT-PCR with primers specific for RIG-I or, respectively. Actin transcripts were determined as control. Gack et al. www.pnas.org/cgi/content/short/8494715 7of11
TRIM SPRY-V5 5 37 GST 2CARD 2CARD I: αgst TRIM-V5 T 55 I K 172 R C T 55 I K 172 R + - + + + + : HA-K 63only -Ub D I: αha I: αha I: αactin 8 7 6 5 4 3 1 GST NF-κ luciferase activity TRIM-V5 - + - + - + 2CARD 2CARD Fig. S6. Abolished TRIM binding, ubiquitination, and signaling activity of RIG-I splice variant. (A) RIG-I but not RIG-I splice variant interacts with TRIM-SPRY. V5-tagged TRIM-SPRY together with GST, GST-RIG-I 2CARD, or GST-RIG 2CARD were expressed in HEK293T cells. At 48 h after transfection, cells were lysed, and s were subjected to GST-PD, followed by I with -V5 (Top) or -GST (Middle). s were used for I with -V5 to determine the expression of TRIM-SPRY (ottom). () RIG-I splice variant and RIG-I T 55 I do not interact with TRIM. After transfection of V5-tagged TRIM together with vector, Flag-tagged RIG-I, RIG-I T 55 I, RIG-I, or RIG-I K 172 R, HEK293T s were subjected to IP with -Flag, followed by I with -V5 (Top)or -Flag (Middle). s were used for I with -V5 to test the TRIM expression (ottom). (C) RIG-I splice variant exhibits a near-complete loss of K63-linked ubiquitination. Flag-tagged RIG-I, RIG-I T 55 I, RIG-I or RIG-I K 172 R together with HA-tagged K 63only -ubiquitin were expressed in HEK293T cells. At 24 h after transfection, the cells were infected with SeV ( HA units/ml) for 1 h. s were used for IP with -Flag, followed by I with -HA (Top) or -Flag (second). s were subjected to I with -HA to determine HA-ubiquitin expression (third). Loading control was determined by using an -actin antibody (fourth). (D) Lack of signaling activity of RIG-I splice variant. HEK293T were transfected with GST, GST-RIG-I 2CARD, or GST-RIG-I 2CARD with or without V5-tagged TRIM together with NF- luciferase and pgk- -gal. At 36 h after transfection, the cells were harvested, and luciferase and -galactosidase values were determined. Luciferase values were normalized to -galactosidase activity and are presented as. Data represent the mean SD (n 3). Gack et al. www.pnas.org/cgi/content/short/8494715 8of11
NF-κ luciferase activity 8 7 6 5 4 3 2 1 T 55 I Mock SeV Fig. S7. RIG-I splice variant inhibits SeV-induced NF- promoter activation. HEK293T were transfected with vector or increasing amount of RIG-I T 55 I or RIG-I splice variant () together with NF- luciferase and pgk- -gal. At 24 h after transfection, the cells were mock-infected or infected with SeV for 16 h. Luciferase and -galactosidase values were determined and NF- luciferase values normalized to -galactosidase activity for transfection efficiency control. Data represent the mean SD (n 3). Gack et al. www.pnas.org/cgi/content/short/8494715 9of11
HCT116 IFN-β luciferase activity 15 1 5 Mock SeV Huh7 IFN-β luciferase activity 35 3 15 1 5 Mock SeV 45 4 35 3 15 1 5 HeLa IFN-β luciferase activity Mock SeV Fig. S8. RIG-I splice variant inhibits SeV-induced IFN- promoter activation in various cell lines. HCT116, Huh7, and HeLa cells were transfected with vector or increasing amount of RIG-I splice variant () together with IFN- luciferase and pgk- -gal. At 24 h after transfection, the cells were mock-infected or infected with SeV for 16 h. Luciferase and -galactosidase values were determined and IFN- luciferase values normalized to -galactosidase activity for transfection efficiency control. Data represent the mean SD (n 3). Gack et al. www.pnas.org/cgi/content/short/8494715 1 of 11
.1 Anisotropy.8.6.4.2. 5 15 Protein [nm] -V5 - + + + + : RIG-I -Flag + + + + + : RIG-I -Myc I: αmyc C T 55I - - + - + + + - + + + + + + + + + + + + + :SeV : MAVS-Flag : RIG-I -Myc I: αmyc I: αmyc I: αmyc Fig. S9. (A) Fluorescence anisotropy changes of fluorescently labeled ppprvl in response to titration with RIG-I (filled square kd 233.39 35.47 nm) and RIG-I (open circles, kd 246.41 42.33 nm). The plot was non-linearly fitted according to a one-site binding model A max * [Protein] / (kd [Protein]). () RIG-I splice variant interferes with virus-induced RIG-I multimerization. HEK293T cells were transfected with vector, Myc-tagged RIG-I, Flag-tagged RIG-I and increasing amount of V5-tagged RIG-I. At 24 h posttransfection, the cells were infected with SeV for 16 h. Co-immunoprecipitation of Myc-RIG-I with Flag-RIG-I was determined by IP using -Flag followed by I with -Myc or -Flag. s were subjected to I with -Myc or -V5. (C) RIG-I splice variant inhibits the virus-induced RIG-I-MAVS-complex formation. HEK293T were cotransfected with Flag-tagged full-length MAVS and Myc-tagged RIG-I together with vector, V5-tagged RIG-I T 55 I, or splice variant () and subsequently either mock-treated or infected with SeV (5 HA units/ml) for 16 h. s were subjected to IP with -Flag, followed by I with -Myc or -Flag. s were subjected to I with -Myc or -V5. Gack et al. www.pnas.org/cgi/content/short/8494715 11 of 11