Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Similar documents
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

The novel herbal cocktail MA128 suppresses tumor growth and the metastatic potential of highly malignant tumor cells

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Clinician Blood Panel Results

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine

NORMAL LABORATORY VALUES FOR CHILDREN

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

A Toxicological Study of HangAmDan-B in Mice

Plasma exposure levels from individual mice 4 hours post IP administration at the

Rapid Laboratories In House Tests

Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

Clinician Blood Panel Results

JKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice

Step 2. Common Blood Tests, and the Coulter Counter Readout

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter

i. Where is the participant seen?

Understanding Blood Tests

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

Acute and Subacute Toxicities of the Ethanol Extract from Alternanthera philoxeroides Griseb.

e-figure 1. The design of the study.

Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female)

NOTE: This table will be discontinued after this lot.

Changes of hematological references depends on storage period and temperature conditions in rats and dogs

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

AVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC)

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens

The Complete Blood Count

Date Time By Code Description Qty (Variance) Photo

(control) or 16 h. The pretreated platelets were analyzed for mitochondrial membrane potential

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.

Delta Check Calculation Guide

International Journal of Pharma and Bio Sciences V1(2)2010

Supplementary Figure 1:

Acute and subchronic toxicity study of the water extract from Tiliacora triandra (Colebr.) Diels in rats

Clinical use of flow cytometry

Clinician Blood Panel Results

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Bone Marrow Pop. (% Total) Mature Pool (Absolute %) Immature Pool (Absolute %) A10 EC Control A10 EC Control A10 EC Control

COMPANY OR UNIVERSITY

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

2013/11/29 Version 2

A Study on the Relationship between CBC and EEG for Epilepsy Patients

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Supplemental Table 1. Effect of Testosterone Treatment on Organ Weight in Mice (% of body weight, mean ± SD).

Senior Executive Wellness Profile

Paper ID: ART

Lifeblood Lab Activity

Complete Medical History

Brief Communication Diagnostic Hematology

Interpreting Blood Tests Part 1. Dr Andrew Smith

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired

Chapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University.

TEST NAME/ PSYCHE CODE COLLECTION GUIDELINES REFERENCE VALUES ROOM TEMP. REFRIGERATED FROZEN

(PDGF), 9 ( -2 (FGF-2), SMO

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature

CASE-BASED SMALL GROUP DISCUSSION

Acute and subchronic toxicity study of the water extract from root of Sida rhombifolia Linn. in rats

Kathryn Jones 8/11/2015

Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD

Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator

Supplementary Data. Effect of repeat administration of human mesenchymal stem cells on clinical biochemistry in

Complete Blood Count (CBC)

CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells

CHARACTERISATION OF THE PHYSIOLOGICAL STATUS OF HARE HERDS

Hematopathology Case Study

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

CELL-DYN 3700 Strength in Technology, Proven Reliability

Nano Immuno Chemotherapy to treat cancers

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

Advanced Hematology Five-Part Differential. Simple Operation

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

Clinical implications for decreased lymphocytes (lymphopenia) o Corticosteroid therapy, adrenocortical hyperfunction, stress, shock

Quantitative Real-Time PCR was performed as same as Materials and Methods.

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

HM5. Hematology Analyzer BETTER. ACTUALLY.

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

SUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.

no concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis

Transcription:

Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim and Jin Yeul Ma* - Supplementary Table S1 - Supplementary Table S2 - Supplementary Table S3 - Supplementary Table S4 - Supplementary Figure S1 - Supplementary Figure S2 - Supplementary Figure S3 - Supplementary Figure S4 - Supplementary Figure S5 - Supplementary Figure S6 - Supplementary Figure S7 - Supplementary Figure S8 - Supplementary Figure S9 - Supplementary Figure S10 -

Table S1. Body weights of mice administrated with WEF or saline Treatment Body weight (g) Day 0 Day 7 Day 14 Control 16.01 ± 0.25 17.52 ± 0.65 18.62 ± 0.73 50 mg/kg 15.89 ± 0.16 17.73 ± 0.54 18.49 ± 0.19 Data are presented as mean S.D. Each group of female C57BL/6J mice (n=3) were orally administrated with 50 mg/kg of WEF or same volume of saline daily and weighed body weight at 0, 7, and 14 days.

Table S2. Organ weights of mice administrated with WEF or saline Treatment Weight of organs (g) Liver Heart Lung spleen Kidney (L) Kidney (R) Control 0.98 0.09 0.09 0.01 0.18 0.02 0.09 0.01 0.12 0.02 0.13 0.01 50 mg/kg 0.95 0.03 0.10 0.01 0.17 0.01 0.08 0.02 0.13 0.01 0.13 0.01 Data are presented as mean S.D. Each group of female C57BL/6J mice (n=3) were orally administrated with 50 mg/kg of WEF or same volume of saline daily, sacrificed at 15 days, and weighed organs.

Table S3. Chemical analysis of serums obtained from mice administrated with WEF or saline. Treatment GOT (IU/L) GPT (IU/L) BUN (mg/dl) CRE (mg/dl) Control 43.1 2.7 23.2 0.5 16.1 1.3 0.4 0.0 50 mg/kg 39.4 3.2 20.3 1.8 15.5 0.8 0.4 0.0 Data are presented as mean S.D. Each group of female C57BL/6J mice (n=3) were orally administrated with 50 mg/kg of WEF or same volume of saline daily, sacrificed at 15 days, and analyzed the levels of GOT, GPT, BUN, and CRE. GOT, glutamic oxaloacetic transaminase; GPT, glutamic pyruvic transaminase; BUN, blood urea nitrogen; CRE, creatinine.

Table S4. Hematological analysis of bloods obtained from mice administrated with WEF or saline. Parameter control 50 mg/kg WBCP ( 10 3 cells/ l) 2.4 0.19 2.4 0.23 WBCB ( 10 3 cells/ l) 2.5 0.32 2.4 0.41 RBC ( 10 6 cells/ l) 9.4 0.57 9.6 0.34 Means HGB (g/dl) 13.6 1.34 13.8 0.54 HCT (%) 49.6 2.17 50.7 1.43 MCV (fl) 53.3 0.23 53.1 0.11 MCH (pg) 14.7 0.21 14.5 0.17 MCHC (g/dl) 26.8 0.13 27.2 0.25 PLT ( 10 4 cells/ l) 92.5 3.12 94.3 1.92 % NEUT 6.7 1.32 6.9 0.82 % LYM 87.3 1.37 87.9 4.25 % MONO 0.5 0.01 0.6 0.17 Data are presented as mean S.D. Each group of mice (n=3) were orally administrated with 50 mg/kg of WEF or saline daily, sacrificed at 15 days, and analyzed hematologic parameters. CBC, complete blood cell count; WBCP, white blood cell count peroxidase method; WBCB, white blood cell count basophile method; RBC, red blood cell count; HGB, hemoglobin, HCT, hematocrit; MCV, mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration; PLT, platelet; NEUT, neutrophil; LYM, lymphocyte; MONO, monocyte.

Figure S1. WEF inhibits the migration and invasion of HT1080 cells. (A): After making wounds on the confluent cell monolayers, cells were incubated in the presence of 25, 50, and 100 g/ml WEF for 36 h. Cell migration was calculated based on the relative width of wound at 0 h and expressed as the mean SD of four selected fields. (B): Cells were pre-treated with 25, 50, and 100 g/ml WEF for 12 h. After harvest, cells (1 10 5 /100 l) suspended in serum-free RPMI was added into upper chamber of Transwell and lower chamber was filled with 600 l 10% FBS/RPMI. For invasion assay, Matrigel-coated Transwell was used. Cells migrated and invaded to the lower surface of the Transwell membrane were measured at 12 h and 24 h incubation, respectively. Data are representative of two independent experiments and expressed as the mean SD of five random fields of each well. #, p 0.01 vs. untreated control.

Figure S2. WEF reduces transcriptional expression of MMPs under PMA stimulation. HT1080 cells pretreated with 25, 50, and 100 g/ml WEF for 12 h in serum-free media were stimulated with 5 nm PMA for additional 24 h. MMPs mrna levels were measured by RT-PCR.

Figure S3. WEF suppresses MMP-9 gelatinolytic activity under PMA stimulation. This is a full length image of the cropped blot presented in the Figure 4B.

Figure S4. WEF suppresses PMA-induced p38 and JNK phosphorylation as well as NF-κB activation. These are full length images of the cropped blot presented in the Figure 5A and 5B.

Figure S5. WEF reduces TNF-α-induced MMP-9 expression and activity via suppression of NFκB activation in B16F10 cells. (A): B16F10 cells pretreated with 25, 50, and 100 g/ml WEF for 12 h in serum-free media were stimulated with TNF-α (10 ng/ml) for additional 24 h. MMP-9 mrna level and MMP-9 activity were measured by RT-PCR and gelatin zymography, respectively. (B): B16F10 cells were pretreated with WEF (100 g/ml) for 12 h and then stimulated with TNF-α (10 ng/ml) for 30, 60, and 180 min. Total cell lysates were subjected to Western blotting and relative ratios were calculated after normalization to tubulin. Data are representative of two independent experiments.

Figure S6. Inhibitory effect of WEF on vessel sprout formation is reversible. Aortic rings were first incubated with WEF-treated CMs of HT1080 or PC-3 and continued to culture in EGM-2 for another 72 h after CMs were removed.

Figure S7. WEF inhibits HIF-1α expression. HT1080 cells were pretreated with WEF (25, 50, and 100 g/ml) for 12 h, and then stimulated with 100 M CoCl 2 for 6 h. Total cell lysates were subjected to Western blotting to measure the levels of HIF-1α, phosphorylated Akt and mtor. After normalization to tubulin, the relative ratios were calculated. Data are expressed as the mean SD of two independent experiments. *, p 0.01 vs. untreated control.

Figure S8. WEF inhibits VEGF-α and HIF-1α expression. (A): B16F10 cells were pretreated with WEF (25, 50, and 100 g/ml) for 24 h and VEGF-α mrna levels were measured by RT- PCR. Relative ratio was quantified after normalization to GAPDH. (B): B16F10 cells were pretreated with WEF (25, 50, and 100 g/ml) for 12 h, and then stimulated with 100 M CoCl 2 for 3 h. Total cell lysates were subjected to Western blotting to measure the levels of HIF-1α, phosphorylated Akt and mtor. After normalization to tubulin, the relative ratios were calculated. Data are representative of two independent experiments.

Figure S9. No inhibitory effects of WEF on HUVEC migration and tube formation. (A): Matrigels mixed with bfgf (1 g/ml) and VEGF-α (100 ng/ml) in the presence of WEF were implanted and angiogenesis was examined after 14 days. (B): HUVEC capillary-like tube formation induced by bfgf (1 g/ml) and VEGF-α (100 ng/ml) in the presence of WEF was examined. (C): EGM-2 was added to the lower chamber, and HUVECs in EBM-2 were allowed to migrate in the presence of WEF (0, 25, 50, and 100 100 g/ml) for 24 h.

Figure S10. WEF inhibits HIF-1α expression and phosphorylation of Akt/mTOR. These are full length images of the cropped blot presented in the Figure 7C.