no concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis
|
|
- Denis Whitehead
- 5 years ago
- Views:
Transcription
1 TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your patient s lab work may mean can help you become a better technician. It enables you to anticipate your veterinarian s needs, explain disease processes and treatments to owners, and help devise treatment plans with your veterinarian. Chemistry Test Alanine Aminotransferase (ALT) Also known as SGPT Albumin (ALB) Alkaline Phosphatase (ALKP) Ammonia (NH 3 ) Amylase Aspartate Aminotransferase (AST) Also known as SGOT Blood urea nitrogen (BUN) Cholesterol Creatine Kinase (CK) Creatinine (CR) toxins, cholestasis, bile obstruction, trauma, hepatic lipidosis, neoplasia, medications, hepatitis, pancreatitis hepatic shunt hemolysis, hemoglobinemia, dehydration, steroids inflammation, hemodilution, protein losing disease, liver disease, burns, malabsorption, CHF bone repair or growth, steroids, medications, hepatitis, neoplasia, hepatic lipidosis, biliary disease, hyperadrenocorticism, pancreatitis, hypothyroidism hepatic shunt, high protein diet, kidney failure, metabolic acidosis lactulose use, low protein diet pancreatitis, dehydrations, liver disease, medications, GI disease, decreased glomerular filtration rate (GFR) feline pancreatitis, no concerns trauma, biliary disease, liver disease, toxins, hepatic lipidosis, neoplasia, medications, IMHA hepatic atrophy (shunt) renal disease, toxins, dehydration, high protein diet liver disease, ascites, fluid overload, low protein diet recent meal, protein losing nephropathy, diabetes, hyperadrenocorticism, pancreatitis, genetics, obesity liver disease, shunt, protein losing enteropathy, exocrine pancreatic insufficiency, hypoadrenocorticism trauma, seizures, infectious diseases, inflammations, SIRS/sepsis, thrombosis, anorexia, exercise, hemolysis, heatstroke decreased GFR, renal disease, dehydration, toxins, medications, high
2 protein diet, hypotension Globulins (Glob) Glucose (GLU) Lactate Lipase Total Bilirubin (TBIL) Calcium (Ca + ) Chloride (Cl - ) Magnesium (Mg + ) Phosphorus (P) Potassium (K + ) Sodium (Na + ) hyperthyroidism, cachexia neonates, neoplasia, hepatitis, infectious diseases, inflammation, SIRS/sepsis, dehydration liver disease, hemorrhage, malnutrition, protein losing enteropathy insulin deficiency, insulin resistance, diabetes, stress, recent meal, hyperthyroidism insulin overdose, malnutrition, diabetes, sepsis, liver failure, insulinoma, hypoadrenocorticism, infections, sample error anemia, hypoxia, hypoxemia, hypoperfusion, hypotension, exercise, drugs, toxins pancreatitis, dehydration, kidney disease, urinary obstruction, liver disease, neoplasia, medications hemolysis, IMHA, medications, toxins, liver disease, biliary disease, pancreatitis acidosis, neoplasia, dehydration, renal disease, hypoadrenocorticism, hyperparathyroidism alkalosis, ethylene glycol toxicity, tumor lysis syndrome, pancreatitis, renal disease, hypoparathyroidism, eclampsia dehydration, free water loss, diarrhea, hypernatremia, diuretics, renal disease, respiratory alkalosis vomiting, CHF, third spacing/fluid overload, renal disease, hyperadrenocorticism, sodium bicarb use renal disease, fluid therapy, GI hypomotility, urinary obstruction malnutrition, diarrhea, neoplasia, pancreatitis, renal disease, diabetic ketoacidosis, irritable bowel disease, exocrine pancreatic insufficiency kidney disease, hemolysis, rhabdomyolysis, osteolysis, tumor lysis syndrome, hypoparathyroidism, young hyperparathyroidism, malnutrition, hypomagnesemia, hypercalcemia, eclampsia, insulinoma, diabetic ketoacidosis, respiratory alkalosis renal failure, hypoadrenocorticism, urinary obstruction, metabolic acidosis, diabetic ketoacidosis, toxins, iatrogenic renal failure, diuretics, vomiting, diarrhea, hyperthyroidism, hyperadrenocorticism, stress, insulin toxicity, free water loss, diabetes insipidus, renal disease, hyperadrenocorticism, hypertonic fluid therapy
3 hypoadrenocorticism, fluid overload, dehydration, hyperglycemia, renal disease, congestive heart failure, hemorrhage Complete Blood Count Hematocrit (HCT) Red Blood Cell Count (RBC) Mean Corpuscular Volume (MCV) Red Cell Distribution Width (RDW) Hemoglobin (Hgb) Mean Corpusclar Hemoglobin (MCH) Mean Corpuscular Hemoglobin Concentration (MCHC) Reticulocyte Count Platelet Count (PLT) White Blood Cell Count (WBC) Monocytes hemorrhage, anemia, hemolysis, GI perforation, malnutrition, bone marrow disease, renal disease, fluid overload, iatrogenic hemorrhage, anemia, hemolysis, GI perforation, malnutrition, bone marrow disease, renal disease, fluid overload, iatrogenic, chemotherapy malnutrition, anemia, chemotherapy, hypothyroidism malnutrition, liver disease, anemia malnutrition, anemia normal anemia, hemolysis, hemorrhage, bone marrow disease, toxins, GI perforation, malnutrition, fluid overload, iatrogenic, chemotherapy malnutrition, anemia, chemotherapy, hypothyroidism malnutrition, liver disease, anemia IMHA, anemia, burns malnutrition, anemia hemolysis, IMHA, regenerative anemia bone marrow disease, malnutrition, nonregenerative anemia malnutrition, anemia, autoimmune disease, bone marrow disease infectious disease, hemorrhage, medications, liver disease, autoimmune disease, sepsis, leukemia, lymphoma, chemotherapy allergies, infectious disease, inflammation, stress, asthma, leukemia, bone marrow disease infection, infectious disease, lymphoma, bone marrow disease, sepsis, malnutrition, medications infectious disease, endocarditis, vasculitis, allergies, leukemia leukemia, bone marrow disease, anemia
4 Lymphocytes Neutrophils Basophils Eosinophils infectious disease, leukemia, lymphoma, stress, inflammation autoimmune disease, infection, steroids, chemotherapy, bone marrow disease infection, inflammation, trauma, stress, leukemia, bone marrow disease, hyperadrenocorticism, IMHA chemotherapy, infection, autoimmune disease, malnutrition, medications, bone marrow disease inflammation, allergies, leukemia, uremia parasites, heartworm disease, asthma, allergies, leukemia, lymphoma, hypoadrenocorticism, neoplasia, inflammation Ancillary Tests Pancreatic Lipase Immunoreactivity (cpli) Bile Acids Low Dose Dexamethasone Suppression (LDDS) Adrenocorticotropic Hormone Stimulation (ACTH) Free T4 (thyroxine) T3 (triiodothyronine) Thyroid Stimulating Hormone (TSH) Phenobarbital level Urine Protein: Creatinine (UCP ratio) pancreatitis, lipemia hemolyzed sample, no concern shunt, liver disease, cholestasis, hepatobiliary disease malabsorption, fasting, GI hypermotility, hyperadrenocorticism hypoadrenocorticism, adrenal tumor, hypoadrenocorticism, hyperadrenocorticism, stress hyperadrenocorticism, adrenal tumor, steroids hyperthyroidism hypothyroidism, pituitary disease hyperthyroidism hypothyroidism, pituitary disease hypothyroidism hyperthyroidism, pituitary disease high drug levels low drug levels glomerular disease, cystitis, urinary tract infections, renal disease
5 Prothrombin time (PT) Partial Thromboplastin Time (aptt) toxins, liver disease, hypoalbuminemia, envenomation, sepsis, hemorrhage toxins, liver disease, hypoalbuminemia, envenomation, sepsis, hemorrhage
The Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationBIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L
Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationWELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationLab Values Chart. Name of Test Purpose Normal Range (Adult) High Results Mean Low Results Mean. 1 5 or 1.5 (depends on unit of measure)
Lab Values Chart Name of Test Purpose Normal Range (Adult) High Results Mean Low Results Mean Albumin (blood) Alkaline phosphatase (ALP) (blood) Diagnose, evaluate, and monitor disease state of cancer,
More information2010 Miniboard Exam- Clinical Pathology
2010 Miniboard Exam- Clinical Pathology 1. All of the following findings are noted in cats with hyperthyroidism EXCEPT: A. Anemia B. Increased creatinine C. Hyperglycemia D. Elevated ALP (bone isoenzyme)
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationChapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University.
Chapter 4 M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. RBC (Erythrocytes): RBC COUNT: NORMAL VALUES: For men: 4.3-5.9 millions/mm 3 of blood. For women: 3.5-5.0
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationBasic Blood Chemistry, by Sharlene Peterson CLASS: G610
Basic Blood Chemistry, by Sharlene Peterson CLASS: G610 This is your test but do not try to fill in the blanks! We created a Test Answer Sheet which is easy to download, fill in the answer, and email.
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationCalcium (Ca 2+ ) mg/dl
Quick Guide to Laboratory Values Use this handy cheat-sheet to help you monitor laboratory values related to fluid and electrolyte status. Remember, normal values may vary according to techniques used
More informationColor: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationBlood Test Results Report
Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationPET CARE VETERINARY CARE CENTER 2009 W SLAUSON AVE ACCOUNT #: ATTENDING VET: ANDERSON, DVM, JOY
Text KISMET EVENTOFF PET OWNER: EVENTOFF SPECIES: Feline BREED: GENDER: Female AGE: 2 Months PATIENT ID: PET CARE VETERINARY CARE CENTER 2009 W SLAUSON AVE 323-294-4030 ACCOUNT #: 93530 ATTENDING VET:
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationLaboratory diagnosis of plasma proteins and plasma enzymes
Laboratory diagnosis of plasma proteins and plasma enzymes Functions of plasma proteins Function: transport humoral immunity enzymes protease inhibitors maintenance of oncotic pressure buffering Example:
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationSMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test
More informationAdams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation
More informationHematology. Chemistry AT HOME VETERINARY CARE. Patient: MAURICE GILLEN ( )
Species: Canine Breed: Poodle Gender: Male Year of Birth: 2005 Client: GILLEN Requisition #: 424 832-6809 Accession #: L0064714 Account Code: 97706 Veterinarian: PATTERSON,BRAD Panel/Profile: SDMA Bile
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationProvided by MedicalStudentExams.com NORMAL LABORATORY VALUES
NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationEpic Labs Orderable As STAT PRIORITY As of 06/22/2016
ABG+HB(CORDARTERIAL) - BABY A ABG+HB(CORD ARTERIAL)- BABY B ABG+HB(CORD ARTERIAL)- BABY C ACETAMINOPHEN LEVEL ALANINE AMINOTRANSFERASE (ALT) ALBUMIN, FLUID ALBUMIN, PLEURAL FLUID ALBUMIN, SYNOVIAL FLUID
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationInterpreting Blood Tests Part 1. Dr Andrew Smith
Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core
More informationROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
More informationSMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Patient Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test results.
More informationCLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800)
ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts 01886 (800) 665-2575 MICROBIOLOGY Bacteriology Aerobic Culture and Identification Antibiotic Susceptibility Testing Direct Antigen Detection Gram Stain
More information*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:
Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationWeight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationGastrointestinal Markers
Gastrointestinal Markers Session 2 Gastrointestinal System Reference Ranges Optimal Range Ttl Total Protein ti 69 6.9 74 7.4 Globulin 2.4 2.8 BUN 10 16 Creatinine 0.8 1.1 Phosphorous 3.0 4.0 Eosinophils
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationWeight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationSources Tips for Writing Tests. Rules, tips, and errors when writing examination questions. Before you start writing: Before you start writing:
Rules, tips, and errors when writing examination questions Steven L. Stockham, D.V.M., M.S. Diplomate, A.C.V.P, Honorary Diplomate, E.C.V.C.P. Professor and Director of Clinical Pathology Laboratory College
More informationUnderstanding your blood results:
Understanding your blood results: Contents Introduction... 1 Haematology... 2 Biochemistry... 3 MB - 'Electrolytes' (Sodium, Potassium, Chloride, Bicarbonate):... 3 MB - Kidney parameters... 4 MB - Liver
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationA test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.
Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Veterinary Emergency and Critical Care Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationDocumentation Dissection
History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3
More informationSMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationM.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017
M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationLaboratory Testing for the Primary Care Optometrist
General lab principles Indications for testing - Confirm a clinical diagnosis - Rule out a diagnosis - Manage a disease - Screen for a disease Sensitivity is the ability to show a positive result in a
More informationKathryn Jones 8/11/2015
1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry
More informationAustralian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after
More informationComplete Guide to Thyroid Blood Testing
BLOOD TESTING AND VALUES Complete Guide to Thyroid Blood Testing I often get asked.. What tests do I need? Why did my Doctor not order these tests? I ve just suppplied you with a complete list of the tests
More informationMiniboard Exam 2011 Veterinary Pathology - Clinical Pathology
Miniboard Exam 2011 Veterinary Pathology - Clinical Pathology 1. The following information is given for an 8 year old felid: Na+ - 138 mmol/l Cl - 102 mmol/l Mg+- 2.4 mmol/l Phos- 11.2 mg/dl Ca²+- 10.1
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationColor: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More information2015 Miniboard Exam Candidate # Clinical Pathology
2015 Miniboard Exam Candidate # Clinical Pathology 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 1 2015 Miniboard Exam Clinical Pathology 1. An aspirate from
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationMichael Kozart, MD, PhD
Michael Kozart, MD, PhD Review common abnormal lab results pertaining to Lithium, Depakote, Tegretol, Clozaril, Electrolytes/Calcium/Vitamin D, Renal, Liver and Thyroid Function, Diabetes, and Lipid Metabolism.
More information5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationWATER, SODIUM AND POTASSIUM
WATER, SODIUM AND POTASSIUM Attila Miseta Tamás Kőszegi Department of Laboratory Medicine, 2016 1 Average daily water intake and output of a normal adult 2 Approximate contributions to plasma osmolality
More informationCCRN Review - Renal. CCRN Review - Renal 10/16/2014. CCRN Review Renal. Sodium Critical Value < 120 meq/l > 160 meq/l
CCRN Review Renal Leanna R. Miller, RN, MN, CCRN-CMC, PCCN-CSC, CEN, CNRN, CMSRN, NP Education Specialist LRM Consulting Nashville, TN Sodium 136-145 Critical Value < 120 meq/l > 160 meq/l Sodium Etiology
More informationGet to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
More informationMineral Panel, Urine. Mineral/Lytes Panel, Urine. Metabolic Profile Test Panel Urea NEFA AST BHB. Non-Mammalian Chem Panel
CHEMISTRY PANELS Bilirubin Panel Bilirubin, Total Bilirubin, Direct Bilirubin, Indirect Canine Chemistry Panel See Small Animal Chemistry Panel Electrolyte Panel (NA) (K) (CL) Electrolyte Panel, Urine*
More informationLab Values: Interpreting Chemistry and Hematology for Adult Patients
Lab Values: Interpreting Chemistry and Hematology for Adult Patients 2 Contact Hours Copyright 2012 by RN.com All Rights Reserved Reproduction and distribution of these materials is prohibited without
More informationSMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationInstrumental determination of electrolytes in urine. Amal Alamri
Instrumental determination of electrolytes in urine Amal Alamri What is the Electrolytes? Electrolytes are positively and negatively chargedions, Found in Within body's cells extracellular fluids, including
More informationPractice Questions for Interpreting Labs
QUESTIONS (SELECT ALL THAT APPLY) 1- A patient in the Pacific NW presents to the ED in February with s/s of muscle spasms. His wife reports that he had his thyroid removed in January, has been staying
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More information* * Interpretation
LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)
More informationCommunity health day. General Robert H. Reed Recreation Center 800 Gabreski Lane, Myrtle Beach Friday, May 11 7:30-10:30 a.m.
Community health day General Robert H. Reed Recreation Center 800 Gabreski Lane, Myrtle Beach Friday, May 11 7:30-10:30 a.m. Health screenings to be offered include: Chemistry profile...$20 TSH (thyroid
More informationAge: 14 Houston TX 77007
Patient Medical History HEIGHTS HOSPITAL FOR ANIMALS Bernie Rogers Patient: JACK DOB: 08/26/1999 720 Courtlandt St. Species: FELINE Age: 14 Houston TX 77007 Breed: Domestic Shorthair Sex: MN Color: Black
More informationHYPERCALCEMIC GOLDEN RETRIEVER
Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier
More informationWHAT IS YOUR DIAGNOSIS?
WHAT IS YOUR DIAGNOSIS? A 12 year old, female neutered domestic shorthaired cat was presented to the R(D)SVS Feline Clinic with a 6 week history of polydipsia and polyuria, which was not quantified. The
More informationCCRN/PCCN Review Course May 30, 2013
A & P Review CCRN/PCCN Review Course May 30, 2013 Endocrine Anterior pituitary Growth hormone: long bone growth Thyroid stimulating hormone: growth, thyroid secretion Adrenocorticotropic hormone: growth,
More information