Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia

Similar documents
Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

SUPPLEMENTARY INFORMATION

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Interplay between FGF21 and insulin action in the liver regulates metabolism

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

SUPPLEMENTARY INFORMATION

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

a b c Physical appearance of mice Lean mass Adipocyte size d e f

Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B

SUPPLEMENTARY INFORMATION

BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Intestine-selective farnesoid X receptor inhibition improves obesity-related metabolic dysfunction

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?

Supplemental Table 1. List of primers used for real time PCR.

Understanding the Physiology of FGF21

Supplementary Figure 1

Supplementary Figure 1.

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus

Supplementary Materials for

The central melanocortin system directly controls peripheral lipid metabolism

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Regulation of adipose tissue remodeling by peripheral serotonin

Supplementary Figure 1

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

3-Thia Fatty Acids A New Generation of Functional Lipids?

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,

Supplementary Figure 1

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Activités scientifiques

Supporting Information

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

PKCδ regulates hepatic insulin sensitivity and hepatosteatosis in mice and humans

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Chapter 1, Part A: Biological background of obesity, insulin resistance and dyslipidemia

Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice.

Supplementary Table 1.

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)

Supplementary Figure 1

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production

SHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong, X; Gua, J; Xu, A. Citation Nature Communications, 2017, v. 8, p.

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Supporting Information

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

Supplemental Information. Brown Adipogenic Reprogramming. Induced by a Small Molecule

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat

Supplementary Figures

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Cited4 is a sex-biased mediator of the antidiabetic glitazone response in adipocyte progenitors

Supplementary Information Titles

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Supplementary Materials

FGF21 Regulates Metabolism Through Adipose- Dependent and -Independent Mechanisms

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

Supplementary legends

A Tryptophan Hydroxylase Inhibitor Increases Hepatic FGF21 Production and Decreases Hepatic Gluconeogenesis Independently of Insulin in db/db Mice

Branched chained amino acids, diabetes and exercise

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

University of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli

Fat and HIV persistence, role of fat metabolism and inflammation

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue

Non-shivering thermogenesis is found in tissues other than brown adipose tissue during cold exposure. By: Jessica Chan & Dayna Weststeyn

JP Morgan Healthcare Conference. January 8, 2007

Transcription:

Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal Rahmouni, Junichiro Sonoda, Xiaorong Fu, Shawn C. Burgess, William L. Holland, Steven A. Kliewer, and David J. Mangelsdorf

Figure S1, related to Figure 1, Figure 2, Figure 4 and Figure 5. β-klotho expression in tissue-specific β-klotho knockout mouse models and metabolic comparison between Klb fl/fl and Klb Alb mice. (A) QPCR analysis of β-klotho mrna levels in liver, BAT, scwat and hypothalamus in DIO Klb Alb mice, Klb Adipoq mice, Klb Camk2a mice and their corresponding DIO Klb fl/fl littermates. QPCR cycle time values are shown for the Klb fl/fl group. n = 5-6/group. (B) Ileal Fgf15 mrna levels and plasma FGF15 protein levels in DIO Klb fl/fl and Klb Alb littermates. QPCR cycle time values are shown for the Klb fl/fl group. n = 5-7/group. (C) Body weight in chow-fed lean and DIO Klb fl/fl and Klb Alb littermates after 7 weeks on high-fat diet (left panel). Body composition in DIO Klb fl/fl and Klb Alb littermates after 7 weeks on high-fat diet (right panel). n = 8/group. (D) Hyperinsulinemic-euglycemic clamp was performed in DIO Klb fl/fl and Klb Alb littermates. Glucose infusion rate, endogenous glucose production and whole-body glucose uptake during the clamp and basal endogenous glucose production measured. n = 5/group. (E) 24hr food intake, activity and energy expenditure were measured in DIO Klb fl/fl and Klb Alb littermates. n = 8/group.

Figure S2, related to Figure 2. Gene expression in control and liver-specific β-klotho knockout mice. (A-C) QPCR analysis of gene expression in (A) liver, (B) BAT and (C) scwat. QPCR cycle time values are shown for the vehicle-treated Klb fl/fl group.

Figure S3, related to Figure 4. Gene expression, hepatic diacylglycerol levels and plasma acylcarnitines and branched-chain amino acid levels in control and adipose tissue-specific β-klotho knockout mice. (A-C) QPCR analysis of gene expression in (A) BAT, (B) scwat and (C) liver. QPCR cycle time values are shown for the vehicle-treated Klb fl/fl group. (D) Hepatic diacylglycerol (DAG) levels. (E) Plasma acylcarnitine levels. (F) Plasma branched-chain amino acid (BCAA) levels.

Figure S4, related to Figure 5. Gene expression in control and nervous system-specific β-klotho knockout mice. QPCR analysis of gene expression in BAT, scwat and liver. QPCR cycle time values are shown for the vehicle-treated Klb fl/fl group. Data are shown as the mean ± SEM. *p < 0.05, **p < 0.01, ***p<0.001 compared to control.

Figure S5, related to Figure 6. Gene expression in mice treated with the FGFR1c/β-Klotho activating antibody. (A) QPCR analysis of gene expression in BAT, scwat and liver in DIO Klb fl/fl and Klb Adipoq littermates administered either bfkb1 or control antibody (trastuzumab) for 4 wk. QPCR cycle time values are shown for the control antibody-treated Klb fl/fl group. (B) QPCR analysis of gene expression in BAT, scwat and liver in DIO Klb fl/fl and Klb Camk2a littermates administered either bfkb1 or control antibody (trastuzumab) for 4 wk. QPCR cycle time values are shown for the control antibody-treated Klb fl/fl group.

Table S1, related to Figure S1-S5. Summary of primers used for QPCR analyses. Gene Name U36B4 Bmp8b Cyp7a1 Dio2 Dusp4 Egr1 Elovl3 Fas Fgf15 Klb Scd1 Ucp1 Primer Sequences Forward 5 cgtcctcgttggagtgaca3 Reverse 5 cggtgcgtcagggattg3 Forward 5 accaaccacgccactatgc3 Reverse 5 cagtaggcacacagcacacctt3 Forward 5 agcaactaaacaacctgccagtacta3 Reverse 5 gtccggatattcaaggatgca3 Forward 5 gtccgcaaatgaccccttt3 Reverse 5 cccacccactctctgactttc3 Forward 5 accacaaggccgacatcag3 Reverse 5 gtcctttactgcgtcgatgtactc3 Forward 5 cgagcgaacaaccctatgag3 Reverse 5 cattattcagagcgatgtcagaaa3 Forward 5 cttcgagacgtttcaggacttaag3 Reverse 5 tctggccaacaacgatgag3 Forward 5 gctgcggaaacttcaggaaat3 Reverse 5 agagacgtgtcactcctggactt3 Forward 5 acgggctgattcgctactc3 Reverse 5 tgtagcctaaacagtccatttcct3 Forward 5 gatgaagaatttcctaaaccaggtt3 Reverse 5 aaccaaacacgcggatttc3 Forward 5 tgcccctgcggatctt3 Reverse 5 gcccattcgtacacgtcatt3 Forward 5 aagctgtgcgatgtccatgt3 Reverse 5 aagccacaaaccctttgaaaa3

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback