Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Similar documents
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Supplementary Figure 1

Supplementary Figure 1

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

SUPPLEMENTARY INFORMATION

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Supplementary Materials for

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Figure 1

Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1

Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU).

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency

Control. csarnt -/- Cre, f/f

Supporting Information Table of Contents

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Deficiency in mtorc1-controlled C/EBPβ-mRNA translation improves metabolic health in mice

Supplementary Information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supporting Information

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Supplementary Figures

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

2.5. AMPK activity

In The Name Of God. In The Name Of. EMRI Modeling Group

Supplementary Information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

AMPK Activation by Metformin Suppresses Abnormal Extracellular Matrix Remodeling in Adipose Tissue and Ameliorates Insulin Resistance in Obesity

University of Zurich. Basal lipolysis, not the degree of insulin resistance, differentiates large from small isolated adipocytes in high-fat fed mice

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

a b c Physical appearance of mice Lean mass Adipocyte size d e f

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

LIPOCALIN 2 DEFICIENCY INFLUENCES TRANSFORMING GROWTH FACTOR-β EFFECT ON INFLAMMATION AND EXTRACELLULAR MATRIX REMODELING IN INGUINAL ADIPOCYTES

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Supplementary Materials

Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical

doi: /nature14508 Rappsilber et al.

Expanded View Figures

Imtiyaz et al., Fig. S1

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:

Supplementary methods:

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

Chapter 2. The Physiology of Fat

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements.

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120

Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical

SUPPLEMENTARY INFORMATION

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Supplementary Table 1.

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Mobilisation des lipides du tissu adipeux et insulinorésistance. Dominique Langin

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

FADD is a key regulator of lipid metabolism

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Supplementary Figures

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

T H E J O U R N A L O F C E L L B I O L O G Y

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Genotype analysis by Southern blots of nine independent recombinated ES cell clones by

Kerdiles et al - Figure S1

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Supplementary Materials for

Transcription:

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK O Plasma NEFA mmol/l (5h fast) 1.0±0.07 0.9±0.08 0.8±0.02 1.0±0.05 1.1±0.1 1.1±0.04 0.8±0.05 0.8±0.03 Liver TAG mmol/l corrected for protein 0.4±0.07 0.3±0.07 0.2±0.03 0.2±0.05 1.3±0.05 1.2±0.07 1.1±0.16 1.2±0.15 Data are mean±sem., control chow diet., high fat diet (58% kcal fat). NEFA, non-esterified fatty acids and TAG, triglycerides.

Supplementary Figure 1. Phd2 levels were not affected by adipocyte-specific Phd2 deletion in other tissues. (A) A schematic view (upper panel) of the genomic PCR used to detect the recombined Phd2 allele (450bp)and agarose gel (lower panel) showing recombination in white adipose tissue depots (epi; epididymal, mes; mesenteric), brown adipose tissue (BAT) and isolated adipocytes (adipo). Note recombination in the stromovascular fraction (SVF) but not in isolated peritoneal macrophages (Mφ) in Phd2KO mice. (B) Recombination PCR gels show that there is no recombination (Cre-mediated excision) present in muscle, liver, spleen or heart in Phd2KO tissues. (C) Adipose Phd2 deficiency (black bars) did not affect adipose Phd1 or Phd3 mrna levels.

Supplementary Figure 2. Hif1a deficient adipocytes do not respond to hypoxic stimulus and have reduced HIFα target genes. (A) Adipocytes from ap22-hif1ako mice (black bars, n=3) and Hif1a controls (white bars, n=3) were isolated and cultured in 21% O 2 or 1% O 2 for 6 hours. Cells were then lysed and probed with a HIF1α antibody. Representative blot (upper panel) and quantification graph (lower panel) showing significantly ablated HIF1α response in hypoxia in Hif1aKO adipocytes. (B) Glut1 mrna levels in isolated Hif1aKO adipocytes (black bars) are ~24 fold lower compared to control Hif1a adipocytes (white bars), n=3/group. mrna levels are corrected for 18S and protein for beta ACTIN levels. AU; arbitrary units. * p<0.05, ** p<0.01, *** p<0.001 comparisons between genotypes. + p<0.05 comparison of the effect of hypoxia within genotype.

Supplementary Figure 3. Unaltered pro-fibrotic genes in adipose of Phd2KO mice. WAT mrna levels of pro-fibrotic genes involved in adipose scarring such as collagens 1 (Col1), 3 (Col3), 6 (Col6), matrix metalloproteinases 2 and 13 (Mmp2, Mmp13) and the collagen crosslinking protein lysyl oxydase (Lox) in Phd2KO mice (black bars, n=6) were similar to control littermate levels (white bars, n=5).

Supplementary Figure 4. Opposing metabolic responses in Hif1aKO and Hif2aKO mice during High FatFeeding. Hif1aKO (A-C) and Hif2aKO (D-F) mice with their littermate controls were fed a High fat diet (HF, 58%kcal fat) for 12 weeks. (A) Hif1aKO (black squaresdashed line, n=6) gained less weight on a HF diet compared to control Hif1a mice (open circle-solid line, n=9). (B) Hif1aKO had similar glucose levels during oral glucose tolerance test (OGTT) at 6weeks (open square-dashed line) on HF diet to control mice and retained their glucose response after 12 weeks (black square-bold dashed line) on the diet, in contrast to control mice that showed impairment (open circle versus black circle, n=5/group). (C) Similar insulin levels during the OGTT (n=5/group). (D) Hif2aKO gained similar body weight to control Hif2a mice during HF. (E) Hif2aKO showed impaired response to OGTT at 6 and 12 weeks on HF diet and (F) Hif2aKO had higher basal fasting insulin during the OGTT compared to control littermates (n=6/group). * p<0.05, **p<0.01comparisons between genotypes and +p<0.05 comparisons of time (6-12 weeks) within genotype.

Supplementary Figure 5. Adipose Hif1a deficiency induces NEFA release under hypoxic conditions. Hif1aKO adipocytes (black bars) cultured in normoxia (21%O 2 ) or hypoxia (1%O 2 ) and stimulated with CL316,243 show increased lipolytic response in hypoxia (n=4/group). Quantification of immunoblots of) basal and CL316,243 stimulated HSL, phosphorylated HSL and perilipin levels (A-C) (n=3/group) in Hif1aKO adipocytes in hypoxia. Total HSL and perilipin protein levels are corrected for beta ACTIN (AU), and phosphorylated HSL corrected for total HSL (AU). * p<0.05, ***p<0.001 comparisons between genotypes.

Supplementary Figure 6. Adipose Hif2a deficiency does not affect lipolysis. (A) NEFA release in medium of Ap2-Hif2a (black bars) adipocytes cultured in normoxia (21% O 2 ) or hypoxia (1% O 2 ) and stimulated with CL316,243 show similar lipolytic response to control Hif2a (white bars) adipocytes (n=4/group). (B) Representative immunoblots of basal total HSL levels and quantification graph (n=3/group) in Ap2-Hif2a adipocytes in normoxia and hypoxia. (C) Representative immunoblots of CL316,243 stimulated total HSL levels and quantification graph (n=3/group) in Ap2-Hif2a adipocytes in nomoxia and hypoxia. Protein levels are corrected for beta ACTIN levels.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback