Complete Medical History

Similar documents
Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest

Weight Your weight. Body Mass Index Measure of weight to hei. Waist Circumference The circumference of you

Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of health.

Clinician Blood Panel Results

Clinician Blood Panel Results

Cardiovascular Health

Multiphasic Blood Analysis

Clinician Blood Panel Results

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

Understanding Blood Tests

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL

*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:

Blood Test Results Report

Results Report. Welcome to Your ABT Report!

SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units

SMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units

What Does My Blood Test Mean

NORMAL LABORATORY VALUES FOR CHILDREN

Results Report. Welcome to Your ABT Report! Introduction to the ABT Report

Tables of Normal Values (As of February 2005)

A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.

Rapid Laboratories In House Tests

10 Essential Blood Tests PART 1

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS

Senior Executive Wellness Profile

BC Biomedical Laboratories Adult Reference Ranges

BASIC METABOLIC PANEL

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program

Test Result Reference Range Flag

NEW RCPCH REFERENCE RANGES-

Routine Clinic Lab Studies

Provider: TONY BOGGESS DO 1310 S Main St Ann Arbor, MI Account No: Results

Parkview Health Laboratories Health Fair Information

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.

Basic Blood Chemistry, by Sharlene Peterson CLASS: G610

Get to know yourself better. Attend our health screening event.

Get to know yourself better. Attend our health screening event.

A. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

Understanding your blood results:

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.

Community health day. General Robert H. Reed Recreation Center 800 Gabreski Lane, Myrtle Beach Friday, May 11 7:30-10:30 a.m.

CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE

Chapter 19(1) An Introduction to the Circulatory System and Blood

G. Types of White Blood Cells

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

* * Interpretation

ENROLLMENT CONFIRMATION

Online catalog

Capillary Action and Blood Components. Biology 20 Unit D: Body Systems Circulation

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval

Fullerton Healthcare Screening Centres

A Comprehensive Look at Blood Work and Lab Tests

no concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis

Tests Explained. General Lab Panels

SMITH, JOHN D.C. Functional Health Report. Practitioner Copy JANE DOE. Lab Test on Jul 31, 2017 Conventional US Units

The Blood Chemistry Panel Explained

Analyte Specimen Demographic Reference Range Units

$ Glucose Only $ 9.00 Detects diabetes or a pre-diabetic condition.

Chapter 19(1) An Introduction to the Circulatory System and Blood

HEMOTOLOGY. B. Helps stabilize body temperature -heats up and cools down slowly which moderates body temp

Welcome to Wellivo Global

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

DIABETES AND LABORATORY TESTS. Author: Josephine Davis

What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of

Count y of Dupage. The Empower Wellness Screening Program. Thoughtfully designed to help you take control of your health

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300

Note-Taking Strategy. You will receive another guided note sheet to record all notes. Anything that is green should be recorded.

PNH Glossary of Terms

Kathryn Jones 8/11/2015

Unit Seven Blood and Immunity

Session 21: Heart Health

What if you could help your team realise their health goals?

Please contact the Client Services Team if you require further information.

Delta Check Calculation Guide

10 Essential Blood Tests PART 2

Kildeer CCSD 96. The Empower Wellness Screening Program. Thoughtfully designed to help you take control of your health

Chapter 14. Blood. Blood Volume. Blood Composition. Blood

Also, some risk factors, such as smoking and diabetes, put you at greater risk for CHD and heart attack than others.

Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments

Blood and Defense. Chapter 11

WSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with:

M. G. Robertson Biology Professor Delta College BLOOD - THE ELIXIR OF LIFE ROBERTSON DOPPELGANGERS. Phil Collins. Flea. Robin Williams.

Functions of Blood. Transport. Transport. Defense. Regulation. Unit 6 Cardiovascular System: Blood

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Supplementary Note Details of the patient populations studied Strengths and weakness of the study

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON

ADPedKD: detailed description of data which will be collected in this registry

Blood Physiology. Rodolfo T. Rafael, M.D.,CFP

KEY COMPONENTS. Metabolic Risk Cardiovascular Risk Vascular Inflammation Markers

HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE

Transcription:

Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical history Lab Documents will be provided to you at the time of your draw Blood draw complete Your blood results are in! Cardiovascular Health Your heart and blood vessels are called your cardiovascular system. When bad cholesterol and triglycerides clog your arteries that feed your brain and heart, raising your risk for a stroke or heart attack, this is known as cardiovascular disease. Basic Lipid Panel The basic lipid panel encompasses your cholesterol, including your good (HDL) and bad (LDL and other non-hdl) cholesterol, and fats in the blood. Total Cholesterol A Type of Fat LDL-C Direct "Bad" Cholesterol HDL-C Direct "Good" Cholesterol Triglycerides Type of Fat 233 93 132 39 LDL Particles Bad, or LDL, cholesterol has many parts and similar particles. By examining all of these particles, one can better understand their risk of atherosclerosis, or the clogging of blood vessels, leading to cardiovascular disease such as a heart attack or stroke. vldl-c Precursor to LDL Cholest LP(a) Different Form of LDL Apo B Protein in LDL ("Bad") Ch 8 5 91 Inflammation Inflammation is our bodies reaction to stress or injury. Though this can be helpful in the short-term, long-term chronic inflammation can contribute to many chronic diseases. hs-crp General Inflammation Mar 0.63 Metabolic Metabolism includes many physical and chemical reactions that are needed to stay alive and in good health. The metabolic lab tests include markers for glucose use and storage, energy regulation, and gender-specific hormone tests. https://wwws.wellnessfx.com/users/oamgeeh/diagnostic_report 1/7

Diabetes & Insulin Resistance Diabetes, a disease of persistently high blood sugar, can lead to cardiovascular disease, kidney disease, blindness, or ulcers in the legs. Glucose Blood Sugar Insulin Blood sugar storage hor Hemoglobin A1c ( Average blood sugar level 87 1.3 5.5 Reproductive Hormones Hormones are substances that are produced in one part of the body and travel to another part of the body to exert their effects. Hormones can affect many processes in your body, including growth, metabolism, mood, sexual functioning, and reproductive ability. Estradiol Main female sex hormone Testosterone (free) Unbound Testosterone Testosterone (total) Steroid hormone DHEA-S DHEA Sulfate (androgen) SHBG Sex Hormone Binding Gl 13 4.2 356 361.8 65.7 Thyroid The thyroid gland makes hormones that regulate your body's metabolism. An underactive thyroid results in low energy and weight gain, while an overactive thyroid causes hyper-activity or excessive weight loss. TSH Thyroid-Stimulating Hor 5.52 Metabolic Hormones Hormones influence how we metabolize fat, sugar, and protein to produce energy or store glycogen (stored blood sugar), muscle, and fat. These hormones govern are anabolic, or muscle building, fat-burning, pathways and our catabolic, or tissue breakdown, pathways. Cortisol The body's main stress h Insulin-Like Growt A Measure of Growth Hor 23.1 95 Liver Your liver detoxifies, produces proteins, and performs many other vital functions. A marked elevation in liver enzymes can signify liver dysfunction. Liver Enzymes and Function Tests Liver enzymes help monitor liver function and liver inflammation. ALT / SGPT Alanine aminotransferase ALP Alkaline Phosphatase AST / SGOT Aspartate aminotransferase Bilirubin (total) Made by the liver to help Albumin Type of protein in blood Total Protein Total protein amount (ser Globulin Immune protein A/G Ratio Proportion, albumin/glob 38 37 76 0.4 4.9 7 2.1 2.3 Kidney https://wwws.wellnessfx.com/users/oamgeeh/diagnostic_report 2/7

Your kidneys help maintain your blood pressure, keep your blood's acid-base level within a healthy range, and filter your blood so that needed substances are reabsorbed and waste substances are passed out of the body as urine. Kidney Function Your kidney function tests reflect how well your kidneys are working--abnormal kidney function tests suggest that your kidneys may be damaged. By monitoring, you can detect and treat kidney problems as early as possible. Creatinine (serum) Creatinine in your blood egfr Marker for kidney function egfr (African Am egfr if African American BUN Blood Urea Nitrogen Albumin Type of protein in blood BUN/Creatinine R BUN / Creatinine Serum 1.14 85 99 23 4.9 20 Electrolytes Electrolytes Sodium An electrolyte outside cells Potassium An electrolyte inside cells Chloride Balances other electrolytes CO2 Carbon dioxide in blood Calcium Blood and Bone Mineral 140 4.2 102 24 9.5 Bone Your bones play many roles in your body, ranging from storing minerals to protecting organs such as your brain. Bone tissue in your body undergoes constant remodeling--old bone is removed and new bone forms to replace it. Bone markers are indicators of how well bone remodeling is happening within your body; significantly abnormal marker levels suggest a possible bone disorder. Bone Bones are primarily made of calcium, supported by Vitamin D, and regulated through constant bone remodeling. When bones remodel excessively or become inflamed, there may be large elevations in an enzyme in bone called ALP (alkaline phosphatase). ALP Alkaline Phosphatase 25-Hydroxy Vitami Precursor to vitamin D Calcium Blood and Bone Mineral 37 45.7 9.5 Blood Blood consists of two main components or parts: the cellular components (red blood cells, white blood cells and the cell fragments known as platelets); and the liquid component, called plasma. Together, these two parts of the blood are responsible for many functions, including oxygen transport, temperature regulation, blood clotting, and immune defense. https://wwws.wellnessfx.com/users/oamgeeh/diagnostic_report 3/7

Red Blood Cells Red blood cells are the most numerous cell type in your blood and have one main role: to carry oxygen to tissues in your body and carry carbon dioxide back to the lungs to be exhaled. The red blood cell lab tests are commonly done as part of routine health checks or if your doctor suspects you have anemia. RBC Red blood cell count Hemoglobin Protein in red blood cells Hematocrit Fraction of red blood cells MCV Mean corpuscular volume MCH Mean cell hemoglobin MCHC RBC hemoglobin concen RDW Red cell distribution width Folate Folic Acid 4.36 13.4 40.6 93 30.7 33 14 18.1 White Blood Cells Your white blood cell (WBC) panel includes a WBC count and a WBC differential. The WBC count measures the number of WBCs you have in a sample of blood; the differential is the proportion of the different WBC types present in the blood. Abnormal values for your WBC count or components of your WBC differential can indicate a wide variety of medical diseases and conditions. White Blood Cell C Immune system cells Neutrophil Count ( Type of white blood cell % Neutrophil Lymphocyte Count Calculation of WBC type % Lymphocytes Monocytes (absol type of white blood cell % Monocytes Eosinophil (absolute) Calculation of WBC type % Eosinophils Basophil (absolute) Calculation of WBC type % Basophils Immature Granulo Immature granulocytes Immature Granulo Immature Granulocytes ( 4.9 3.2 65 1.2 25 0.3 7 0.1 2 0 1 0 0 https://wwws.wellnessfx.com/users/oamgeeh/diagnostic_report 4/7

Iron Iron is an essential mineral; it is needed to form hemoglobin, the main protein found in red blood cells. Your iron panel includes tests that help your doctor detect conditions of iron deficiency or iron overload. Iron (serum) Iron in liquid part of blood Ferritin Iron storage protein Total Iron Binding Estimates Transferrin level MCH Mean cell hemoglobin MCV Mean corpuscular volume Hematocrit Fraction of red blood cells Hemoglobin Protein in red blood cells Unsaturated Iron- Iron transport protein not RBC (Red Blood C The Magnesium in our cells Iron Saturation The percent of Iron trans 69 89 297 30.7 93 40.6 13.4 228 4.8 23 Platelets Your platelets play a key part of an important process in your body: forming blood clots at the site of an injured blood vessel. Your platelet panel includes a measure of how many platelets you have circulating as well as how large your platelets are; these values can provide important information about your risk for bleeding problems or clotting problems. Platelet Count Clot-forming cell fragments 227 Vitamins & Minerals Vitamins are carbon-containing (organic) substances and minerals are inorganic substances; both are needed for normal body processes. Your vitamin and mineral levels provide important clues to your overall health and nutrition status. Vitamins Vitamins are substances that are essential for normal health and well being. Vitamin B12 Essential nutrient for cells 25-Hydroxy Vitami Precursor to vitamin D Folate Folic Acid 1486 45.7 18.1 Minerals Minerals are inorganic substances that are needed for many processes in your body. A healthy diet can help prevent harmful mineral deficiencies. Ferritin Iron storage protein Iron (serum) Iron in liquid part of blood 89 69 Release Notes Lab Report released by a WellnessFX practitioner with practitioner. Adjustment of treatment plan recommended. Lab Report released by a WellnessFX practitioner with note: No critical values were found. Lab Report released by a WellnessFX practitioner with note: No critical values were found. Ensure to follow up to discuss treatment of all of your abnormal biomarkers. https://wwws.wellnessfx.com/users/oamgeeh/diagnostic_report 5/7

Lab Notes **Please note reference interval change** **Please note reference interval change** Results confirmed on dilution. According to ATP-III Guidelines, HDL-C >59 mg/dl is considered a negative risk factor for CHD. **Verified by repeat analysis** According to ATP-III Guidelines, HDL-C >59 mg/dl is considered a negative risk factor for CHD. **Please note reference interval change** Desirable: <20 Borderline high risk: 20-30 High risk: 31-50 Very high risk: >50. Note: Values >30 may indicate independent risk factor for CHD. Significance of high Lp(a) in non-white populations must be evaluated with caution. Desirable: <20 Borderline high risk: 20-30 High risk: 31-50 Very high risk: >50. Note: Values >30 may indicate independent risk factor for CHD. Significance of high Lp(a) in non-white populations must be evaluated with caution. Relative Risk for Future Cardiovascular Event Low <1.00 Average 1.00-3.00 High >3.00 Relative Risk for Future Cardiovascular Event Low <1.00 Average 1.00-3.00 High >3.00. Increased risk for diabetes: 5.7-6.4 Diabetes: >6.4 Glycemic control for adults with diabetes: <7.0. Increased risk for diabetes: 5.7-6.4 Diabetes: >6.4 Glycemic control for adults with diabetes: <7.0 Roche ECLIA methodology Cortisol AM 6.2-19.4 Cortisol PM 2.3-11.9 Cortisol AM 6.2-19.4 Cortisol PM 2.3-11.9 Vitamin D deficiency has been defined by the Institute of Evaluation, treatment, and prevention of vitamin D deficiency: an Endocrine Society clinical practice guideline. JCEM. 2011 Jul; 96(7):1911-30. Medicine and an Endocrine Society practice guideline as a level of serum 25-OH vitamin D less than 20 ng/ml (1,2). The Endocrine Society went on to further define vitamin D insufficiency as a level between 21 and 29 ng/ml (2). 1. IOM (Institute of Medicine). 2010. Dietary reference intakes for calcium and D. Washington DC: The National Academies Press. 2. Holick MF, Binkley NC, Bischoff-Ferrari HA, et al. Vitamin D deficiency has been defined by the Institute of Evaluation, treatment, and prevention of vitamin D deficiency: an Endocrine Society clinical practice guideline. JCEM. 2011 Jul; 96(7):1911-30. Medicine and an Endocrine Society practice guideline as a level of serum 25-OH vitamin D less than 20 ng/ml (1,2). The Endocrine Society went on to further define vitamin D insufficiency as a level between 21 and 29 ng/ml (2). 1. IOM (Institute of Medicine). 2010. Dietary reference intakes for calcium and D. Washington DC: The National Academies Press. 2. Holick MF, Binkley NC, Bischoff-Ferrari HA, et al. A serum folate concentration of less than 3.1 ng/ml is considered to represent clinical deficiency. A serum folate concentration of less than 3.1 ng/ml is considered to represent clinical deficiency. Plasma NOT separated from cells; may falsely decrease RBC Magnesium levels.. Written Authorization Received. Authorization received from SAMANTHA LEVINE 10-02-2012 Logged by Karlyn Ransom https://wwws.wellnessfx.com/users/oamgeeh/diagnostic_report 6/7

https://wwws.wellnessfx.com/users/oamgeeh/diagnostic_report 7/7