British Journal of Nutrition

(2013), 110, 1837 1848 q The Authors 2013 doi:10.1017/s0007114513001293 Dietry fire ffects intestinl mucosl rrier function nd regultes intestinl cteri in wening piglets Hong Chen 1,2, Xinging Mo 1,2, Jun He 1,2, Bing Yu 1,2, Zhiqing Hung 1,2, Jie Yu 1,2, Ping Zheng 1,2 nd Diwen Chen 1,2 * 1 Institute of Animl Nutrition, Sichun Agriculture University, No. 46, Xinkng Rod, Yucheng District, Yn, Sichun 625014, People s Repulic of Chin 2 Key Lortory of Animl Disese-Resistnce Nutrition, Ministry of Eduction, Y n, People s Repulic of Chin (Sumitted 20 Septemer 2012 Finl revision received 19 Mrch 2013 Accepted 23 Mrch 2013 First pulished online 9 My 2013) Astrct The ojective of the present study ws to evlute the effects of fire source on intestinl mucosl rrier function in wening piglets. A totl of 125 piglets were rndomly llotted on the sis of their ody weight nd litters to one of five experimentl diets, i.e. control diet without fire source (CT), nd diets in which expnded mize ws replced y 10 % mize fire (MF), 10 % soyen fire (SF), 10 % whet rn fire (WBF) or 10 % pe fire (PF). The diets nd wter were fed d liitum for 30 d. Piglets on the WBF nd PF diets hd lower dirrhoe incidence compred with the MF- nd SF-fed nimls. A higher rtio of villous height:crypt depth in the ileum of WBF-fed piglets nd higher colonic golet cells in WBF- nd PF-fed piglets were oserved compred with CT-, MF- nd SF-fed piglets. In the intestinl digest, feeding WBF nd PF resulted in incresed Lctocillus counts in the ileum nd Bifidocterium counts in the colon. Lower Escherichi coli counts occurred in the ileum nd colon of WBF-fed piglets thn in SF-fed piglets. Tight junction protein (zonul occludens 1; ZO-1) nd Toll-like receptor 2 (TLR2) gene mrna levels were up-regulted in the ileum nd colon of pigs fed WBF; however, feeding MF nd SF rised IL-1 nd TNF- mrna levels. Furthermore, higher dimine oxidse ctivities, trnsforming growth fctor-, trefoil fctor fmily nd MHC-II concentrtion occurred when feeding WBF nd PF. In conclusion, the vrious fire sources hd different effects on the ilel nd colonic rrier function. Clerly, WBF nd PF improved the intestinl rrier function, proly medited y chnges in microiot composition nd concomitnt chnges in TLR2 gene expression. Key words: Dietry fires: Intestinl cteri: Intestinl rrier function: Toll-like receptor 2 The intestinl epithelium is single lyer of columnr epithelil cells tht hs two criticl functions: cting s rrier to hrmful sustnces nd s selective filter to essentil nutrients (1,2). It cn synthesise nd secrete mny mucosl rrier fctors, such s dimine oxidse (DAO), trefoil fctor fmily (TFF) nd trnsforming growth fctor- (TGF-), which re considered s centrl fctors to mintin nd restore intestinl mucosl integrity (3 5). Intestinl tight junctions re the piclmost dhesive junctionl complexes defining prcellulr permeility of the intct intestinl epithelium, which consist of integrl trnsmemrne proteins (occludin nd cludin) (6). Chnges in the intestinl rrier cn ffect the invsion of hrmful sustnces nd the sorption of nutrients. Intestinl rrier dysfunction is thought to result in mny intestinl diseses, including dirrhoe, inflmmtory owel disese, ischemic disese, food llergy nd Crohn s disese (7,8). Specific dietry nutrients hve een shown to ffect intestinl functioning, one of which is dietry fire. Recent studies hve shown tht dietry fire is eneficil nutrient for preventing intestinl disese (dirrhoe, constiption nd the irritle owel syndrome) nd improving intestinl helth in humn sujects nd nimls (9). However, due to resistnce to digestion nd sorption in the foregut, the effect of dietry fire on intestinl helth hs een primrily ttriuted to mutul effect on intestinl cteri (10), especilly in the hindgut. Previous studies hve indicted tht dietry fires could selectively regulte intestinl cteri, including the stimultion of eneficil cteril species nd the suppression of pthogenic cteril species (11,12). Commensl cteri hve een shown to chnge intestinl rrier integrity. In vitro, occludin nd cingulin gene mrna levels of Cco-2 cells were up-regulted y Lctocillus (13). Arevitions: ADF, cid-detergent fire; DAO, dimine oxidse; Bx, Bcl-2-ssocited X protein; MF, mize fire; NDF, neutrl-detergent fire; PF, pe fire; SF, soyen fire; TFF, trefoil fctor fmily; TGF-, trnsforming growth fctor-; TLR2, Toll-like receptor 2; VFA, voltile ftty cid; WBF, whet rn fire; ZO-1, zonul occludens 1. * Corresponding uthor: D. Chen, fx þ86 835 2885106, emil dwchen@sicu.edu.cn

1838 H. Chen et l. Escherichi coli could result in tight junction disruption through the destilistion nd dissocition of tight junction proteins from the epithelil cells (14,15). These results suggest tht cteri could ffect intestinl rrier integrity y regulting the gene expression level of tight junction proteins. Menwhile, dietry fires (whet rn, pe fire, cellulose nd mixed fire) hve een shown to increse the excretion of intestinl mucin y stimulting the cpcity of mucosl protein synthesis in mny species including humn sujects (16,17). However, few studies hve shown the effect of dietry fire on intestinl mucosl rrier fctors (DAO, TFF nd TGF-). Therefore, it is prole tht dietry fire improves gut mucosl rrier function, such s intestinl mucosl tight junctions nd mucosl rrier fctors, through supporting etter intestinl microiot. Becuse piglets often suffer mjor stress t wening, ccompnied y intestinl mucosl dmge nd dirrhoe in conventionl pig production, we chose wened piglets s the experimentl niml. Generlly, mize fire (MF), whet rn fire (WBF), soyen fire (SF) nd pe fire (PF) re incresingly incorported in humn food nd niml diets s dietry fire sources. Previous studies hve shown tht these fire sources possess different physico-chemicl properties (soluility, fermentility) nd components, which results in discordnt intestinl helth (18,19). In order to further determine the mechnism y which dietry fire ffects intestinl helth, we hypothesise tht dietry fire could chnge intestinl helth y the regultion of intestinl mucosl tight junctions nd rrier fctors. Therefore, in the present study, complex fire sources purified from cerels (mize nd whet) nd legumes (soyen nd pe) were selected nd dded to wening piglet diets. The study imed to ssess whether supplementtion with dietry fires ffects intestinl mucosl tight junctions nd rrier fctors, nd regultes intestinl cteril popultions. Mterils nd methods The experimentl protocols used in the present study were pproved y the Sichun Agriculturl University Institutionl Animl Cre nd Use Committee. Preprtion of dietry fires MF, SF, WBF nd PF were purified from mize, soyen, whet nd pe, respectively, y Chinese Food Compnies. MF ws provided y Ci Yun Biotech Compny Limited, SF ws from Winwy Biotech Compny Limited, WBF ws from Shngyido Science nd Technology Compny Limited nd PF ws from Jinyun Food Compny Limited. Crude protein, crude fire, neutrl-detergent fire (NDF) nd cid-detergent fire (ADF), cellulose nd hemicellulose contents of the fire sources re summrised in Tle 1. The contents of crude fire, NDF nd ADF were ssyed in our lortory y using the method of Vn Soest (20). To void protein contmintion, sodium sulphite ws dded to NDF solution. Hemicellulose nd cellulose were clculted s follows: Hemicellulose ¼ NDF 2 ADF; Cellulose ¼ ADF 2 ðsh þ ligninþ: Experimentl design nd niml mngement The experiment followed rndomised lock design. A totl of 125 cross-red (Duroc Lndrce Yorkshire) piglets (wened t 28 (SEM 2) d) were locked nd ssigned to one of five experimentl diets sed on their ody weight nd litters. Ech tretment ws replicted with five pens of five pigs per replicte pen. The five tretments included control group nd four dietry fire groups. The temperture ws mintined t 268C for the first 3 d fter wening nd then reduced y 28C/week for the reminder of the experiment. Piglets consumed the diets nd wter d liitum for 30 d. All pigs were checked dily for generl helth nd dirrhoe during the experimentl period. Pigs showing loose feces/ dirrhoe were recorded. The incidence of dirrhoe ws clculted s follows: Dirrhoe incidence ð%þ ¼ðtotl numer of pigs per pen with dirrhoeþ=ðnumer of pigs per pen 30 dþ 100: Piglets were fed mize soyen mel diets (Tle 2) formulted to meet the nutrient recommendtions of the Ntionl Reserch Council (1998). The five experimentl diets included control diet without supplementl fire source nd four diets in which expnded mize ws replced y 10 % MF, 10 % SF, 10 % WBF or 10 % PF. To ensure similr energy levels in ll the diets, expnded mize ws reduced nd 2 % ft powder ws dded in the fire source diets. Tle 1. Crude protein (CP), crude fire (CF), neutrl-detergent fire (NDF), cid-detergent fire (ADF), cellulose nd hemicellulose contents of the fire sources Items Mize fire Soyen fire Whet rn fire Pe fire CP (%) 9 00 12 1 12 1 9 26 CF (%) 13 9 10 9 10 3 21 1 NDF (%) 60 9 40 7 68 1 48 2 ADF (%) 16 5 15 3 20 7 30 1 Cellulose (%) 12 2 10 2 15 5 22 9 Hemicellulose (%) 44 5 25 4 47 4 18 1 Lignin (%) 0 38 0 02 1 55 0 08

Fire ffects intestinl rrier function 1839 Tle 2. Composition of the experimentl diets (s-fed sis) Fire sources Items Con MF SF WBF PF Ingredients (%) Expnded mize 36 86 24 68 24 68 24 68 24 68 Dehulled soyen mel, 47 9 % 19 00 19 00 19 00 19 00 19 00 Mize strch 20 00 20 00 20 00 20 00 20 00 Fishmel, 62 5 %* 5 00 5 00 5 00 5 00 5 00 Soy protein concentrte, 65 % 5 00 5 00 5 00 5 00 5 00 Whey powder 4 00 4 00 4 00 4 00 4 00 Sucrose 3 00 3 00 3 00 3 00 3 00 Glucose 3 00 3 00 3 00 3 00 3 00 Ft powder 1 00 3 00 3 00 3 00 3 00 MF 10 00 SF 10 00 WBF 10 00 PF 10 00 Slt 0 20 0 20 0 20 0 20 0 20 L-Lys.HCl, 75 % 0 42 0 45 0 45 0 45 0 45 DL-Met 0 24 0 29 0 29 0 29 0 29 L-Thr 0 16 0 20 0 20 0 20 0 20 L-Trp 0 04 0 05 0 05 0 05 0 05 Limestone 0 93 0 90 0 90 0 90 0 90 Monoclcium phosphte 0 81 0 89 0 89 0 89 0 89 Choline chloride, 50 % 0 10 0 10 0 10 0 10 0 10 Vitmin premix 5 0 04 0 04 0 04 0 04 0 04 Trce minerl premixk 0 20 0 20 0 20 0 20 0 20 Totl 100 00 100 00 100 00 100 00 100 00 Anlysed chemicl composition DM (%) 89 54 89 91 89 93 90 63 90 40 Gross energy (MJ/kg) 16 09 16 17 15 95 16 17 16 62 CP (%) 18 61 18 59 18 93 19 09 18 73 Lys (%){ 1 40 1 40 1 40 1 40 1 40 C (%) 0 71 0 54 0 45 0 83 0 84 Aville P (%){ 0 45 0 45 0 45 0 45 0 45 P (%) 0 54 0 55 0 55 0 64 0 53 Crude fire (%) 2 39 3 87 3 53 3 82 4 95 NDF (%) 7 98 12 69 10 77 13 41 11 02 ADF (%) 2 58 3 68 3 48 4 12 5 26 Con, control; MF, mize fire; SF, soyen fire; WBF, whet rn fire; PF, pe fire; CP, crude protein; NDF, neutrl-detergent fire; ADF, cid-detergent fire. * Imported Peruvin red fishmel. Produced y WILMAR & ADM J.V. Mde of plm oils, produced y Shndong Tinjio Biotech Compny Limited. Provided the following per kg diet: 4 05 mg vitmin A; 52 25 mg vitmin D 3 ; 24 mg vitmin E; 3 mg vitmin K 3 ; 3 mg vitmin B 1 ; 6 mg vitmin B 2 ; 3 mg vitmin B 6 ;24mg vitmin B 12 ; 15 mg pntothenic cid; 1 2 mg folic cid; 150 mg iotin; 1 g choline. k Provided the following per kg diet: 110 mg Fe (s FeSO 4.7H 2 O); 10 mg Cu (s CuSO 4.5H 2 O); 110 mg Zn (s ZnSO 4.7H 2 O); 6 mg Mn (s MnSO 4.H 2 O); 0 3 mg I (s KI); 0 3 mg Se (s N 2 SeO 3 ). { Clculted vlue. Smple collection After 30 d, five pigs per diet were nesthetised y lethl injection of sodium pentoritl (200 mg/kg ody weight), nd the domen ws immeditely opened to remove the ileum nd the colon, emptied nd smpled. The middle section (2 cm) of the ileum nd colon ws collected nd fixed in 10 % formldehyde-phosphte uffer for intestinl histology nlysis. Intestinl segments of the ileum nd colon were collected nd immeditely frozen t 2808C for quntittive rel-time PCR. Mucosl scrpings from the ileum nd colon were prepred nd stored t 2808C until ELISA nlysis. Approximtely 3 g of the digest from the middle section of the ileum nd colon were kept in sterile tues nd immeditely frozen t 2808C until nlysis for microil DNA nd voltile ftty cid (VFA) concentrtions. Histologicl mesurements Mesurements of villous height nd crypt depth were conducted s descried y Shen et l. (21). Fixed intestinl segments were pcked with prffin wx. Consecutive sections t 5 mm thickness were stined with hemtoxylin eosin for histomorphologicl exmintion. Intestinl mucosl morphology including villous height nd crypt depth ws mesured t 40 mgnifiction with n Olympus CK 40 microscope (Olympus Opticl Compny). Positively stined golet cells were counted in ten rndomly selected mucous lyers using Imge-Pro Plus softwre, version 6.0 (Medi Cyernetics).

1840 H. Chen et l. Voltile ftty cid nlysis VFA concentrtions in the intestinl digest were determined using gs chromtogrphic method descried y Frnklin et l. (22). Digest smples (1 g) were thwed nd suspended in 2 ml of distilled wter in screw-cpped tue. After eing vortexed, the smple ws centrifuged (12 000 g) t 48C for 10 min. The superntnt (1 ml) ws trnsferred into centrifuge tues (2 ml) nd mixed with 0 2 ml metphosphoric cid. After 30 min t 48C, the tues were centrifuged (12 000 g) gin t 48C for 10 min. Aliquots of the superntnt (1 ml) were nlysed using Vrin CP-3800 gs chromtogrph (Agilent Technologies). A flme ionistion detector ws used with n oven temperture of 100 1508C. The polyethylene glycol column ws operted with highly purified N 2, s the crrier gs, t 1 8 ml/min. The lower detectle limit for ll VFA ws 0 1 mmol/l. ELISA nlysis of dimine oxidse ctivities, trnsforming growth fctor-, trefoil fctor fmily, MHC-II nd secretory IgA concentrtion Approximtely 1 g of mucosl scrpings ws homogenised y hnd fter eing suspended in 9 ml PBS. After centrifugtion t 700 g for 10 min, the superntnt ws removed nd centrifuged t 12 000 g for 15 min. Then, the superntnt ws tken for the mesurement of intestinl fctors y n ntiswine ELSIA kit (BlueGene Biotech). The totl protein content of the intestinl smples ws mesured y the Brdford rillint lue method simultneously. The concentrtion of intestinl fctors ws expressed s mg/mg or g protein (12). DNA isoltion, design nd vlidtion of primers for Lctocillus, Escherichi coli nd Bifidocterium Bcteril DNA ws extrcted from the intestinl digest using the Stool DNA Kit (Omeg Bio-tek) ccording to the mnufcturer s instructions. For quntittive detection of Lctocillus, E. coli nd Bifidocterium, primers nd fluorescent oligonucleotide proes (Tle 3) were designed following 16S rrna sequences of mximum species of ech genus encountered in the pig intestinl trct downloded from the GenBnk dtse, EMBL nd DDBJ. To void ny non-specific mplifiction, the sequences of ll the gener fetched from the dtse were sumitted to DNAStr (MegAlign) progrm (DNASTAR, Inc.), s descried y Hn et l. (23). It ws reveled tht the Lctocillus, E. coli nd Bifidocterium locks of hypervrile regions comprised ll other gener. These sequences were sumitted to second round of lignment where the mximum numer of species elonging to one genus ws ligned nd the conservtive regions were selected s genus-specific primers nd proes of Lctocillus, E. coli nd Bifidocterium. Furthermore, to ensure tht the oligonucleotide sequences were complementry piring with the trget genus only, they were checked with the GenBnk progrm BLAST (NCBI BLAST, http:// lst. nci.nlm.nih.gov/blst.cgi) nd the Riosoml Dtse Project (RDP) progrm Check-Proe (detils on RDP dt nd nlyticl functions cn e found t http://rdp.cme.msu.edu/). Primers (Tle 3) for totl cteri were otined from Lee et l. (24). All the primers nd proes (25,26) were commercilly synthesised y Life Technologies Limited. Microil quntittive PCR conditions Quntittive rel-time PCR ws performed y conventionl PCR on the Opticon DNA Engine (Bio-Rd). Ech rection ws run in volume of 25 ml with 1 ml of forwrd nd 1 ml of reverse primers (100 nm), 12 5 ml SYBR Premix Ex Tq (2 concentrted), 1 ml templte DNA nd 9 5 ml of douledistilled wter for detecting totl cteri. The PCR conditions were s follows: one cycle of pre-denturtion t 958C for 30 s; forty cycles of denturtion t 958C for 5 s; nneling t 608C for 30 s nd extension t 728C for 60 s. The PrimerScriptTM PCR kit (Perfect Rel Time; Tkr) ws used for Lctocillus, E. coli nd Bifidocterium. The rection protocol ws composed of one cycle of pre-denturtion t 958C for 2 min; fifty cycles of denturtion t 958C for 15 s; nneling t 608C for 30 s nd extension t 728C for 50 s. Ech rection Tle 3. Sequences of primers nd proes for intestinl cteri Primer Nucleotide sequence (5 0 3 0 ) Anneling temperture (8C) Product size (p) Reference Totl cteri Forwrd ACTCCTACGGGAGGCAGCAG 60 200 Hn et l. (23) Reverse ATTACCGCGGCTGCTGG Lctocillus Forwrd GAGGCAGCAGTAGGGAATCTTC Reverse CAACAGTTACTCTGACACCCGTTCTTC 60 126 Qi et l. (25) Proe AAGAAGGGTTTCGGCTCGTAAAACTCTGTT Escherichi coli Forwrd CATGCCGCGTGTATGAAGAA Reverse CGGGTAACGTCAATGAGCAAA 60 96 Qi et l. (25) Proe AGGTATTAACTTTACTCCCTTCCTC Bifidocterium Forwrd CGCGTCCGGTGTGAAAG Reverse CTTCCCGATATCTACACATTCCA 60 121 Xing et l. (26) Proe ATTCCACCGTTACACCGGGAA

Fire ffects intestinl rrier function 1841 ws run in volume of 20 ml with 8 ml RelMsterMix (2 5 ), 1 ml of forwrd nd 1 ml of reverse primers (100 nm), 1 ml proe enhncer solution (20 ), 0 3 ml proe (100 nm), 1 ml DNA nd 7 7 ml of doule-distilled wter in ech rection for detecting Lctocillus, E. coli nd Bifidocterium. Stndrd curve For the quntifiction of cteri in the test smples, specific stndrd curves were generted y constructing stndrd plsmids, s presented y Hn et l. (23). The stndrd strins of Lctocillus, E. coli nd Bifidocterium were cultured neroiclly or eroiclly in the respective culture, including 1 % glucose t 378C from 12 to 48 h. The specific PCR product of ll cteri ws purified using the QIAQuick Gel Extrction Kit (Qigen), nd cloned into pgem-t Esy Vector (Promeg). After verifiction of the sequence, the recominnt plsmid ws isolted using the Endo-Free Plsmid Kit I (OMGA), nd stndrd plsmids for ll cteri were constructed successfully. DNA concentrtion of the stndrd plsmids ws mesured using spectrophotometer (Coulter DU 800; Beckmn). The copies were clculted y the following formul: (6 0233 10 23 copies/mol DNA concentrtion (mg/ml))/(660 10 6 DNA size (p)). A 10-fold seril dilution series of plsmid DNA ws used to construct the stndrd curves for totl cteri, Lctocillus, E. coli nd Bifidocterium. Ech stndrd curve ws constructed y liner regression of the plotted points, nd cycle threshold (CT) vlues were plotted ginst the logrithm of templte copy numers. Tle 4. Sequences of primers for the intestine-relted genes Rel-time PCR for quntifiction of cludin 1, occludin, zonul occludens 1, TNF-, IL-1, B-cell lymphom/ leukemi-2-ssocited X protein, B-cell lymphom/ leukemi-2 nd Toll-like receptor 2 Frozen intestinl tissue (0 1 g) ws homogenised in 1 ml TRIzol regent (Invitrogen) nd totl RNA ws extrcted following the mnufcturer s instructions. The concentrtion nd purity of RNA were nlysed spectrophotometriclly (Beckmn Coulter DU800; Beckmn Coulter Inc.), nd the OD 260 :OD 280 rtio (where OD is the opticl density) rnged from 1 8 to 2 0 for ll smples. The integrity of RNA ws mesured y formldehyde gel electrophoresis nd the 28S:18S riosoml RNA nd rtio ws determined s $1 8. The RNA smples were reverse trnscried into complementry DNA using the PrimeScripte RT regent kit (Tkr) ccording to the mnufcturer s instructions. The primers were synthesised commercilly y Life Technologies Limited, which re listed in Tle 4. Rel-time PCR for quntifiction of cludin 1, occludin (OCLN), zonul occludens 1 (ZO-1), TNF-, IL-1, B-cell lymphom/leukemi-2 (Bcl-2)-ssocited X protein, Bcl-2 nd Toll-like receptor 2 (TLR2) were crried out on the Opticon DNA Engine (Bio-Rd) using SYBR Green PCR regents (Tkr). -Actin ws chosen s the reference gene trnscript, nd the reltive expression rtio of the trget gene in comprison with the reference gene ws clculted s descried previously (27). Ech stndrd nd smple ws run simultneously in duplicte on the sme PCR plte, nd the verge of ech duplicte vlue expressed s the numer of copies ws used for sttisticl nlysis. Primer Nucleotide sequence (5 0 3 0 ) Anneling temperture (8C) Product size (p) Reference -Actin Forwrd TCTGGCACCACACCTTCT 57 0 114 Hn et l. (23) Reverse TGATCTGGGTCATCTTCTCAC CLDN1 Forwrd GCCACAGCAAGGTATGGTAAC 60 0 140 Present study Reverse AGTAGGGCACCTCCCAGAAG OCLN Forwrd CTACTCGTCCAACGGGAAAG 62 0 158 Present study Reverse ACGCCTCCAAGTTACCACTG ZO-1 Forwrd TGGCATTATTCGCCTTCATAC 59 0 171 Present study Reverse AGCCTCATTCGCATTGTTT TNF- Forwrd ACCTCCTCTCTGCCATCAAG 60 0 173 Present study Reverse CTGCCCAGATTCAGCAAAGT IL-1 Forwrd GCATGTGCTGAGCCTTTGTA 60 0 181 Present study Reverse CCTGGTCCTCCCAAGATTGT Bx Forwrd AAGCGCATTGGAGATGAACT 60 0 121 Present study Reverse TGCCGTCAGCAAACATTTC Bcl2 Forwrd TGCCTTTGTGGAGCTGTATG 60 0 144 Present study Reverse GCCCGTGGACTTCACTTATG TLR2 Forwrd AGTTGAAGACGCTCCCAGATG 59 5 170 Present study Reverse GAAGGACAGGAAGTCACAGGA CLDN1, cludin 1; OCLN, occludin; ZO-1, zonul occludens 1; Bx, B-cell lymphom/leukemi-2-ssocited X protein; Bcl2, B-cell lymphom/- leukemi-2; TLR2, Toll-like receptor 2.

1842 H. Chen et l. Tle 5. Effects of the dietry fire sources on the intestinl morphology of wening piglets (Men vlues with their pooled stndrd errors) Items Con MF SF WBF PF Pooled SEM P Ileum Villous height (mm) 344 334 320 381 348 0 59 0 048 Crypt depth (mm) 264 267 258 238 247 0 58 0 649 Villous height:crypt depth 1 31 1 25 1 27 1 61 1 42 0 05 0 013 Golet cells (n/60 mm 2 ) 34 34 35 45 38 0 26 0 013 Colon Crypt depth (mm) 227 282 280 284 286 0 68 0 192 Golet cells (n/60 mm 2 ) 42 51 49 80 73 0 43,0 001 Con, control; MF, mize fire; SF, soyen fire; WBF, whet rn fire; PF, pe fire. Men vlues with unlike superscript letters were significntly different (P,0 05). Sttisticl nlysis The pen ws considered s the experimentl unit for ll nlyses. Bcteril copies were trnsformed (log 10 ) efore sttisticl nlysis. Litters nd ody weight of piglets were used s locking fctors, nd five locks were included. All dt were sujected to one-wy ANOVA for rndomised lock design using the GLM procedure of SAS 9.0 (SAS Institute Inc.). Sttisticl differences mong the tretments were seprted y Tukey s multiple-rnge tests. For significnce determintion, the -level ws set s 0 05. All dt re presented s mens with their pooled stndrd errors. Results Effects of fire sources on dirrhoe incidence There ws no difference in dirrhoe incidence etween the pigs fed the control diet (10 00 %) nd the fire source diets. However, lower dirrhoe incidence ws oserved in pigs fed the WBF (8 56 %) nd PF diets (8 72 %) compred with those fed the MF (11 47 %) nd SF diets (12 40 %). Effects of the fire sources on intestinl mucosl morphology The results of intestinl mucosl morphology nlysis re presented in Tle 5. In the ileum, pigs on the WBF diet hd higher villous height thn those fed the SF diet (P¼0 031). The ilel villous height:crypt depth rtio ws higher in WBF diet-fed pigs thn in those supplemented with the MF (P¼0 018) nd SF diets (P¼0 023). In pigs fed the WBF nd PF diets, the numer of mucosl golet cells incresed in the colon compred with pigs fed the control (P,0 001 nd, 0 001, respectively), MF (P¼0 001 nd 0 008, respectively) nd SF diets (P, 0 001 nd P¼0 005, respectively). However, difference in ilel golet cells ws only oserved in pigs fed the WBF diet when compred with those on the control (P¼0 023), MF (P¼0 025) nd SF diets (P¼0 032). Effects of the fire sources on voltile ftty cid concentrtions VFA concentrtions in the intestinl digest re presented in Tle 6. In the colon, there ws no difference in VFA concentrtions etween the pigs fed the control diet nd the fire source diets; however, pigs on the MF diet hd the lowest VFA concentrtion when compred with those fed the other diets. Higher cette, propionte, utyrte nd totl VFA concentrtions were oserved in pigs on the SF diet when compred with those fed the MF diet (P¼0 026, 0 005, 0 013 nd 0 010, respectively). The concentrtion of utyrte ws higher in pigs fed the WBF diet thn in those on the MF diet (P¼0 036). Menwhile, n increse in cette (P¼0 035) Tle 6. Effects of the dietry fires on the voltile ftty cid (VFA) concentrtions of wening piglets (Men vlues with their pooled stndrd errors) Items Con MF SF WBF PF Pooled SEM P Ileum (mmol/g) Acette 5 68 4 42 4 69 6 41 3 73 0 18 0 707 Propionte 1 10 1 02 2 82 2 91 2 89 0 13 0 146 Butyrte 1 82 2 31 1 51 2 09 2 10 0 13 0 971 Totl VFA 8 33 7 75 9 03 11 41 8 80 0 19 0 553 Colon (mmol/g) Acette 58 4 50 5 90 7 77 3 88 9 0 47 0 011 Propionte 23 9 13 5 37 1 29 6 30 1 0 34 0 009 Butyrte 12 0 5 2 20 5 18 4 16 4 0 29 0 014 Totl VFA 94 3 69 1 148 125 136 0 66 0 008 Con, control; MF, mize fire; SF, soyen fire; WBF, whet rn fire; PF, pe fire. Men vlues with unlike superscript letters were significntly different (P,0 05).

Fire ffects intestinl rrier function 1843 Tle 7. Effects of the dietry fires on the intestinl fctors of wening piglets (Men vlues with their pooled stndrd errors) Items Con MF SF WBF PF Pooled SEM P Ileum DAO (ku/g) 8 67 9 51 9 16 11 19 9 94 0 12 0 022 TGF- (mg/g) 1 33 1 29 1 35 1 39 1 21 0 04 0 733 TFF (ng/g) 642 625 651 754 752 0 03 0 253 MHC-II (ng/g) 167 193 225 244 225 0 89 0 646 SIgA (mg/g) 79 4 75 8 82 3 79 2 73 9 0 32 0 746 Colon TGF- (mg/g) 1 59 1 66 1 66 1 68 1 82 0 04 0 066 TFF (ng/g) 984 1071 1021 2378 2049 0 07,0 001 MHC-II (ng/g) 195 244 189 211 283 0 73 0 009 SIgA (mg/g) 103 9 106 3 111 8 99 0 98 6 0 40 0 703 Con, control; MF, mize fire; SF, soyen fire; WBF, whet rn fire; PF, pe fire; DAO, dimine oxidse; TGF-, trnsforming growth fctor-; TFF, trefoil fctor fmily; SIgA, secretory IgA. Men vlues with unlike superscript letters were significntly different (P,0 05). nd totl VFA (P¼0 035) concentrtions ws oserved in PF diet-fed pigs compred with those on the MF diet. Effects of the fire sources on intestinl mucosl dimine oxidse ctivities, trnsforming growth fctor-, trefoil fctor fmily nd MHC-II concentrtion Concentrtions of the intestinl fctors re presented in Tle 7. In the ileum, DAO ctivity ws higher (P¼0 022) in pigs fed the WBF diet thn in those on the control diet. In the colon, pigs on the PF diet hd higher TFF (P¼0 003), TGF- (P¼0 041) nd MHC-II (P¼0 020) concentrtions thn those on the control diet. Menwhile, pigs supplemented with the WBF nd PF diets hd higher TFF concentrtions thn those on the MF (P, 0 001 nd P¼0 006, respectively) nd SF diets (P, 0 001 nd P¼0 004, respectively). MHC-II concentrtions were higher in pigs fed the PF diet thn in those on the SF diet (P¼0 013). However, there ws no effect on SIgA concentrtions etween the diets in the ileum nd colon. Effects of the fire sources on intestinl cteri Bcteril popultions in the intestinl digest were ffected y the dietry fires (Fig. 1). There ws no effect of the diets on totl cteril popultions in pigs. In the ileum, Lctocillus popultions were higher in pigs fed the PF diet thn in those on the control (P¼0 012) nd SF diets (P¼0 037). In the colon, n increse in Bifidocterium popultions ws found in pigs fed the WBF diet compred with those on the control (P¼0 035) nd SF diets (P¼0 040). Higher colonic Bifidocterium popultions were oserved in pigs fed the PF diet compred with those on the control diet (P¼0 047). A difference in E. coli popultions ws oserved in the ileum nd colon. Pigs supplemented with the WBF diet hd lower (P¼0 021) ilel E. coli popultions thn those on the SF diet. In ddition, colonic E. coli popultions decresed in pigs fed the WBF diet compred with those on the control (P¼0 010), MF (P¼0 024) nd SF diets (P¼0 016). Effects of the fire sources on intestinl gene expression The effects of the dietry fires on intestinl gene expression re presented in Fig. 2. In the ileum nd colon, n increse in OCLN nd TLR2 mrna levels ws oserved in pigs fed the WBF diet compred with those on the control diet (P¼0 049 nd 0 037, respectively). Pigs supplemented with the WBF diet hd higher ilel ZO-1 mrna levels thn those on the control diet (P¼0 045). Menwhile, the WBF diet incresed colonic OCLN mrna levels compred with the MF diet (P¼0 004). Pigs fed the WBF diet showed higher colonic TLR2 mrna levels when compred with those on the MF (P¼0 020) nd SF diets (P¼0 039). However, pigs supplemented with the MF nd SF diets hd higher IL-1 mrna levels in the colon compred with those on the control (P¼0 005 nd 0 004, respectively), WBF (P, 0 001 nd, 0 001, respectively) nd PF diets (P¼0 007 nd 0 006, respectively), nd hd higher IL-1 mrna levels in the ileum compred with those on the control diet (P¼0 014 nd 0 011, respectively). Menwhile, higher ilel TNF- mrna levels were lso oserved in pigs fed the MF nd SF diets compred with those on the control (P¼0 014 nd 0 019, respectively) nd PF diets (P¼0 027 nd 0 036, respectively). However, no differences in Bcl-2- ssocited X protein nd Bcl2 mrna levels were oserved in pigs fed ll the diets. Discussion Dietry fire hs een reported to decrese dirrhoe incidence in pigs nd improve gut helth (28,29). According to Molist et l. (29), whet rn hs een shown to decrese the numer of pthogenic E. coli in the feces nd reduce the incidence of post-wening dirrhoe. Pe fire (pe hulls nd pe inner fire) hs lso een shown to improve intestinl helth in nimls y reducing the dhesion nd incresing the excretion of enterotoxigenic E. coli (30). However, in the present study, no effect on dirrhoe incidence ws oserved etween the pigs fed the control diet nd the fire source diets. A difference in dirrhoe incidence ws oserved mong the fire diets. The result indictes tht the effects of dietry fires on intestinl helth re relted to fire sources,

1844 H. Chen et l. (A) Ilel digest (copies/g) 12 11 10 9 8 7 6 5 4 Totl cteri Lctocillus Escherichi coli Bifidocterium (B) 13 Colonic digest (copies/g) 12 11 10 9 8 7 6 mye resulting from inconsistent intestinl function in regulting intestinl cteri (such s E. coli). Previous studies hve shown tht lower villous height: crypt depth rtio is ssocited with microil chllenges nd ntigenic components of the feed (31). Therefore, mesurement of intestinl mucosl morphology ws used to evlute the surfce re of the intestine undertken for mucosl integrity. The present results show tht supplementtion with the WBF diet elevted ilel mucosl integrity y improving ilel villous height nd the villous height:crypt depth rtio, in greement with previous study showing tht feeding pigs with high-insolule fire diets might e etter protected ginst pthogenic cteri y incresing the villous length (32). Previous studies hve found tht pigs fed solule nd insolule dietry fires hd more golet cells in the ileum thn those in fire-free group (33), in greement with the WBF nd PF diets in the present study. Golet cells hve een found to ply n importnt protective role in the intestine y synthesising nd secreting severl meditors, including mucin nd peptide trefoil fctors (TFF) (34). In the present study, higher colonic TFF concentrtion ws oserved in pigs fed on the WBF nd PF diets with n increse in golet cells. TFF, which is found minly in the smll nd lrge intestine, is reltively resistnt to proteolytic digestion nd cn stimulte the repir process (35). DAO ctivities in the intestinl mucos hve een determined s mrker for smll-intestinl mucosl mturity nd integrity in rts (36). According to Kiyoshi & Yoshihis (37), DAO ctivities in the smll intestine hve een,c c,c Totl cteri Lctocillus Escherichi coli Bifidocterium Fig. 1. Effects of the dietry fires on intestinl cteri in the (A) ilel nd (B) colonic digest. CT ( ), control; MF ( ), mize fire; SF ( ), soyen fire; WBF ( ), whet rn fire; PF ( ), pe fire. Vlues re mens (n 5), with stndrd errors represented y verticl rs.,c Men vlues with unlike letters were significntly different within cluster of rs, not cross the clusters of rs (P,0 05). found to e higher in rts fed fire diet, such s mixture of crystl cellulose nd croxymethyl cellulose sodium slt, thn in rts fed fire-free diet, in greement with pigs fed the WBF diet in the present study. Previous studies hve reported tht the function of mucosl TGF- is to mintin norml epithelil integrity s the lignd of the common epiderml growth fctor/tgf- receptor on djcent cells (38).In the colon, TGF- concentrtion ws higher in pigs fed the PF diet thn in those on the fire-free diet, suggesting tht pigs fed the PF diet hd etter epithelil integrity. Due to the ility to present peptide ntigens to CD4 þ T-lymphocytes, the MHC clss II molecule is necessry to initite the immune response (39). In the present study, pe fire could support stronger intestinl immunity defence response ginst extrcellulr pthogens y incresing colonic MHC-II concentrtion. Therefore, the present study indictes tht pe fire nd whet rn fire could improve intestinl rrier function y incresing the concentrtion of intestinl rrier fctors. Dietry fires hve een shown to selectively regulte intestinl cteri, including stimulting the growth of helthpromoting cteril species (ifidocteri nd lctocilli) nd suppressing the growth of potentil pthogenic cteril species (E. coli nd clostridi) (11,12), in greement with whet rn nd pe fires in the present study. Previous studies hve shown tht lctocilli re predominnt group in the smll intestine (40) ; however, ifidocteri re predominnt group in the colonic microiot (41), which could e the reson for

Fire ffects intestinl rrier function 1845 (A) 3 0 mrna copies per β-ctin copy 2 5 2 0 1 5 1 0 0 5 0 0 ZO-1 CLDN-1 OCLN Bx Bcl2 IL-1 TNF- TLR2 (B) 2 5 mrna copies per β-ctin copy 2 0 1 5 1 0 0 5 0 0 ZO-1 CLDN-1 OCLN Bx Bcl2 IL-1 TNF- TLR2 the difference in Lctocillus popultions oserved only in the ileum, nd the difference in ifidocteri popultions found only in the colon in the present study. With n increse in Lctocillus popultions in the ileum nd ifidocteri in the colon of piglets fed the WBF diet, the estlishment of E. coli ws inhiited possily y phenomenon known s competitive exclusion, first referred to s colonistion resistnce (42). However, we found tht not ll of the dietry fires selected could estlish etter intestinl microflor, nd there ws difference in E. coli popultions etween the pigs fed the WBF nd SF diets. According to Cstillo et l. (43), the host s intestinl cteri chnges in response to dietry fire composition due to specific sustrte preferences of cteri. Supplementtion with specific dietry fire llows the regultion of the composition of intestinl cteri (44). These results indicte tht more fire components esily used y ifidocteri nd lctocilli exist in whet rn nd pe fires thn in mize nd soyen fires. On the contrry, more fire components esily used y E. coli exist in soyen fire, compred with whet rn fire in the present study. Tight junction proteins (ZO-1, CLDN1 nd OCLN) ply crucil role in intestinl rrier integrity, which sel the prcellulr spce etween epithelil cells, thus preventing the Fig. 2. Effects of the dietry fires on intestinl gene expression in (A) the ileum nd (B) the colon. CT ( ), control; MF ( ), mize fire; SF ( ), soyen fire; WBF ( ), whet rn fire; PF ( ), pe fire; ZO-1, zonul occludens 1; CLDN-1, cludin 1; OCLN, occludin; Bx, Bcl-2-ssocited X protein; Bcl2, B-cell lymphom/leukemi-2; TLR2, Toll-like receptor 2. Vlues re mens (n 5), with stndrd errors represented y verticl rs. Men vlues with unlike letters were significntly different within cluster of rs, not cross the clusters of rs (P,0 05). prcellulr diffusion of intestinl cteri nd other ntigens cross the epithelium (45). In vitro, the proiotic Lctocillus lso hve shown to up-regulte occludin nd cingulin gene mrna levels of Cco-2 cells, suggesting tht cteri could ffect intestinl rrier integrity y regulting the gene expression level of tight junction proteins (13). In contrst, E. coli hs een reported to trigger tight junction disruption through destilistion nd dissocition of the ZO-1, occludin nd cludin 1 tight junction complex from the epithelil cells (14,15). Previous studies hve shown tht occludin mrna levels were higher in rts fed glcto-oligoscchride diet thn in those fed fire-free diet, nd the eneficil effect of glcto-oligoscchrides on occludin mrna levels hs een considered to e relted to the greter numer of ifidocteri nd lctocilli (12), in greement with whet rn fire in the present study. However, moleculr mechnisms y which intestinl cteri medite tight junction ltertions re still uncler. Toll-like receptor 2 (TLR2) hs een shown to ply key role in microil recognition nd the control of dptive immune responses (46). TLR2 ctivted y specific microil lignds is necessry to preserve intestinl epithelil tight junction-ssocited integrity ginst toxic or inflmmtory

1846 H. Chen et l. stress-induced dmge in rts (47,48). According to Gison et l. (49), TLR2 2/2 mice suffered impired epithelil rrier function medited vi ZO-1 nd cludin 3, suggesting tht TLR2 plys criticl role in mintining intestinl mucosl integrity during infection y cteril pthogen. These results suggest tht TLR2 could medite rrier function vi tight junction protein gene expression in pigs fed whet rn fire diet, s specific microil lignds in the present study. Menwhile, we found tht pigs fed the MF nd SF diets up-regulted intestinl pro-inflmmtory cytokine (IL-1 nd TNF-) mrna levels s interference fctors of the intestinl rrier (50). Pro-inflmmtory cytokines hve een shown to increse intestinl permeility through the dysregultion of tight junction proteins (51,52), which is the prtil reson why lower ZO-1 nd OCLN mrna levels were found in pigs fed the MF nd SF diets thn in those on the WBF diet. In the present study, difference in VFA concentrtions in the fire diets ws oserved only in the colon, ut not in the ileum, which is possily ecuse the digest is retined longer in the lrge intestine thn in the smll intestine nd ecuse microil popultions re greter in the colon thn in the ileum (53). According to Tcik et l. (54), chnge in totl VFA concentrtions ws oserved in the middle colon when pigs were fed different fire sources (potto fire or cellulose). A previous study hs indicted tht utyrte concentrtion ws higher in pigs fed whet rn fire diet thn in those on mize fire diet (55), in greement with the present study. Lower fermentle components oserved in the MF diet were due to VFA concentrtions eing lower in pigs fed the MF diet thn in those on the other fire diets, resulting in lower energy supply for the growth of the intestinl epithelium. However, fermentility of the fire sources could not explin why whet rn nd pe fires, nd not soyen fire, improved intestinl rrier function. From the composition nlysis of fire sources, it hs een found tht cerel (mize nd whet rn) fires hve higher NDF content thn legume (soyen nd pe) fires, which suggests higher insolule fire content in cerel thn in legume fires (20). However, positive effects of whet rn nd pe fires on ilel nd colonic rrier integrity pper to e relted to high ADF nd cellulose contents of fire sources rther thn to their otnicl origin nd soluility. Menwhile, there is n interesting difference in C: higher C content in whet rn nd pe fire diets, in greement with the present results showing chnges in epithelium integrity. Previous studies hve shown tht n increse in dietry C content hs eneficil impct on intestinl lkline phosphtse (56), which is key enzyme involved in the dephosphoryltion (nd detoxifiction) of pro-inflmmtory cteril components resulting in the down-regultion of intestinl inflmmtion (57). Also, eneficil effects of dietry C hve een documented in niml models of colonic inflmmtion (58 60). Incidentlly, the protective effects of C seem to depend on dietry P (59), nd the WBF diet lso displyed higher P content in the present study. In conclusion, complex fire sources could ffect intestinl mucosl rrier function nd regulte intestinl cteri in wening piglets. Also, the present results show tht piglets fed the different fire sources did not hve the sme qulittive or quntittive effects on ilel nd colonic rrier functions. Whet rn nd pe fires improved intestinl rrier function, proly medited y chnges in microiot composition nd concomitnt chnges in TLR2 gene expression. Additionlly, fire composition is considered s more importnt fctor to ffect intestinl rrier function in piglets thn their otnicl origin, soluility nd fermentility. Acknowledgements The present study ws supported y the ermrked fund for the Chin Agriculture Reserch System. Ech uthor fully contriuted to the design, experiment nd interprettion of the results of the study. There is no conflict of interest. References 1. Blikslger AT, Moeser AJ, Gookin JL, et l. (2007) Restortion of rrier function in injured intestinl mucos. Physiol Rev 87, 545 564. 2. Kunzelmnn K & Mll M (2002) Electrolyte trnsport in the mmmlin colon: mechnisms nd implictions for disese. Physiol Rev 82, 245 289. 3. Plyford RJ (1995) Peptides nd gstrointestinl mucosl integrity. Gut 37, 595 597. 4. Plyford RJ, Ghosh S & Mhmood A (2004) Growth fctors nd trefoil peptides in gstrointestinl helth nd disese. Curr Opin Phrmcol 4, 567 571. 5. Agostino L, Argenio G, Cicci C, et l. (1984) Dimine oxidse in rt smll owel: distriution in different segments nd cellulr loction. Enzyme 31, 217 220. 6. Turner JR (2006) Moleculr sis of epithelil rrier regultion from sic mechnisms to clinicl ppliction. Am J Pthol 169, 1901 1909. 7. Kuchrzik T, Wlsh SV, Chen J, et l. (2001) Neutrophil trnsmigrtion in inflmmtory owel disese is ssocited with differentil expression of epithelil intercellulr junction proteins. Am J Pthol 159, 2001 2009. 8. Meddings JB, Jrnd J, Urnski SJ, et l. (1999) Incresed gstrointestinl permeility is n erly lesion in the spontneously dietic BB rt. Am J Physiol Gstrointest Liver Physiol 276, 951 957. 9. Ingvr B (2004) Fire effects on intestinl functions (dirrhe, constiption nd irritle owel syndrome). Clin Nutr Suppl 1, 33 38. 10. Iin AB (2011) The physiologicl roles of dietry fire. Food Hydrocolloids 25, 238 250. 11. Gison GR, Betty ER, Wng X, et l. (1995) Selective stimultion of ifidocteri in the humn colon y oligofructose nd inulin. Gstroenterology 108, 975 982. 12. Zhong Y, Ci DL, Ci W, et l. (2009) Protective effect of glctooligoscchride-supplemented enterl nutrition on intestinl rrier function in rts with severe cute pncretitis. Clin Nutr 28, 575 580. 13. Anderson RC, Cookson AL, McN WC, et l. (2010) Lctocillus plntrum MB452 enhnces the function of the intestinl rrier y incresing the expression levels of genes involved in tight junction formtion. BMC Microiol 10, 316. 14. Spitz J, Yuhn R, Koutsouris A, et l. (1995) Enteropthogenic Escherichi coli dherence to intestinl epithelil

Fire ffects intestinl rrier function 1847 monolyers diminishes rrier function. Am J Physiol Gstrointest Liver Physiol 268, G374 G379. 15. Muz-Moons MM, Schneeerger EE & Hecht GA (2004) Enteropthogenic Escherichi coli infection leds to ppernce of errnt tight junctions strnds in the lterl memrne of intestinl epithelil cells. Cell Microiol 6, 783 793. 16. Fuller MF & Cdenhed A (1991) Effect of the mount nd composition of the diet on glctosmine flow from the smll intestine. In Digestive Physiology in Pigs. EAAP Puliction No. 54, pp. 330 333 [MWA Verstegen, J Huismn nd LA den Hrtog, editors]. Wgeningen: Pudoc. 17. Lien KA, Suer WC & He JM (2001) Dietry influences on the secretion into nd degrdtion of mucin in the digestive trct of monogstric nimls nd humns. J Anim Feed Sci 10, 223 245. 18. Hmerg O, Rumessen JJ & Gudmndhoyer E (1989) Bloodglucose response to pe fier comprisons with sugr-eet fier nd whet rn. Am J Clin Nutr 50, 324 328. 19. Titgemeyer EC, Bourquin LD, Fhey GC, et l. (1991) Fermentility of vrious fier sources y humn fecl cteri in vitro. Am J Clin Nutr 53, 1418 1424. 20. Vn Soest PJ, Roertson JB & Lewis BA (1991) Methods for dietry fier, neutrl detergent fier, nd nonstrch polyscchrides in reltion to niml nutrition. J Diry Sci 74, 3583 3597. 21. Shen YB, Pio XS, Kim SW, et l. (2009) Effects of yest culture supplementtion on growth performnce, intestinl helth, nd immune response of nursery pigs. J Anim Sci 87, 2614 2624. 22. Frnklin MA, Mthew AG, Vickers JR, et l. (2002) Chrcteriztion of microil popultions nd voltile ftty cid concentrtions in the jejunum, ileum nd cecum of pigs wened t 17 vs 24 dys of ge. J Anim Sci 80, 2904 2910. 23. Hn GQ, Xing ZT, Yu B, et l. (2012) Effects of different strch sources on Bcillus spp. in intestinl trct nd expression of intestinl development relted genes of wenling piglets. Mol Biol Rep 39, 1869 1876. 24. Lee C, Lee S, Shin SG, et l. (2008) Rel-time PCR determintion of rrna gene copy numer: solute nd reltive quntifiction ssys with Escherichi coli. Appl Environ Micro 78, 371 376. 25. Qi HW, Xing ZT, Hn GQ, et l. (2011) Effects of different dietry protein sources on cecl microflor in rts. Afr J Biotechnol 10, 3704 3708. 26. Xing ZT, Qi HW, Hn GQ, et l. (2011) Rel-time TqMn polymerse chin rection to quntify the effects of different sources of dietry strch on Bifidocterium in the intestinl trct of piglets. Afr J Biotechnol 10, 5059 5067. 27. Michel WP (2001) A new mthemticl model for reltive quntifiction in rel-time RT-PCR. Nucleic Acids Res 29, e45. 28. Wellock IJ, Fortomris PD, Houdijk JG, et l. (2008) The consequences of non-strch polyscchride soluility nd inclusion level on the helth nd performnce of wened pigs chllenged with enterotoxigenic Escherichi coli. Brit J Nut 99, 520 530. 29. Molist F, Gómez DS, Gs J, et l. (2009) Effects of dietry fire on phsycochemicl chrcteristics of digest, microil ctivity nd gut mturtion in erly wened piglets. Anim Feed Sci Technol 149, 346 353. 30. Becker PM, Wikselr PG, Jnsmn AJ, et l. (2009) Pe dietry fier for dhesion nd excretion of enterotoxigenic E. coli K88 to prevent intestinl coloniztion. J Anim Sci 87, 172 189. 31. Hung CW, Lee TT, Shih YC, et l. (2012) Effects of dietry supplementtion of Chinese medicinl hers on polymorphonucler neutrophil immune ctivity nd smll intestinl morphology in wenling pigs. J Anim Physiol Anim Nutr 96, 285 294. 32. Hedemnn MS, Eskildsen M, Lærke HN, et l. (2006) Intestinl morphology nd enzymtic ctivity in newly wened pigs fed contrsting fier concentrtions nd fier properties. J Anim Sci 84, 1375 1386. 33. Shingo H, Noki T, Kei S, et l. (2012) Smll intestinl golet cell prolifertion induced y ingestion of solule nd insolule dietry fier is chrcterized y n increse in silylted mucins in rts. J Nutr 142, 1429 1436. 34. Kirk SB, Julin AG, Mohmmd R, et l. (2008) Modultion of intestinl golet cell function during infection y n ttching nd effcing cteril pthogen. Infect Immun 76, 796 811. 35. Rymond JP, Surt G & Asif M (2004) Growth fctors nd trefoil peptides in gstrointestinl helth nd disese. Curr Opin in Phrmcol 4, 567 571. 36. D Agostino L, D Argenio G, Cicci C, et l. (1984) Dimine oxidse in rt smll owel: distriution in different segments nd cellulr loction. Enzyme 31, 217 220. 37. Kiyoshi E & Yoshihis N (1998) Comprtive effect of wtersolule nd -insolule dietry fier on owel function in rts fed liquid elementl diet. Nutr Res 18, 883 891. 38. Romno M, Polk WH, Awd JA, et l. (1992) Trnsforming growth fctor protection ginst drug-induced injury to rt gstric mucos in vivo. J Clin Invest 90, 2409 2421. 39. Tjdine MH, Erik S & Peter JE (2004) Function nd regultion of MHC clss II molecules in T-lymphocytes: of mice nd men. Hum Immunol 65, 282 290. 40. Bin L, Joshu G, Qi W, et l. (2011) In-vitro ssessment of the effects of dietry fiers on microil fermenttion nd communities from lrge intestinl digest of pigs. Food Hydrocolloids 25, 180 188. 41. Jing W, Boguo S, Ynping C, et l. (2010) In vitro fermenttion of xylooligoscchrides from whet rn insolule dietry fier y ifidocteri. Crohyd Polym 82, 419 423. 42. vn der Wij D, Berghuis-de Vries JM & Lekkerkerk Lekkerkerk-v (1971) Colonistion resistnce of the digestive trct in conventionl nd ntiiotic treted mice. J Hyg 69, 405 411. 43. Cstillo M, Skene G, Roc M, et l. (2007) Appliction of 16S rrna gene-trgetted fluorescence in situ hyridiztion nd restriction frgment length polymorphism to study porcine microiot long the gstrointestinl trct in response to different sources of dietry fire. FEMS Microiol Ecol 59, 138 146. 44. Brr UM, Seem H, Roert P, et l. (2010) Nonstrch polyscchrides modulte cteril microiot, pthwys for utyrte production, nd undnce of pthogenic Escherichi coli in the pig gstrointestinl trct. Appl Environ Micro 76, 3692 3701. 45. Dulnth U, Rchel CA, Wrren CM, et l. (2011) Regultion of tight junction permeility y intestinl cteri nd dietry components. J Nutr 141, 769 776. 46. Crio E (2005) Bcteril interctions with cells of the intestinl mucos: Toll-like receptors nd NOD2. Gut 54, 1182 1193. 47. Crio E (2008) Brrier-protective function of intestinl epithelil Toll-like receptor 2. Mucosl Immunol 1, Suppl. 1, S62 S66. 48. Mnkertz J, Tvlli S, Schmitz H, et l. (2000) Expression from the humn occludin promoter is ffected y tumor necrosis fctor lph nd interferon gmm. J Cell Sci 113, 2085 2090. 49. Gison DL, M C, Rosenerger CM, et l. (2008) Toll-like receptor 2 plys criticl role in mintining mucosl

1848 H. Chen et l. integrity during Citrocter rodentium-induced colitis. Cell Microiol 10, 388 403. 50. Boivin MA, Ye D, Kennedy JC, et l. (2007) Mechnism of glucocorticoid regultion of the intestinl tight junction rrier. Am J Physiol Gstrointest Liver Physiol 292, G590 G598. 51. Zund G, Mdr JL, Dzus AL, et l. (1996) Interleukin-4 nd interleukin-13 differentilly regulte epithelil chloride secretion. J Biol Chem 271, 7460 7464. 52. Berin MC, Yng PC, Ciok L, et l. (1999) Role for IL-4 in mcromoleculr trnsport cross humn intestinl epithelium. Am J Physiol Cell Physiol 276, C1046 C1052. 53. Simpson JM, McCrcken VJ, White BA, et l. (1999) Appliction of denturnt grdient gel electrophoresis for the nlysis of the porcine gstrointestinl microiot. J Microiol Methods 36, 167 179. 54. Tcik M, Pstuszewsk B, Tuśnio A, et l. (2010) Effects of two protein nd fire sources on SCFA concentrtion in pig lrge intestine. Livest Sci 133, 138 140. 55. Crneiro MS, Lordelo MM, Cunh LF, et l. (2008) Effects of dietry fire source nd enzyme supplementtion on fecl pprent digestiility, short chin ftty cid production nd ctivity of cteril enzymes in the gut of piglets. Anim Feed Sci Tech 146, 124 136. 56. Brun LR, Brnce ML & Riglli A (2012) Luminl clcium concentrtion controls intestinl clcium sorption y modifiction of intestinl lkline phosphtse ctivity. Br J Nutr 108, 229 233. 57. Llles JP (2010) Intestinl lkline phosphtse: multiple iologicl roles in mintennce of intestinl homeostsis nd modultion y diet. Nutr Rev 68, 323 332. 58. Schepens MAA, Schonewille AJ, Vink C, et l. (2009) Supplementl clcium ttenutes the colitis-relted increse in dirrhe, intestinl permeility, nd extrcellulr mtrix rekdown in HLA-1327 trnsgenic rts. J Nutr 139, 1525 1533. 59. Schepens MAA, ten Bruggencte SJM, Schonewille AJ, et l. (2012) The protective effect of supplementl clcium on colonic permeility depends on clcium phosphteinduced increse in luminl uffering cpcity. Br J Nutr 107, 950 956. 60. vn Ampting MTJ, Schonewille AJ, Vink C, et l. (2010) Dmge to the intestinl epithelil rrier y ntiiotic pretretment of slmonell-infected rts is lessened y dietry clcium or tnnic cid. J Nutr 140, 2167 2172.