About OMICS Group Conferences

Similar documents
About OMICS Group Conferences

About OMICS Group. OMICS Group International is an amalgamation of Open Access acetyl-coa

About OMICS International Conferences

About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and

OMICS International Conferences

About OMICS Group Conferences

About OMICS International Conferences

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS International Conferences

About OMICS Group Conferences

About OMICS International Conferences

About OMICS Group Conferences

OMICS International Conferences

OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007

OMICS Group International is an amalgamation of Open Access publications

About OMICS Group Conferences

About OMICS International Conferences

About OMICS International Conferences

About OMICS Group Conferences

OMICS International Conferences

About OMICS International Conferences

About OMICS Group Conferences

About OMICS Group. Prof Dr. Abdalla Omar

About OMICS Group. events. Established in the year 2007 with the sole aim of making the information on Sciences and technology Open Access, OMICS

About OMICS International Conferences

About OMICS Group Conferences

OMICS INTERNATIONAL CONFERENCES

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS Group Conferences

About OMICS International Conferences

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Generating Mouse Models of Pancreatic Cancer

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs

About Omics Group conferences

VIRUSES AND CANCER Michael Lea

Refining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis

Lecture 3-4. Identification of Positive Regulators downstream of SA

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer

About OMICS Group Conferences

OMICS Journals are welcoming Submissions

ABOUT OMICS INTERNATIONAL CONFERENCES

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

Epidermal Growth Factor Signaling Pathway. R. Armijo, D. Dinh, S. Hindi, S. Jehle, J. Jones & L. Lawson

Daehwan Kim September 2018

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

OCCUPATIONAL HEALTH CONSIDERATIONS FOR WORK WITH VIRAL VECTORS

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Oncology Therapeutics without Compromise APRIL 2011

Regulation of cell signaling cascades by influenza A virus

Understanding and Optimizing Treatment of Triple Negative Breast Cancer

GPS Cancer. The Era of Complete Genomics and Proteomics is Here. Advanced molecular profiling to inform personalized treatment strategies

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015

SPIE Student Chapter Report Annual report

UNRAVELING THE SIGNALING NETWORKS IN HUMAN CELL TRANSFORMATION. By ROCKY CIPRIANO

609G: Concepts of Cancer Genetics and Treatments (3 credits)

Cancer Science and Therapy

~Lentivirus production~

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

About OMICS International

About OMICS International

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Towards an HIV Cure. Steven G. Deeks Professor of Medicine University of California, San Francisco

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108

Health Systems Adoption of Personalized Medicine: Promise and Obstacles. Scott Ramsey Fred Hutchinson Cancer Research Center Seattle, WA

Supplementary Materials for

Why chaperone vectors?

2.1 VIRUSES. 2.1 Learning Goals

Virology. Brochure. 4 th World Congress on. San Antonio, USA October 06-08, 2014

Osamu Tetsu, MD, PhD Associate Professor Department of Otolaryngology-Head and Neck Surgery School of Medicine, University of California, San

Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1

Histones modifications and variants

About OMICS International

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors

Autoimmunity. Autoimmunity Brochure. International Conference on. Autoimmunity Manchester, UK October 13-14, 2016

Choosing Between Lentivirus and Adeno-associated Virus For DNA Delivery

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

The value of Omics to chemical risk assessment

Xiaonan L. Liu. using a variety of methodologies. These include computational modeling, behavioral studies,

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Table S2. Expression of PRMT7 in clinical breast carcinoma samples

Personalized oncology: the potential for tissue and cell-free DNA

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, MD

Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet

Module 3: Pathway and Drug Development

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Chapter 4 Cellular Oncogenes ~ 4.6 -

SUPPLEMENTARY INFORMATION

About OMICS Group Conferences

SUPPLEMENTARY FIGURES

Transcription:

About OMICS Group OMICS Group International is an amalgamation ofopen Access publicationsand worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information on Sciences and technology Open Access, OMICS Group publishes 400 online open accessscholarly journalsin all aspects of Science, Engineering, Management and Technology journals. OMICS Group has been instrumental in taking the knowledge on Science & technology to the doorsteps of ordinary men and women. Research Scholars, Students, Libraries, Educational Institutions, Research centers and the industry are main stakeholders that benefitted greatly from this knowledge dissemination. OMICS Group also organizes 300International conferencesannually across the globe, where knowledge transfer takes place through debates, round table discussions, poster presentations, workshops, symposia and exhibitions.

About OMICS Group Conferences OMICS Group International is a pioneer and leading science event organizer, which publishes around 400 open access journals and conducts over 300 Medical, Clinical, Engineering, Life Sciences, Pharma scientific conferences all over the globe annually with the support of more than 1000 scientific associations and 30,000 editorial board members and 3.5 million followers to its credit. OMICS Group has organized 500 conferences, workshops and national symposiums across the major cities including San Francisco, Las Vegas, San Antonio, Omaha, Orlando, Raleigh, Santa Clara, Chicago, Philadelphia, Baltimore, United Kingdom, Valencia, Dubai, Beijing, Hyderabad, Bengaluru and Mumbai.

Using VBIM technique to identify drug resistance genes in ovarian cancer Tao Lu, Ph.D. Department of Pharmacology &Toxicology Department of Biochemistry & Molecular Biology Department of Medical and Molecular Genetics Experimental & Developmental Therapeutics Program Indiana University School of Medicine

Outline Background of Validation-Based Insertional Mutagenesis (VBIM) technique Example 1: VBIM technique identifies F-box leucine repeat rich protein (FBXL11) as a novel regulator of NF-κB Example 2: VBIM technique and drug resistance gene discovery in ovarian cancer

Book Chapter, p253-264. Cold Spring Harbor Press (2009). http://cshperspectives.cshlp.org/cgi/collection/nf-kb

Lentiviral VBIM mutagenesis method Lentiviral VBIM vector with CMV promoter ATG Enhanced expression ATG Gene ATG Dominant negative or functional domain ATG Antisense RNA

Reversible insertional mutation Lentiviral vector with loxp sites (defective promoter in LTR) LoxP LoxP Insertional mutation + Gene wild type Gene mutant Reverted with Cre Cre Gene Gene wild type

Part I VBIM technique identifies F-box leucine repeat rich protein (FBXL11) as a novel regulator of NF-κB

Human cancers Constitutive activation Baud V and Karin M. (2009).Nat Rev Drug Discov 8, 33-40.

Stimuli Model (Activation) Methylation NFκB FBXL11 Demethylation (Inhibition) NFκB NFκB κb Target genes Lu, T et al. (2010). Proc Natl Acad Sci 107:46-51.

Take-home message We successfully developed the lentiviral VBIM technique, which has broad application in a variety of signaling systems. Using VBIM technique we identified and confirmed that FBXL11 is a novel negative regulator of NF-κB. Lu, T et al. (2009). Proc Natl Acad Sci 106:16339-44.

Part II Target discovery: Using VBIM to identify carboplatin resistance gene in ovarian cancer (OC) cells

Background 1. Ovarian cancer is the sixth most common cause of cancer in women globally with over 200,000 cases diagnosed annually. 2. Chemotherapy resistance is a complex process using different mechanisms and pathways. However, the mechanism is NOT fully understood.

Experimental Design

In our ongoing carboplatin resistance gene identification study, NCR-1, 2, 3 (Novel carboplatin resistance protein) have been identified in A2780 OC cells

A2780 NCR-1 overexpressing and shrna knockdown cells Ctrl NCR-1 NCR-1 β-actin Ctrl shncr-1 NCR-1 β-actin Wei H et al, unpublished data

Effect of NCR-1 on carboplatin resistance in A2780 OC cells NCR1 Ctrl shncr1 Wei et al, unpublished data

NCR1 is an NF-κB activator in 293 cells * NCR1 β-actin

NCR1 is an NF-κB activator in A2780 OC cells

Expression of NCR-1 in cancer Ovarian cancer Breast cancer Oncomine data

Correlation between NCR1 expression and OC (Tumor microarray) ression level NCR1 expr

NCR is overexpressed in OC

VBIM and high throughput screen (HTS) of drug resistance gene in OC cells VBIM virus Plated A2780 ovarian cells Options: 1. Multiple plates 2. Multiple drugs carboplatin whole genome RNAseq Oncomine TCGA ICGC data Bioinformatics analysis Drug resistant mutant cells PCR and targeted RNAseq experiment Expression profile in ovarian cancer cells & tissues

Significance 1. Lead to the discovery of novel carboplatin resistant genes in ovarian cancer. 2. Yield mechanisms of gene-mediated carboplatin resistance, so that reversal or bypass of this resistance can be achieved by developing small chemical inhibitors in ovarian cancer. 3. In a broader scope, the findings in ovarian cancer would further shed light on mechanisms of carboplatin resistance in other cancers as well.

Successful applications of VBIM technology 1. Lu T*, Jackson MW, Singhi AD, Kandel ES, Yang MJ, Zhang Y, Gudkov AV, and Stark GR*. (2009). Validation-based insertional mutagenesis identifies lysine demethylase FBXL11 as a negative regulator of NF-kB. Proc Natl Acad Sci USA. 106, 16339-16344. (*corresponding authors). 2. Lu T*, Jackson MW, Wang B, Yang M, Chance M, Miyagi M, Gudkov AV, and Stark GR*. (2010). Regulation of NF-kB by NSD1/FBXL11-dependent reversible lysine methylation of p65. Proc Natl Acad Sci USA. 107, 46-51. (*corresponding authors). 3. Lu T, Stark GR. (2010). Use of forward genetics to discover novel regulators of NF-kB. Cold Spring Harb Perspect Biol. a001966. 4. De S, et al. (2009). Overexpression of kinesins mediates docetaxel resistance in breast cancer cells. Cancer Res. 69(20):8035-8042. 5. Guo C, et al. (2011). FER tyrosine kinase (FER) overexpression mediates resistance to quinacrine through EGFdependent activation of NF-kB. Proc Natl Acad Sci U S A. 108(19):7968-7973. 6. Tan MH et al. (2012). Specific kinesin expression profiles associated with taxane resistance in basal-like breast cancer. Breast Cancer Res Treat. 131(3):849-58. 7. Cipriano R, et al. (2012).FAM83B mediates EGFR- and RAS-driven oncogenic transformation. J Clin Invest. 122(9):3197-210. 8. Wang B, Zhang X, Zhao Z. (2013). Validation-based insertional mutagenesis for identification of Nup214 as a host factor for EV71 replication in RD cells. Biochem Biophys Res Commun. 437(3):452-6. 9. Cipriano R et al. (2013). FAM83B-mediated activation of PI3K/AKT and MAPK signaling cooperates to promote epithelial cell transformation and resistance to targeted therapies. Oncotarget 4(5):729-38.

Acknowledgments Lu Lab, Indiana University Han Wei, Ph.D. Rasika Mundade, Ph.D. student Larry Hua, Research Scholar Yun She, B.S. Lindsey Pyron, Summer student Cleveland Clinic Dr. George Stark Dr. Mark Jackson Dr. Eugene Kandel Case Western Reserve University Mass Spectrometry Center Dr. Benlian Wang Dr. Masaru Miyagi Dr. Mark Chance Indiana University Dr. Lang Li Dr. Yunlong Liu Dr. George Sandusky Roswell Park Cancer Institute Dr. Andrei Gudkov Dr. Aatur Singh Harvard University Dr. Yi Zhang

THE END

Let Us Meet Again We welcome you all to our future conferences of OMICS Group International Please Visit: www.omicsgroup.com www.conferenceseries.com www.pharmaceuticalconferences.com