Metabolic Solutions Development Company, Kalamazoo, USA.

Similar documents
ENHANCEMENT OF BROWN ADIPOSE TISSUE DEVELOPMENT IN VIVO BY A NOVEL INSULIN SENSITIZER

SUPPLEMENTARY INFORMATION

Supplemental Material:

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

In The Name Of God. In The Name Of. EMRI Modeling Group

Project Summary. Funded by The Beef Checkoff. Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

ab Adipogenesis Assay Kit (Cell-Based)

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Cited4 is a sex-biased mediator of the antidiabetic glitazone response in adipocyte progenitors

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Examination of Mechanisms of Hepatotoxicity of Anti-diabetic PPARγ Agonists Using Applied Biosystems Rat Whole Genome Microarrays

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Combining molecular modelling with experiments: Sulfonylureas and glinides as new PPARγ agonists

Novel insulin sensitizer modulates nutrient sensing pathways and maintains beta-cell phenotype in human islets

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Beneficial effects of naringenin and indomethacin on white and brown adipocytes

NASH Bench to Bedside

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Tadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual

In search for obesogens. Ewa Szalowska BDS Amsterdam 2012

SUPPLEMENTARY INFORMATION

Diabetes Diabetes mellitus is a chronic disease characterized by elevated blood sugars for months to years. Diabetes is characterized by either: (1) a

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Endocrine Disrupters as Obesogens

Endonuclease G (EndoG) is one of the most abundant

Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue

Beige fat: A New Hope for Metabolic Disorder

WY14643 combined with all-trans retinoic acid acts via p38 MAPK to induce browning of white adipocytes in mice

Plasma exposure levels from individual mice 4 hours post IP administration at the

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

Production of Exosomes in a Hollow Fiber Bioreactor

Metabolic Syndrome. DOPE amines COGS 163

2.5. AMPK activity

ACTH Enhances Lipid Accumulation in Bone-marrow derived Mesenchymal stem cells undergoing adipogenesis

3-Thia Fatty Acids A New Generation of Functional Lipids?

Thiazolidinediones and the risk of bladder cancer: A cohort study. R Mamtani, K Haynes, WB Bilker, DJ Vaughn, BL Strom, K Glanz, JD Lewis

FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets

Galvus the most comprehensively studied DPP-4 inhibitor

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Outline. Fitting Nutrition into Your Genes. Martha A. Belury, Ph.D., R.D. Martha A. Belury Sept 2018

FGF21 Resistance in Adipose Tissues as a Cause of Insulin Resistance

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

SUPPLEMENTARY INFORMATION

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Pr oject Summar y. The Role of Fatty Acids at Enhancing Marbling Development through Bovine G-coupled Protein Receptors (GPR)

Autophagy regulates adipose mass and differentiation in mice

Expanded View Figures

Naohito AOKI, Erina ARAKAWA and Miyuki ITO. Department of Life Science, Graduate School of Bioresources, Mie University Tsu ABSTRACT

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Anti-inflammatory properties of SM04690, a small molecule inhibitor of the Wnt pathway as a potential treatment for knee osteoarthritis

Supplementary Materials for

and Restenosis Yangsoo Jang, MD, PhD. Yonsei University College of Medicine

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019

GLUCOSE CONCENTRATION INCREASES IGF EXPRESSION FROM SYNOVIAL MEMBRANE

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

Consecutive Positive Feedback Loops Create a Bistable Switch that Controls Preadipocyte-to-Adipocyte Conversion

Rat Primary Pre-adipocytes Culture Kit

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Cardiac natriuretic peptides act via p38 MAPK to induce the brown fat thermogenic program in mouse and human adipocytes

Untargeted strategy for identification of Toxic Chemicals in OSPW

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Adipose tissue dysfunction in obesity. Gijs Goossens, PhD

The Origin of Human White, Brown, and Brite/ Beige Adipocytes

Regulation of adipose tissue remodeling by peripheral serotonin

Pioglitazone And The Heart. Prof. Hilla Knobler Diabetes and Metabolic Disease Unit Kaplan Medical Center, Rehovot

Type 2 Diabetes and Cancer: Is there a link?

Glucose Uptake Assay Kit (Red Fluorescence)

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Review Article Novel Browning Agents, Mechanisms, and Therapeutic Potentials of Brown Adipose Tissue

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

PRODUCT INFORMATION & MANUAL

Development & Characterization of Pooled and Plated Hepatocytes to Support the Evolving DMPK Landscape

SUPPLEMENTARY INFORMATION

Supplementary Materials for

Supporting Information

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

ShapePerfection Burns fat fights cellulite

Supporting Information Table of content

Supplementary Information

Lipout. Burns stored fat and achieves centimetric reduction BODY SCULPTURE

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.

Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids

Supporting Information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Transcription:

New Insulin Sensitizers Produce Differentiation of Brown-like Adipose Cells from a Subcutaneous Fat Depot and Increase Secretion of Adiponectin in vitro William G. McDonald, Serena L. Cole, Danielle D. Holewa, Angela S. Brightwell-Conrad, Peter K. Harris, Jerry R. Colca, and Rolf F. Kletzien. Metabolic Solutions Development Company, Kalamazoo, USA. 1

Presenter Disclosure Jerry R. Colca, PhD Board Member/Cofounder: Metabolic Solutions Development Co., LLC Employee: Metabolic Solutions Development Co., LLC Stock/Shareholder: Metabolic Solutions Development Co., LLC 2

Mechanism of Action for Insulin Sensitizers ld Troglitazone; Rosiglitazone; Pioglitazone riginal TZDs New MSDC (mtt) PPAR MSDC-0160 MSDC-0602 PPAR-Driven Gene Changes (Phase 2 clinical trials) Metabolic signals Fat Sequestered Increased Insulin Action Fluid Retention Weight Gain Nuclear Regulatory Factors Improved Insulin Action Improved Lipid Profiles Regeneration of Brown Fat Regeneration of β-cells 3

% of Maximal Response 1.2 Relative Activity Against PPARγ PPAR Binding Rosiglitazone (IC50=0.148 M) 1.0 0.8 0.6 0.4 0.2 Rosi Pio 0602 0160 Pioglitazone (IC50=1.623 M) MSDC-0160 (IC50=23.73 m) MSDC-0602 (IC50=15.54 M) Binding Activation EC 50 ( M) Fold rosi 1 Fold rosi 2 Rosi 0.148 1.00 1.00 Pio 1.623 11 3 602 15.54 105 39 160 23.73 160 29 1 Lantha screen binding 2 Gene blazer- cell activation 0.0 0.0001 0.001 0.01 0.1 1 10 100 1000 Concentration ( M) This Presentation: Compounds also stimulate brown-like phenotype in precursors from axillary fat pads and stimulate production and secretion of adiponectin in a PPAR -independent manner. 4

TZDs Increase Differentiation of Brown Fat Progenitors MSDC-0160 ( M) N S MSDC-0160 NH S NH MSDC-0602 N Pioglitazone S NH Rosiglitazone The effect of TZDs on BAT is maintained in new insulin sensitizers. Similar to pio and rosi (although > 30-fold, 10-fold reduction at PPAR vs rosi, pio). Not blocked by PPAR antagonists; signaling occurs in PPAR -K cells. Will new insulin sensitizers affect subcutaneous fat? > Adiponectin production/secretion? 5

Methods Progenitor cells are isolated from axillary fat pads from 3-4 week old CD-1 mice and cultured for 7 days in DMEM + 10% FBS. At 90% confluence the cells are treated with various concentrations of compounds (172 nm insulin); medium is changed every 48 hours with fresh additions. Cells are harvested for mrna analysis (rt-pcr) and Western Blots at various time points. Conditioned medium is harvested for measurement of secreted adiponectin by ELISA. Pad isolated from 10-15 mice Digested with collagenase Precursors isolated and plated Grown to 90% confluence 6

Conversion of Progenitor Cells to Brown-like Phenotype (7 days of treatment) Multilocular fat droplets Increased Mitochondria Increased UCP1 (message and protein) Increased adiponectin (message, protein, and secretion) 7

PPAR Antagonists Do Not Block Compound-Induced Effects on UCP1 UCP1- mrna Note: antagonists affect baseline UCP1 mrna and differentiation in absence of compounds UCP1- Western Blot and rosi action in a PPAR cell assay 0.3 M rosi but do not block the effects of the compounds to increase UCP1 mrna and protein. 8

Increase in UCP1 Protein Expression in Subcutaneous Adipose Progenitors Time (days) Dose ( M) New Insulin Sensitizers Increase UCP1 Message and Protein In SC Adipose 9

Increased Mitochondria in Subcutaneous Adipose Progenitors CD-1 mice MSDC-0160 MSDC-0602 MSDC-0160. New Insulin sensitizers also increase mitochondrial biogenesis by a mechanism independent of PPAR activation in SC adipose progenitors. 10

Increased Adiponectin Production and Secretion Intensity (x1000) Western blot Secretion Time Course Analogs 4 Days Time (Days) Compound (3 M) New insulin sensitizers directly increase adiponectin production in subcutaneous adipose Independent of expansion of white fat or activation of PPAR. 11

Summary New insulin sensitizing agents cause browning of progenitor cells from the axillary fat pad in a PPAR-independent manner. Not related to ability to bind to and activate PPAR - rosi vs 0160 and 0602 Not blocked by PPAR antagonists This mechanism includes increase in UCP1 and mitochondrial biogenesis. mrna Protein The compounds increase adiponection in a PPAR -independent manner. Expression Secretion into the medium New insulin sensitizers not only stimulate differentiation of dedicated brown fat progenitor cells but also favor brown adipose-like phenotype and increase adiponectin secretion from subcutaneous adipose. There is potential for a new generation of insulin sensitizing agents that avoids side effects associated with activation of PPAR. 12

Implications for Novel Agents 13