Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury
|
|
|
- Rodger Campbell
- 5 years ago
- Views:
Transcription
1 Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Swapan K. Ray, PhD Professor, Department of Pathology, Microbiology, and Immunology USC School of Medicine, Columbia, SC SC SCIRF Presentation at HealthSouth Rehabilitation Hospital, Columbia, SC May 2, 2014
2 Spinal cord injury (SCI) and treatment strategies SCI at lower spinal cord regions (thoracic, lumbar, or sacral) causes paraplegia. SCI at cervical region causes quadriplegia that may affect all four limbs (arms and the legs). The pathophysiology of SCI is highly complex. Currently, more than 250,000 SCI patients cost more than 4 billion dollars annually in the US. At present, methylprednisolone (MP) at high-dose (30 mg/kg) is the only FDA recommended treatment for acute SCI in humans. High-dose MP may also cause muscle damage or myopathy in acute SCI patients. There are no suitable therapeutic strategies yet for treatment of chronic SCI patients. New therapeutic strategies must be developed for treatment of both acute and SCI patients. Nuclear receptors are ligand-inducible transcription factors that control expression of their target genes. We think that nuclear receptors are significant molecular targets for neuroprotection in acute and chronic SCI in rats. Estrogen receptor agonists target estrogen receptor alpha (ERα) or/and ER beta (ERβ), which are nuclear receptors, to provide neuroprotection and improve motor function in SCI in rats. Ray et al. Brain Res Rev 42: , 2003; Ray et al. Neurotherapeutics 8: , 2011.
3 Estrogen receptor (ER) agonists and antagonist Compound 1,3,5-Tris (4- hydroxyphenyl)-4- propyl-1h-pyrazole (PPT) ER selectivity PPT is a selective ERα agonist that displays 400-fold selectivity for ERα over ERβ. 7-Bromo-2-(4- hydroxyphenyl)-1,3- benzoxazol-5-ol (WAY ) 17-β-Estradiol or estrogen (EST) ICI 182,780 WAY is a selective ERβ agonist with 68 folds more affinity over ERα. EST is a naturally occurring hormone that binds to both ERα and ERβ. ICI 182,780 is an ER antagonist. It is known to down regulate both estrogen receptors in vitro and in vivo. Functions of ER agonists and antagonist An ER agonist provides neuroprotection by modulating angiogenesis, inflammatory responses, and oxidative stress. An ER antagonist inhibits the neuroprotective functions of an ER agonist.
4 Involvement of ERα and ERβ in neuroprotection Figure 2. RT-PCR and Western blotting for levels of ERα and ERβ in VSC4.1 motoneunons. (A) RT-PCR for alterations in mrna expression of ERα and ERβ. (B) Determination of percent changes in mrna expression of ERα and ERβ. (C) Western blotting for alterations in protein expression of ERα and ERβ. (D) Determination of percent changes in protein expression of ERα and ERβ. Chakrabarti et al. Neuroscience 256: , 2014.
5 Alterations in expression of specific micrornas (mirs) in VSC4.1 cells following treatment with CI and ER agonist Figure 3. Qualitative RT-PCR and real-time qrt-pcr to determine levels of specific mirs in VSC4.1 motoneurons. (A) Qualitative RT-PCR products of mirs were resolved by 2.2% agarose gel electrophoresis. (B) Real-time qrt-pcr products were analyzed for levels of expression of mirs after normalizing with U6 RNA. Chakrabarti et al. Neuroscience 256: , 2014.
6 Overexpression of mir-7-1 enhanced efficacy of ER agonists in preventing apoptosis in motoneurons Figure 4. Overexpression of mir-7-1 enhanced the efficacy of WAY or EST for prevention of apoptosis in the CI insulted VSC4.1 motoneurons. Cells were then subjected to Annexin V-FITC/PI staining and flow cytometry for percentages of apoptotic cells. Chakrabarti et al. Neuroscience 256: , 2014.
7 Combination of mir-7-1 and ER agonist provided functional neuroprotection to motoneurons Figure 7. Transfection with mir-7-1 mimic followed by treatment with WAY or EST provided functional neuroprotection in VSC4.1 motoneurons. (A) Whole cell membrane potential. (B) JC-1 ratio (590 nm: 530 nm) at different time points (0 to 12 h). (C) Prevention mitochondrial release of cytochrome c (Cyt c) and Smac/Diablo into the cytosol. (D) Percent changes in the mitochondrial and cytosolic cytochrome c (Cyt c) and cytosolic Smac/Diablo. Chakrabarti et al. Neuroscience 256: , 2014.
8 Induction and treatment of subacute SCI in rats Pathological and experimental therapeutic studies can be designed for acute (0-1 week), subacute (1-4 weeks), and chronic (1-6 months) phases following SCI in adult Sprague-Dawley rats. Figure 1. Schematic presentation of induction of subacute SCI (40 g.cm force) at T10 in rats. The putative SCI penumbra is shown at 1 day and 14 days after induction of injury.
9 Figure 2. Use of the Basso, Beattie, and Bresnahan (BBB) rating scale to assess locomomor function in subacute SCI in Sprague-Dawley rats. The BBB scores were recorded every day for 14 days. Significant early stage (scale of 0-7) improvements in locomotor function were noted in the treated SCI animals when compared with the vehicle treated SCI animals on day 14. Figure 3. Determination of expression of ERα and ERβ in subacute SCI rats following treatments for 14 days. (A) RT-PCR for assessing mrna expression of ERα and ERβ in SCI lesion segment. (B) Western blotting for assessing protein expression of ERα and ERβ in SCI lesion segment.
10 Increase in survival signaling and inhibition of apoptotic process in subacute SCI in Sprauge-Dawley rats after therapy Figure 4. Increase in expression of specific molecules for survival signaling in subacute SCI in Sprague-Dawley rats following treatments for 14 days. Western blotting for assessing protein expression of PI3K, p-akt, p-bad, HIF-1α and β- Actin in SCI lesion segment. Figure 5. Modulation of expression of the molecules for inhibition of apoptotic death signaling in subacute SCI in Sprague-Dawley rats following treatments for 14 days. Extraction of protein sample to perform Western blotting for assessing protein expression of Bax, Bcl-2, Cytochrome c (Cyto c), Caspase-9, Caspase-3, sprectrin break down product (SBDP), and β- Actin in SCI lesion segment. β-actin expression was used as a loading control.
Frontiers of Science Foundation Scholar. Toby Bothwell. Freshman, University of Arkansas. final research manuscripts
Frontiers of Science Foundation Scholar Toby Bothwell Oklahoma city, OKlahoma Freshman, University of Arkansas final research manuscripts The Effect of Estradiol and Estrogen Receptors α and β on Bone
Victor Chaban, Ph.D., MSCR
Hormonal Modulation of Pain : Estrogen Modulation of Visceral Nociception Victor Chaban, Ph.D., MSCR Department of Internal Medicine Charles R. Drew University of Medicine and Science Department of Medicine
B-cell. Astrocyte SCI SCI. T-cell
RF #2015 P-01 PI: Azizul Haque, PhD Grant Title: Targeting Enolase in Spinal Cord Injury 12-month Technical Progress Report Progress Report (First Six Months): Enolase is one of the most abundantly expressed
Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T
Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
Supplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
Nuclear Receptors. Estrogen and Thyroid Hormone Receptors and their Interaction. Estrogen Hormone Receptor.
SZENT ISTVÁN UNIVERSITY FACULTY OF VETERINARY MEDICINE Nuclear Receptors Estrogen and Thyroid Hormone Receptors and their Interaction Lior Kerner Budapest, 2012 What are Nuclear Receptors? o Proteins located
Page 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update
NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update 1 Overview The natural growth factor IGF-1 is broken down in the body to IGF-1[1-3] NNZ-2566 is an analogue of IGF-1[1-3] developed
BIK BIM NOXA PUMA MCL-1. p53
HT116 cells A IK IM NOXA PUMA ML-1 p53 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48 Procaspase 3 PARP leaved Product 12 8 4 24 hr 48 hr Figure S1. HT116 cell death by different proteasome inhibitors.
TITLE: Extranuclear Signaling Effects Mediated by the Estrogen Receptor
AD Award Number: W81XWH-05-1-0241 TITLE: Extranuclear Signaling Effects Mediated by the Estrogen Receptor PRINCIPAL INVESTIGATOR: Erin O Neill, B.S. Geoffrey Greene CONTRACTING ORGANIZATION: University
Estrogen s Role in Aiding the Growth of Cancer Cells. Kelly Mayfield. Copyright May, 2015, Kelly Mayfield and Koni Stone
Estrogen s Role in Aiding the Growth of Cancer Cells Kelly Mayfield Copyright May, 2015, Kelly Mayfield and Koni Stone According to the American Cancer Society, breast cancer is the second leading cause
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
TITLE: Extranuclear Signaling Effects Mediated by the Estrogen Receptor
AD Award Number: W81XWH-05-1-0241 TITLE: Extranuclear Signaling Effects Mediated by the Estrogen Receptor PRINCIPAL INVESTIGATOR: Erin O Neill, B.S. CONTRACTING ORGANIZATION: University of Chicago Chicago,
An Epstein-Barr virus-encoded microrna targets PUMA to promote host cell survival
An Epstein-Barr virus-encoded microrna targets to promote host cell survival The Journal of Experimental Medicine 205(11): 2551-2560, 2008. 1 Elizabeth Yee-Wai Choy, Kam-Leung Siu, Kin-Hang Kok, Raymond
Molecular biology :- Cancer genetics lecture 11
Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to
supplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
The effect of elemene reversing the multidurg resistance of A549/DDP lung cancer cells
213 12 33 12 TUMOR Vol. 33, December 213 www.tumorsci.org 161 Basic Research DOI: 1.3781/j.issn.1-7431.213.12. 5 Copyright 213 by TUMOR A549/DDP 1, 2 2 1 3 4 1 1 1. 3619 2. 355 3. 3611 4. 361 elemene cisplatin
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
ENVIRONMENTAL HEALTH PERSPECTIVES
ehp ehponline.org ENVIRONMENTAL HEALTH PERSPECTIVES Bisphenol A at Low Nanomolar Doses Confers Chemoresistance in Estrogen Receptor Alpha Positive and Negative Breast Cancer Cells Elizabeth W. LaPensee,
Supplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
Supplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Supplementary Figures
Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
In vivo prediction of anti-tumor effect of 3- bromopyruvate in Hepatocellular Carcinoma using Tc-99m labeled annexin-v imaging
In vivo prediction of anti-tumor effect of 3- bromopyruvate in Hepatocellular Carcinoma using Tc-99m labeled annexin-v imaging Won Kim, Jung-Hwan Yoon*, Gi Jeong Cheon, Tae Sup Lee, Chung Yong Kim Department
Introduction to pathology lecture 5/ Cell injury apoptosis. Dr H Awad 2017/18
Introduction to pathology lecture 5/ Cell injury apoptosis Dr H Awad 2017/18 Apoptosis = programmed cell death = cell suicide= individual cell death Apoptosis cell death induced by a tightly regulated
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
Supplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
Rapamycin suppresses astrocytic and microglial activation and reduces development of neuropathic pain after spinal cord injury in mice.
Rapamycin suppresses astrocytic and microglial activation and reduces development of neuropathic pain after spinal cord injury in mice. Satoshi Tateda, MD, Haruo Kanno, MD, PhD, Hiroshi Ozawa, MD, PhD,
SCIRF Award #2016 I-03 PI: Azizul Haque, PhD Grant Title: Neuron-specific Enolase and SCI
SCIRF Award #2016 I-03 PI: Azizul Haque, PhD Grant Title: Neuron-specific Enolase and SCI 10-month Technical Progress Report Enolase is a multifunctional glycolytic enzyme involved in growth control, hypoxia,
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is
' ^Summary C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein pigment isolated from Spirulina platensis. This water- soluble protein pigment is of greater importance because of its various
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
Epigonal Conditioned Media from Bonnethead Shark, Sphyrna tiburo, Induces Apoptosis in a T-Cell Leukemia Cell Line, Jurkat E6-1
Mar. Drugs 2013, 11, 3224-3257; doi:10.3390/md11093224 Article OPEN ACCESS marine drugs ISSN 1660-3397 www.mdpi.com/journal/marinedrugs Epigonal Conditioned Media from Bonnethead Shark, Sphyrna tiburo,
DIET, AGING, and MIND Part II. Neal G. Simon, Ph. D. Dept. of Biological Sciences Lehigh University
DIET, AGING, and MIND Part II Neal G. Simon, Ph. D. Dept. of Biological Sciences Lehigh University Outline: Diet, Aging, and Mind 1. Review 2. Brain Changes in Aging 3. Dementias 4. Dietary Interventions:
BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr.
BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES Overview and Mechanism of Action Dr. Leah Klapper, CSO 88 BL-8040: Novel CXCR4 Antagonist For Hematological Cancers Indications:
Supplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.
HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.
HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Pathogenesis of Cervical Myelopathy in Chronic Cervical Cord Compression Model of Rat
Pathogenesis of Cervical Myelopathy in Chronic Cervical Cord Compression Model of Rat Shigeru Kobayashi,MD,PhD 1, Masafumi Kubota, PT 1, Hisao Iwamoto, MD,PhD 2, Riya Kosaka,MD,PhD 3, Katsuhiko Hayakawa,MD,PhD
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
mir-424 protects PC-12 cells from OGD-induced injury by negatively regulating MKP-1
European Review for Medical and Pharmacological Sciences 2018; 22: 1426-1436 mir-424 protects PC-12 cells from OGD-induced injury by negatively regulating MKP-1 Y.-X. CAO 1, Z.-Q. WANG 2, J.-X. KANG 3,
Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology COX-2 NTera-2 NTera-2 RT-PCR FasL caspase-8 caspase-3 PARP.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 7 28 7 630 ~ 636 NTera-2 ** ** * 410081 COX-2 NTera-2 MTT NTera-2 NTera-2 Hoechest 33258
Problem Set 8 Key 1 of 8
7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients
Insight into cancer research from discovery to validation
Insight into cancer research from discovery to validation 1 Exosomes in cancer research: from exosome isolation to biomarker discovery Zheng Songyue, PhD Technical Sales Specialists Life Technologies The
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
Nabeel R. Obeid Mentors: Erin A. Booth and Dr. Benedict R. Lucchesi
Cardioprotective Action of Selective Estrogen-receptor Agonists against Myocardial Ischemia and Reperfusion Injury Nabeel R. Obeid Mentors: Erin A. Booth and Dr. Benedict R. Lucchesi Abstract Cell death
TITLE: Autocrine and Paracrine Control of Breast Cancer Growth by Sex Hormone-Binding Globulin
AD Award Number: DAMD17-02-1-0572 TITLE: Autocrine and Paracrine Control of Breast Cancer Growth by Sex Hormone-Binding Globulin PRINCIPAL INVESTIGATOR: William Rosner, M.D. Scott M. Kahn, Ph.D. CONTRACTING
GENERAL SUMMARY Corpus luteum is a transient endocrine structure formed from the ruptured ovarian follicle. Its main function is to secrete P 4, a pro
Corpus luteum is a transient endocrine structure formed from the ruptured ovarian follicle. Its main function is to secrete P 4, a pro-gestational hormone, essential for establishment and maintenance of
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
Enhancement of C2C12 myoblast proliferation and differentiation by diarylheptanoid form Curcuma comosa Roxb.
Enhancement of C2C12 myoblast proliferation and differentiation by diarylheptanoid form Curcuma comosa Roxb. Curcuma comosa Roxb. Mr. Chittipong Tipbunjong Mahidol University Bangkok, Thailand Muscle regeneration
Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes
Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
Identification of influential proteins in the classical retinoic acid signaling pathway
Ghaffari and Petzold Theoretical Biology and Medical Modelling (2018) 15:16 https://doi.org/10.1186/s12976-018-0088-7 RESEARCH Open Access Identification of influential proteins in the classical retinoic
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from
Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as
The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors
Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor
RECEIVED. W. M. Keck Center for Collaborative Neuroscience 604 Allison Road, D-251 Piscataway, NJ (732)
Principal Investigator: Dongming Sun, W. M. Keck Center for Collaborative Neuroscience 604 Allison Road, D-251 Piscataway, NJ 08854 (732) 445-1832 RECEIVED NJ COMMISSION ON SPINAL CORD RESEARCH The overall
Chapter 4. Estrogen receptor expression in human macrophages
Chapter 4 Estrogen receptor expression in human macrophages 4.1. Introduction Macrophages respond to estrogen present in their microenvironment and hence should express functional estrogen receptors unless
Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
Effect of low temperatures on BAX and BCL2 proteins in rats with spinal cord ischemia reperfusion injury
Effect of low temperatures on BAX and BCL2 proteins in rats with spinal cord ischemia reperfusion injury P. Zhu 1 *, M.Y. Zhao 1,2 *, X.H. Li 1 *, Q. Fu 1, Z.F. Zhou 1, C.F. Huang 1, X.S. Zhang 1, H.L.
Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
Original Article Suppression of mir-301a alleviates LPS-induced inflammatory injury in ATDC5 chondrogenic cells by targeting Sirt1
Int J Clin Exp Pathol 2017;10(8):8991-9000 www.ijcep.com /ISSN:1936-2625/IJCEP0057081 Original Article Suppression of mir-301a alleviates LPS-induced inflammatory injury in ATDC5 chondrogenic cells by
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-11-1-77 TITLE: Translational Pharmacologic Efficacy Studies of Glial Growth Factor 2 (GGF2) in Spinal Cord Injury Models and in the Veterinary Clinical Setting PRINCIPAL INVESTIGATOR:
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
MiRNA-202 impacts proliferation and apoptosis of granulose cells
MiRNA-202 impacts proliferation and apoptosis of granulose cells Liqiong Huang, Bo Zheng*, Yi He Department of Obstetrics and Gynecology, Xianning Central Hospital, The First Affiliated Hospital Of Hubei
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Contribution of microglia to tissue injury and repair in MS
Contribution of microglia to tissue injury and repair in MS MS disease course histologic features Courtesy of Samuel Ludwin I ACUTE CHRONIC s ACTIVE CHRONIC Clinical Course Intra CNS Extra CNS Imaging
PREP Course # 2 Optimizing Poster Presentations. Presented by: Bettie M. Steinberg, PhD Chief Scientific Officer
PREP Course # Optimizing Poster Presentations Presented by: Bettie M. Steinberg, PhD Chief Scientific Officer CME Disclosure Statement The North Shore LIJ Health System adheres to the ACCME s new Standards
MSc CANCER CELL AND MOLECULAR BIOLOGY (2008/9)
Faculty of Medicine and Biological Sciences Department of Biochemistry MSc CANCER CELL AND MOLECULAR BIOLOGY (2008/9) COURSE AIMS AND STRUCTURE Background The MSc in Cancer Cell and Molecular Biology is
Thomas Jefferson University Annual Progress Report: 2008 Formula Grant
Thomas Jefferson University Annual Progress Report: 2008 Formula Grant Reporting Period July 1, 2012 December 31, 2012 Formula Grant Overview The Thomas Jefferson University received $3,455,597 in formula
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect