SALSA MS-MLPA probemix ME028-B2 PRADER WILLI/ANGELMAN Lot B2-0811: As compared to version B1 (lot B1-0609, B1-1108), the 88 and 96 nt control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME (PWS) and ANGELMAN SYNDROME (AS) are distinct neurogenetic disorders, both usually caused by chromosomal deletions on chromosome 15q11 or by uniparental disomy. The chromosomal alterations result in an aberrant expression profile of gene loci that are subject to imprinting. Absence of a paternal allele of chromosome 15q11, due to chromosomal deletion or uniparental disomy, results in PWS. The absence of the maternal copy of the same region causes AS. This SALSA MS- probemix ME028 can be used to detect copy number changes, as well as to analyse CpG island methylation of the 15q11 region in a semi-quantitative manner. This SALSA ME028-B2 PWS/AS probemix contains 32 probes specific for sequences in or near the PWS/AS critical region of chromosome 15q11, which can be used to detect copy number changes in this region. Five of these probes are specific for an imprinted sequence and contain a recognition site for the methylation sensitive HhaI enzyme. These five probes can be used for the presence of aberrant methylation patterns in the 15q11 locus, either caused by uniparental disomy or by imprinting defects. For the analysis of results, 14 reference probes for genes located outside the PWS/AS region are present. In addition, three probes are present that will indicate complete digestion by the HhaI enzyme in the methylation quantification reaction. Please note that each MS-MLPA reaction generates two samples that are analysed by capillary electrophoresis: one undigested sample for copy number detection and one HhaI digested sample for methylation detection. More information about MS-MLPA on page 5 and in the MS-MLPA protocol. This SALSA MS- probemix can be used to detect aberrant methylation of one or more sequences of the Prader Willi / Angelman region. Methylation levels can be different for different tissues. Please use DNA derived from the same type of tissue and purified by the same method as reference sample. This SALSA MS- MLPA probemix can also be used to detect deletions and duplications of one or more sequences of the 15q11 region in a DNA sample. Heterozygous deletions of probe recognition sequences should give a 35-50% reduced relative peak area of the amplification product of that probe. However, mutations and/or polymorphisms very close to the probe ligation site may also result in a reduced relative peak area. Therefore, apparent deletions detected by a single probe always require confirmation by other methods. Please note several copy number changes affecting only a part of the 15q11 PWS/AS region have been described in healthy persons. Analysis of parental DNA samples can therefore in some cases be required for correct interpretation of results. MS- probemixes are sold by for research purposes and to demonstrate the possibilities of the MLPA technique. They are not CE/FDA certified for use in diagnostic procedures. Purchase of the SALSA test probemixes and reagents includes a limited license to use these products for research purposes. The use of this SALSA probemix and reagents requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA technique has been first described in Nucleic Acid Research 30, e57 (2002). The MS-MLPA method for the detection of both copy numbers and methylation changes was described in Nucleic Acid Research 33, e128 by Nygren et al. 2005. Related SALSA probemixes ME030 BWS: Contains probes for Beckwith-Wiedemann syndrome. P336 UBE3A: contains probes for each UBE3A exon. P343 Autism: Contains additional probes for UBE3A and the 15q13 region. More information Website : www.mlpa.com E-mail : info@mlpa.com (information & technical questions); order@mlpa.com (for orders) Mail : bv; Willem Schoutenstraat 6, 1057 DN Amsterdam, the Netherlands SALSA MS- probemix ME028 Prader Willi / Angelman Page 1 of 12
References for SALSA probemix ME028 Ramsden et al (2010). Practice guidelines for the molecular analysis of Prader-Willi and Angelman syndromes. BMC Med Genet 2010 may 11; 11:70. Bittel D.C. et al (2007). Methylation-specific multiplex ligation-dependent probe amplification: analysis of subjects with chromosome 15 abnormalities. Genet Test. 2007; Winter; 11(4):467-475. Dikow, N. et al. (2007). Quantification of the methylation status of the PWS/AS imprinted region: comparison of two approaches based on bisulfite sequencing and methylation-sensitive MLPA. Mol.Cell Probes.. 2007 Jun;21(3):208-15. Procter M. et al. (2006). Molecular Diagnosis of Prader-Willi and Angelman Syndromes by Methylation- Specific Melting Analysis and Methylation-Specific Multiplex Ligation-Dependent Probe Amplification. Clin Chem. 2006 Jul;52(7):1276-83. Reference DNA samples Please note that the NIBSC provides an excellent panel of WHO certified genomic DNA samples for Prader Willi and Angelman syndrome: www.nibsc.ac.uk/products/biological_reference_materials/product_catalogue/detail_page.aspx?catid=09/140 Methylation-Specific MLPA Please note that each MS-MLPA reaction generates two samples that need analysis by capillary electrophoresis: one undigested sample for copy number detection and one digested sample for methylation detection. A modification of the MLPA technique, MS-MLPA allows the detection of both copy number changes and unusual methylation levels of 10-50 different sequences in one simple reaction. MLPA probes for methylation quantification are similar to normal MLPA probes, except that the sequence detected by the MS-MLPA probe contains the sequence recognized by the methylation-sensitive restriction enzyme HhaI. Similar to ordinary MLPA reactions, the MS-MLPA protocol starts with sample DNA denaturation and overnight hybridization. The reaction then is split into two tubes. One tube is processed as a standard MLPA reaction. This reaction provides information on copy number changes. The other tube of the MLPA hybridization reaction is incubated with the methylation-sensitive HhaI endonuclease while simultaneously, the hybridized probes are ligated. Hybrids of (unmethylated) probe oligonucleotides and unmethylated sample DNA are digested by the HhaI enzyme. Digested probes will not be exponentially amplified by PCR and hence will not generate a signal when analysed by capillary electrophoresis. In contrast, if the sample DNA is methylated, the hemimethylated probe-sample DNA hybrids are prevented from being digested by HhaI and the ligated probes will generate a signal. More information about MS-MLPA can be found in the MS-MLPA protocol. Please note that this product can not be used with an alternative protocol in which the genomic DNA is first digested with Hha1, followed by MLPA reactions on both digested and undigested genomic DNA. Digestion control probes Digestion control probes are unmethylated in most blood-derived DNA samples, meaning a complete probe signal should remain upon HhaI digestion. Besides the two digestion control probes at 346 and 463 nt, the sequence detected by the 184 nt UBE3A MS-MLPA probe is also unmethylated in most blood-derived DNA samples. A total absence of these three probes in the digested sample therefore indicates a complete digestion by HhaI. The 346 nt probe is the most sensitive to incomplete HhaI digestion; Hha1-digestion can be considered sufficient when less than 10% of the 346 nt digestion control probe signal remains in the digested reaction compared to the undigested reaction. Data analysis The ME028-B2 Prader Willi/Angelman probemix contains 48 MLPA probes with amplification products between 130 and 480 nt. In addition, it contains 9 control fragments generating an amplification product smaller than 120 nt: four DNA Quantity fragments (Q-fragments) at 64-70-76-82 nt, three DNA denaturation control fragments (D-fragments) at 88-92-96 nt, one X-fragment at 100 nt and one Y-fragment at 105 nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. SALSA MS- probemix ME028 Prader Willi / Angelman Page 2 of 12
Please note that the great majority of PWS and Angelman samples will show a deletion of 29-31 probes, AND/OR a methylation change of all five SNRPN and NDN MS-MLPA probes. Abnormal copy numbers or methylation changes detected by only one or two probes should be treated with caution. The analysis of MS-MLPA probemixes consists of two parts: 1) determining copy numbers by comparing different undigested samples (all MLPA probemixes), and 2) determining methylation patterns by comparing each undigested sample to its digested counterpart (MS-MLPA probemixes only). The second part is unique for MS-MLPA probemixes and serves to semi-quantify the percentage of methylation within a given sample. Intra-sample data normalisation (all samples) For analysis of MLPA results, not the absolute fluorescence values but intra-normalized data are used (relative peak areas). The data generated in the digested and undigested sample should first be normalized intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. This Normalization Constant can then be used for sample to reference sample comparison, both for copy number and digestion determination. Copy numbers determination (comparison between undigested samples) The final probe ratio, or ploidy status, of each probe in each sample is calculated by dividing a) the Normalization Constant of each probe obtained on the undigested patient sample by b) the average Normalization Constant of that probe obtained on the undigested reference samples. Methylation analysis (comparing digested and undigested samples) Methylation status of MS-MLPA probes* is calculated by dividing a) the Normalization Constant of each MS- MLPA probe obtained on the digested patient sample by b) the Normalization Constant of each MS-MLPA probe obtained on the corresponding undigested sample. Multiplying this value by 100 gives an estimation of the percentage methylation. Aberrant methylation can then be identified by comparing the methylation status of one or more MS-MLPA probes in the sample in question to that obtained on reference samples. *Note: An MS-MLPA probe targets a single specific HhaI site in a CpG island; if methylation is absent for a particular CpG-site, this does not necessarily mean that the whole CpG island is unmethylated! Aberrant methylation of the 15q11 locus In addition to the large de novo deletions of the 15q11 on the paternal or on the maternal chromosome, PWS or AS can be caused by aberrant methylation of the 15q11 locus. This can be caused either by uniparental disomy or by imprinting defects. Aberrant methylation of the 15q11 locus can be detected by use of the 5 methylation specific MLPA probes detecting sequences in the SNRPN gene and the NDN gene, when compared to results obtained on DNA samples from healthy individuals. However, with this probemix no discrimination between uniparental disomy and imprinting defects can be made. For this it is necessary to perform microsatellite analysis in the patient and parents. SNRPN locus The four probes targeting the SNRPN gene are located very close to each other and it is expected that all four probes provide similar results. We recommend using the average, or the median, methylation status of these SNRPN probes to determine to methylation status of the SNRPN locus and to disregard aberrant methylation detected by a single SNRPN MS-MLPA probe. NDN locus Please note that the 419 nt NDN probe has a tendency to overdigest and may seem to be only 30% methylated in DNA samples from healthy persons. We noticed that the percentage of methylation found using this and two alternative NDN probes that we tested varies between individuals. Methylation changes of the NDN probe only may not have any clinical significance. We have been informed that the NDN locus is significantly hypomethylated in chorionic villi (Karin Buiting & Jasmin Beygo, Essen, unpublished results). We therefore recommend interpreting the SNRPN locus methylation only in case of prenatal diagnosis. Data used for normalisation should have been obtained within a single experiment. Only samples purified by the same method should be compared. Confirmation of most exons deletions and amplifications can be done by e.g. Southern blots, long range PCR, FISH. SALSA MS- probemix ME028 Prader Willi / Angelman Page 3 of 12
Note that Coffalyser, the MLPA analysis tool developed at, can be downloaded free of charge from our website www.mlpa.com. This probemix was developed at in collaboration with several European laboratories, represented by K. Buiting (Essen) and S. Ramsden (Manchester). Info/remarks/suggestions for improvement: info@mlpa.com. SALSA MS- probemix ME028 Prader Willi / Angelman Page 4 of 12
Table 1. SALSA MS-MLPA ME028-B2 PWS/AS probemix Length (nt) SALSA MLPA probe Chromosomal region Hha1 Methylated Ref. UBE3A SNRPN Other 15q site in blood (%) 64-70-76-82 Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA 88-92-96 D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 100 X-fragment: Specific for the X chromosome 105 Y-fragment: Specific for the Y chromosome 130 Reference 03896-L00020 11q13 136 Reference 09824-L10234 10q26 142 SNRPN 04103-L02951 CpG island + 50% imprinted 148 Reference 08372-L08226 17q12 154 ٨ TUBGCP5 02018-L00865 BP1-BP2 region 160 UBE3A 04620-L00863 Exon 7 166 Reference 08020-L07801 11q24 172 MKRN3 02020-L12922 15q11.2 178 SNRPN 04106-L13905 CpG island + 50% imprinted 184 UBE3A 04641-L04293 Exon 1 + 0% 190 SNRPN 04104-L04294 CpG island + 50% imprinted 197 UBE3A 10880-L11550 Exon 6 202 APBA2 01314-L00867 15q13.1 208 Reference 07404-L07051 12q13 214 SNRPN 12719-L13907 SNORD116 snorna cluster 220 GABRB3 01315-L09339 15q12 226 ATP10A 11159-L11843 15q12 232 ~ Reference 08335-L08267 17q21 238 ٨ SNRPN 12178-L13090 exon u1b* 244 Reference 08051-L07832 5p15 250 SNRPN 11181-L13997 CpG island + 50% imprinted 256 SNRPN 02027-L12881 exon u5 (AS-SRO) 264 Reference 09533-L09943 7q22 270 SNRPN 12182-L13094 intron u2 278 SNRPN 12179-L13383 intron u2 287 ٨ SNRPN 11178-L11862 exon u1b 294 SNRPN 01318-L13088 SNURF-SNRPN exon 3 301 UBE3A 12082-L13474 Exon 8 309 Reference 01576-L01148 22q12 319 Reference 08018-L07799 11q24 328 + SNRPN 12723-L13798 SNORD116 snorna cluster + (100%) 337 Reference 01590-L01162 13q14 346 ๑ Digestion 01709-L12924 15q26 Digestion Control Probe. Signal <10% upon digestion. + 0% 355 UBE3A 02034-L12925 Exon 13 366 ± ATP10A 11162-L11846 15q12 373 UBE3A 10878-L11548 Exon 5 382 GABRB3 10874-L11544 15q12 391 SNRPN 12477-L13519 exon U5 (AS-SRO) 400 SNRPN 11177-L11861 SNURF-SNRPN exon 7 409 ~ MAGEL2 11155-L11839 15q11.2 419 ~ NDN 04027-L13937 15q11.2 + 30-50% impr 427 Reference 05330-L04717 1p21 434 ٨ NIPA1 06249-L05755 BP1-BP2 region 445 NDN 11149-L11833 15q11.2 454 Reference 08947-L09042 11p15 463 # ~ Digestion 02260-L01747 3p22 Digestion Control Probe. No signal upon digestion. + 0% 472 SNRPN 12721-L13796 SNORD116 snorna cluster 480 Reference 08586-L13087 17q23 ٨ BP1-BP2 region and u1b-u1b* region: copy number variation in these regions has been described in healthy individuals. NDN: (1) both NDN probes, especially 454 nt, are affected by denaturation problems. Check the 96 nt D-fragment: if this and one or both NDN probes are lower than the 92 nt fragment, denaturation was incomplete. (2) the 419 nt probe has a tendency to overdigest. The SNORD116 snorna gene cluster was previously named HBII-85. ± 366 nt: target site contains 2 SNPs which may affect probe signal. In case of a reduced probe signal, sequence the target region! ๑ 346 nt: Digestion control, warns for insufficient digestion. Hha1-digestion can be considered sufficient when <10% of the signal remains in the digested reaction compared to the undigested reaction. #463 nt: Digestion control, warns for insufficient digestion. Upon digestion, this probe should not give a signal. SALSA MS- probemix ME028 Prader Willi / Angelman Page 5 of 12
+ The target sequence of the 328 nt SNORD116 probe appears to be fully methylated in blood-derived DNA but hypomethylated in fetal DNA (K. Buiting & J. Beygo, pers. communication). We have received various reports of different methylation ratios for this probe also in blood-derived DNA and strongly recommend to use this probe only for copy number analysis, not for methylation analysis. ~ This probe is located within, or close to, a very strong CpG island. A low signal of this probe can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. Table 2. 15q probes arranged according to chromosomal location Length SALSA MLPA Hha1 Distance to Distance to Gene Chromosomal position (nt) probe site p-telomere next probe 434 ٨ 06249-L05755 NIPA1 BP1-BP2 region 214.0 kb 154 ٨ 02018-L00865 TUBGCP5 BP1-BP2 region End of copy number variable region 172 02020-L12922 MKRN3 21.362.818 exon 1 77.5 kb 409 ~ 11155-L11839 MAGEL2 21.440.355 exon 1 42.0 kb 445 11149-L11833 NDN 21.482.381 exon 1 1.0 kb 419 04027-L13937 NDN + 21.483.412 exon 1 1136.5 kb 287 ~ 11178-L11862 SNRPN 22.619.902 Exon u1b 6.2 kb 238 ~ 12178-L13090 SNRPN 22.626.072 Exon u1b* 64.9 kb 278 12179-L13383 SNRPN 22.690.980 Intron u2 12.3 kb 270 12182-L13094 SNRPN 22.703.328 Intron u2 13.4 kb 256 02027-L12881 SNRPN 22.716.713 Exon u5 (AS-SRO) 0.6 kb 391 12477-L13519 SNRPN 22.717.321 Exon u5 (AS-SRO) 33.8 kb 250 11181-L13997 SNRPN + 22.751.105 SNRPN CpG island 0.1 kb 178 04106-L13905 SNRPN + 22.751.213 SNRPN CpG island 0.3 kb 190 04104-L04294 SNRPN + 22.751.480 SNRPN CpG island 0.3 kb 142 04103-L02951 SNRPN + 22.751.772 SNRPN CpG island 12.5 kb 294 01318-L13088 SNRPN 22.764.247 SNURF-SNRPN exon 3 8.3 kb 400 11177-L11861 SNRPN 22.772.555 SNURF-SNRPN exon 7 75.7 kb 214 + 12719-L13907 SNRPN 22.848.250 SNORD116 snorna cluster 24.4 kb 472 + 12721-L13796 SNRPN 22.872.658 SNORD116 snorna cluster 16.0 kb 328 + 12723-L13798 SNRPN + 22.888.662 SNORD116 snorna cluster 247.7 kb 355 02034-L12925 UBE3A 23.136.395 exon 13 20.3 kb 301 12082-L13474 UBE3A 23.156.677 exon 8 11.1 kb 160 04620-L00863 UBE3A 23.167.740 exon 7 4.2 kb 197 10880-L11550 UBE3A 23.171.919 exon 6 29.8 kb 373 10878-L11548 UBE3A 23.201.674 exon 5 33.5 kb 184 04641-L04293 UBE3A + 23.235.184 exon 1 287.0 kb 366 11162-L11846 ATP10A 23.522.207 exon 5 137.7 kb 226 11159-L11843 ATP10A 23.659.906 exon 1 684.3 kb 220 01315-L09339 GABRB3 24.344.242 exon 12 19.6 kb 382 10874-L11544 GABRB3 24.363.881 exon 10 2832.9 kb 202 01314-L00867 APBA2 27.196.749 Exon 14; Outside common 61864.7 kb PWS-AS region to BLM probe 346 # 01709-L12924 BLM + 89.061.432 15q26 # Digestion control, warns for insufficient digestion. Hha1-digestion can be considered sufficient when <10% of the signal remains in the digested reaction compared to the undigested reaction. The 202 nt APBA2 probe is outside the common PWS/AS region. Size of the region showing aberrant copy number will differ between different PWS/AS patients. More 15q13 probes are available in SALSA MLPA probemix P297 Microdeletion- 2. ~ Copy number changes of the exon u1b/u1b* regions have been described in some healthy individuals: http://projects.tcag.ca/variation ٨ The copy numbers of the TUBGCP5 and NIPA1 genes show variation in some healthy individuals! According to Stefansson, H. et al (2008; Nature 455, 232-236), a deletion of this BP1-BP2 region is present in 0.19% of normal individuals and in 0.55% of schizophrenia patients. More probes for this BP1-BP2 region are in the P211 HSP probemix. The chromosomal order of these probes in the NCBI and BLAT databases is different. We used the order that is mentioned by Jiang et al. (2008) BMC Genomics 9:50. + The new name for the HBII-85 snorna gene cluster is SNORD116. Deletions within the SNORD116 cluster have been described as cause of Prader-Willi phenotype (Sahoo,T. et al (2008) Nature Genetics 40:719-721). Additional probes in this region are present in the P343 Autism probemix. Small deletions in this region might be a rare cause of PWS and will only be of interest when they are not present in parental samples. The target sequence of the 328 nt SNORD116 probe appears to be fully methylated in blood-derived DNA but hypomethylated in fetal DNA (K. Buiting & J. Beygo, pers. SALSA MS- probemix ME028 Prader Willi / Angelman Page 6 of 12
communication). We have received various reports of different methylation ratios for this probe also in blood-derived DNA and strongly recommend to use this 328 nt probe only for copy number analysis, not for methylation analysis. The AS-SRO is part of the PWS-AS Imprinting Centre (located upstream of the SNURF-SNRPN gene) and is required for a chromosome to have the maternal pattern of epigenetic modification and gene expression only if the chromosome has an intact PWS-SRO. The PWS-SRO is also part of the PWS-AS IC and is a 4.1kb region that includes the SNRPN promoter. The PWS-SRO is unconditionally required for a chromosome to have the paternal pattern of epigenetic modification and gene expression. Note: Exon numbering used here may differ from literature! Complete probe sequences are available on request: info@mlpa.com. Please notify us of any mistakes: info@mlpa.com. Table 3. Location of the SNRPN/UBE3A probes in Genbank Length SALSA Distance to Location in Genbank Distance to Gene (nt) MLPA probe p-telomere NG_002690.1 next probe 287 SNRPN 11178-L11862 22.619.902 42751-42804 Reverse 6.2 kb 238 SNRPN 12178-L13090 22.626.072 48921-48984 64.9 kb 278 SNRPN 12179-L13383 22.690.980 113829-113895 12.3 kb 270 SNRPN 12182-L13094 22.703.328 126177-126246 13.4 kb 256 SNRPN 02027-L12881 22.716.713 139562-139629 0.6 kb 391 SNRPN 12477-L13519 22.717.321 140172-140238 33.8 kb 250 SNRPN 11181-L13997 22.751.105 173953-174005 0.1 kb 178 SNRPN 04106-L13905 22.751.213 174062-174120 0.3 kb 190 SNRPN 04104-L04294 22.751.480 174329-174390 0.3 kb 142 SNRPN 04103-L02951 22.751.772 174621-174681 0.1 kb 328 SNRPN 11182-L11866 22.751.908 174757-174819 12.3 kb 294 SNRPN 01318-L13088 22.764.247 187096-187168 Reverse 8.3 kb 400 SNRPN 11177-L11861 22.772.555 195404-195458 75.7 kb 214 SNRPN (SNORD116) 12719-L13907 22.848.250 271138-271137 Reverse 24.4 kb 472 SNRPN (SNORD116) 12721-L13796 22.872.658 295538-295539 16.0 kb 328 SNRPN (SNORD116) 12723-L13798 22.888.662 311513-311576 247.7 kb 355 UBE3A 02034-L12925 23.136.395 559244-559317 Reverse 20.3 kb 301 UBE3A 12082-L13474 23.156.677 579526-579592 Reverse 11.1 kb 160 UBE3A 04620-L00863 23.167.740 590589-590662 Reverse 4.2 kb 197 UBE3A 10880-L11550 23.171.919 594768-594834 Reverse 29.8 kb 373 UBE3A 10878-L11548 23.201.674 624523-624589 Reverse 33.5 kb 184 UBE3A 04641-L04293 23.235.184 658033-658086 Reverse 287.0 kb Note More UBE3A and 15q13 probes are available in SALSA MLPA probemix P336 UBE3A and in SALSA MLPA probemix P343 Autism. Please contact us with suggestions or questions about this probemix: info@mlpa.com. SALSA MS- probemix ME028 Prader Willi / Angelman Page 7 of 12
Table 4. Sequences detected by the ME028-B2 probes Length (nt) Gene Sequences detected by the ME028-B2 probes, with HhaI site 130 CTTN GGCTTCCTTCAAGGCAGAGCTGA-GCTACAGAGGCCCTGTGAGTGGGACGGAGCCG 136 DPYSL4 TGGGCTCTGACGCTGACCTGGTCATA-TGGAACCCCAAGGCCACCAAGATCATCTCTGCCAA 142 SNRPN AGGGGGTGTTGAGCGCAGGT-AGGTGTATAATAGTGACCACTGCGTGGTGGAGCAGGGTAC 148 AATF TAGGTTTCATGTCCTTAGCAAGCTACTGAG-TTTCATGGCACCTATTGACCATACTACAATGAATGATGATGCC 154 TUBGCP5 GGACCAACACTTGTACAGCAGTGATCCATT-GTATGTTCCAGATGACAGGGTTTTGGTTACTGAGACTCAGGTT 160 UBE3A GAAGAAGACTCAGAAGCATCTTCCTCAAGG-ATAGGTGATAGCTCACAGGGAGACAACAATTTGCAAAAATTAG 166 CHEK1 GTCACAGGAGAGAAGGCAATATCCAATATT-TATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTT 172 MKRN3 CGACATGTGTGGGCTGCAGACCT-TGCACCCCATGGATGCTGCCCAGAGGGAAGAACATAT 178 SNRPN GCCGCTGCTGCAGCGAGTCTGGCGCAGAGT-GGAGCGGCCGCCGGAGATGCCTGACGCATCTGTCTGAG 184 UBE3A GAGATCCGTGTGTCTCCCAAGA-TGGTGGCGCTGGGCTCGGGGTGACTACAGGA 190 SNRPN CCGATGGTATCCTGTCCGCTCGCAT-TGGGGCGCGTCCCCCATCCGCCCCCAACTGTGGT 197 UBE3A GCATCTAATAGAACGCTACTACCACCAGTT-AACTGAGGGCTGTGGAAATGAAGCCTGCACGAATGAG 202 APBA2 CAAAGGGTGTGCCCTCACCACCCACTT-GATTTTTTTCATTTTGCCAAAAAGGGGTATGTCTTTATCAAAG 208 COL2A1 GGACCTTCTGTTCCTGTCTCTTCTGGAACA-TTCTTCTCTGAGCCTGAGACCTCTCTCCTGACAGGGT 214 SNRPN CCTGGTGACCAATGCTGCAGGGTA-GGCTGAAGAGGCTTTCACTGTTTGCCCCGACACC 220 GABRB3 AGGCGGCATTGGCGATACCAGGAA-TTCAGCAATATCCTTTGACAACTCAGGAATCCAGTACAGGAAA 226 ATP10A CATGGATCCTTTGGATTTTGATTCCAG-TTGATCCCTGGAGTAAGGTCCTAACCGGGGT 232 VAT1 GCTGATGCCATGAAACAGATGCAGGAGAA-GAAGAATGTGGGCAAGGTCCTCCTGGTTCCAG 238 SNRPN GTGGCCAGCTCACCACCACCTGA-TGAAAGATACACCACAGGGTGAGAGCATCCTAACAGCAAAC 244 DNAH5 GTTTCAAAGGAAAGTCAGTGCTGTGAAAAT-TGACCTGGAAAAAAGCTGTACCATGCCCTCCTGGCAG 250 SNRPN GAGGGAGCTGGGACCCCTGCA-CTGCGGCAAACAAGCACGCCTGCGCGGCCGC 256 SNRPN CCTTGGTTTGCGGCAGAAGAATCTGCA-TTTCGAACAAGTGCCAGGACTGGTCTGAGGAACACACGTT 264 CYP3A5 GAATTCCAGGGCCCACACCTCTGCCTTTG-TTGGGAAATGTTTTGTCCTATCGTCAGGTGAGTTGCTTGAGCTT 270 SNRPN CAGGGATTTGAGAAGAGGGGATTCAGA-TGACAGAGAACATCCCAAGGGAGAAGCAGAATCCAATATAGAG 278 SNRPN CACAGAGATCTGGGAGAGCTGACTTTGGTGAAA-ATTCTCACCTTGCACAGGCTTGTGTCTGTTTTCCAGAATC 287 SNRPN GACCTTGCCCCCGCAAACCA-CACAGAAGGCTCTGAGCTCAGCTACAGTGGCTGC 294 SNRPN CCTGGTTTTTGCTTGGAATCAGATTCCTCGCTA-CTCCAATATGGCTTTAACCACCTCTTGGTGTCTCAGCTAA 301 UBE3A GAAAATCCTGCAGACTTGAAGAAGCAGTTG-TATGTGGAATTTGAAGGAGAACAAGGAGTTGATGAGGGAGGT 309 NF2 GGCAGATCAGCTGAAGCAGGA-CCTGCAGGAAGCACGCGAGGCGGAGCGAAGAGCCAAGCAG 319 CHEK1 CACGACAAAATGGTCAGGTTTAGAATAGTTGT-TCGTGGTTGAAAGACTTGGATAAATGTGGATGAGATAGAA 328 SNRPN GGTGATGGATACTCCAGGTGGGAATGAGAA-AGCGCCATACATGTGTTGACTTGGTACCCTAAGA 337 DLEU1 AGGAGGTTGTTTGCTGTACTCTCCCTTGT-ACAGTTAGCTGTCTCTAGTGCCTGAATGCACTAATTGTCCTTT 346 BLM GCGGGGTCGCCGTACAGCGC-CGGGAGGGACGCGTATCTCCAAAGCCCAATCAGAGTC 355 UBE3A GGAGTTCTGGGAAATCGTTCATTCATTTAC-AGATGAACAGAAAAGACTCTTCTTGCAGTTTACAACGGGCACA 366 ATP10A GAGAGGCAGATGAACTGCGACGT-GCTCTGGTGTGTCCTGCTCCTTGTTTGCATGTCT 373 UBE3A CAGGAGAACCTCAGTCTGACGACATTG-AAGCTAGCCGAATGTAAGTGTAACTTGGTTGAGACTGTGG 382 GABRB3 CTGAGCTTTCGGTTGAAGAGGAACATTGGA-TACTTCATTCTTCAGACTTATATGCCCTCTATACTGATAACGA 391 SNRPN GAAGTGGCATATATCCAAGGACAGCCATAA-TATTCCACTTGGCCAAGGCTCTTCTGACAGGCTCATG 400 SNRPN GCGAAGCAACCAGAGCGTGAAGAA-AAGCGGGTTTTGGGTCTGGTGTTGCTGCGTG 409 MAGEL2 GCATTCCTGGAAACCAGCAAGATGCTT-GTCCTGAGGTTTTTGGCCAAGCTCCATAAGAAAGATCCAC 419 NDN CTTGCCAGACGGCGCAGACAT-GTCAGAACAAAGTAAGGATCTGAGCGACCCTAACTTTGCAGCC 427 DPYD CAATATGGAGCTTCCGTTTCTGCCAA-GCCTGAACTACCCCTCTTTTACACTCCTATTGATCTGGTGG 434 NIPA1 CAGTGGCTGTTGGCCAGATTGGAA-ACTTCCTGGCTTACACGGCGGTCCCCACGGTCCTGG 445 NDN GAAGGGTGGGGGTGGGTCATTAT-AGTATTCAGGATTTACAGTGCAGTATTCACGTGTAACTTT 454 SLC6A5 CTGGGGCCCATTCTTAGCTCA-ACACCGCGGGGAGCGTTACAAGAACATGATCGAC 463 MLH1 CTGCTGAGGTGATCTGGCGCAGA-GCGGAGGAGGTGCTTGGCGCTTCTCAGGCTCCTCCTCT 472 SNRPN TCACCTGCATGCTTCACATCCAGGCCAG-AGTGCCTCTGTTGTACCCTCTGTGTTATGAAGACATA 480 BRIP1 CAACACCTGAGCTCGGGTCATCAGAGAATA-GTGCCTCTAGTCCTCCCCGTTTCAAAACAGAGAAGATGGAAA The Hha1 sites are marked in grey. Please notify us on any mistakes: info@mlpa.com. SALSA MS- probemix ME028 Prader Willi / Angelman Page 8 of 12
SALSA MLPA probemix ME028-B2 Prader Willi/Angelman sample pictures * Figure 1. Capillary electrophoresis pattern from a sample of 50 ng human male DNA analysed with SALSA MLPA probemix ME028-B2 Prader Willi/Angelman (lot B2-0811) for copy number quantification. Arrows indicate the location of the two digestion control probes (open arrows) and the five probes detecting the imprinted 15q11 sequences (closed arrows). * The 184 nt probe is unmethylated in most blood-derived DNA samples. The old MLPA buffer (replaced in December 2012) was used. Vials with the old MLPA buffer have a white label. * Figure 2. Capillary electrophoresis pattern from a sample of 50 ng human male DNA analysed with SALSA MLPA probemix ME028-B2 Prader Willi / Angelman (lot B2-0811) and digested with Hha1 enzyme to determine the methylation status. Arrows indicate the location of the two digestion control probes (open arrows) and the five probes that detect the imprinted 15q11 sequences (closed arrows). * The 184 nt probe is unmethylated in most blood-derived DNA samples. The old MLPA buffer (replaced in December 2012) was used. Vials with the old MLPA buffer have a white label. SALSA MS- probemix ME028 Prader Willi / Angelman Page 9 of 12
* Figure 3. Capillary electrophoresis pattern from a sample of 50 ng human male DNA analysed with SALSA MLPA probemix ME028-B2 Prader Willi / Angelman (lot B2-0811) for the quantification of copy numbers. Arrows indicate the location of the two digestion control probes (open arrows) and the five probes detecting the imprinted 15q11 sequences (closed arrows). * the 184 nt is unmethylated in most blood-derived DNA samples. The new MLPA buffer (introduced in December 2012) was used. Vials with the new MLPA buffer have a yellow label. * Figure 4. Capillary electrophoresis pattern from a sample of 50 ng human male DNA analysed with SALSA MLPA probemix ME028-B2 Prader Willi / Angelman (lot B2-0811) and digested with Hha1 enzyme to determine methylation status. Arrows indicate the location of the two digestion control probes (open arrows) and the five probes detecting the imprinted 15q11 sequences (closed arrows). * The 184 nt probe indicated is unmethylated in most blood-derived DNA samples. The new MLPA buffer (introduced in December 2012) was used. Vials with the new MLPA buffer have a yellow label. SALSA MS- probemix ME028 Prader Willi / Angelman Page 10 of 12
Figure 3. Copy number and methylation changes in 15q11 detected by MS-MLPA in Prader-Willi and Angelman syndrome patients. Partial peak patterns (8 out of 48 probes shown) of the ME028 probemix (older version) used on one reference and various patient samples. Top: detection of copy number changes (ligation only). Bottom: detection of methylation changes (ligation & digestion with HhaI restriction-endonuclease). R: reference probe on other chromosomes not affected by HhaI digestion (probes 3, 4, 6). Probe 1: detects SNRPN gene, no HhaI site; 2: detects UBE3A gene, no HhaI site; 5: detects SNRPN gene, contains HhaI site; 7: detects 15q26, contains HhaI site, sequence completely unmethylated in normal blood-derived DNA; 8: detects UBE3A gene, no HhaI site. Arrow: probes showing aberrations as compared to the reference sample. The SNRPN and UBE3A genes are located in the 15q11 PWS/AS region. Probe 5 and 7 are MS-MLPA probes containing a HhaI site: when the target sequence is unmethylated and HhaI digestion is performed (bottom row), they are digested: no probe signal. Probe 5 detects methylation changes of a sequence in the 15q11 region; this sequence is imprinted and a normal reference thus has one copy remaining upon digestion. Many Angelman syndrome patients have only unmethylated copies (no probe signal in digested reactions). Many PWS patients have only methylated copies (similar signals in digested and undigested reactions). Probe 7 is a digestion control detecting a 15q26 sequence that is unmethylated in blood-derived DNA (no signal in digested reactions); this probe is present to check for complete endonuclease digestion. SALSA MS- probemix ME028 Prader Willi / Angelman Page 11 of 12
Implemented Changes compared to the previous product description version(s). Version 48 (07) - Warning added in Table 1, 232 nt probe 08335-L08267, 409 nt probe 11155-L11839, 419 nt probe 04027-L13937, and 463 nt probe 02260-L01747. Version 47 (05) - Information added about the digestion control probes on page 2 and table 1 and 2. - Information added to the figures about the 184 nt probe. Version 46 (05) - Electropherogram pictures using the new MLPA buffer (introduced in December 2012) added. Version 45 (05) - p2: Remark on the availability of reference DNA samples - p2: Remark on partial digestion of the 346 nt DNA digestion control probe as an indication for incomplete HhaI digestion. Version 44 (05) - Added on page 6: More probes are available in SALSA MLPA probemix P343 Autism. Version 43 (05) - Warning on the 328 nt probe below tables 1 and 2 updated. This probe should only be used for copy number analysis. Version 42 (05) - Product description adapted to a new product version (version number changed, lot number added, small changes in Table 1 and Table 2, new picture included). - Warning about variability updated under table 1 for NDN probes at 419 nt (04027-L13937) and 445 nt (11149-L11833). Version 41 (05) - Interpretation of methylation specific MLPA probes with regard to distinguishing uniparental disomy from imprinting defects has been changed. - Reference of Ramsden et al added. - Warning about SNPs added under table 1 for ATP10A probe at 366 nt. - Warning about variability added under table 1 for NDN probe at 455 nt. - Various minor textual and layout changes. Version 40 (05) - Remark added under table 2 about the role of the AS-SRO in AS. - Name of the HBII-85 snorna gene cluster adapted to the new nomenclature (SNORD116). - Small changes of probe lengths in Table 1, 2 and 3 in order to better reflect the true lengths of the amplification products. Version 39 (04) - Remark added in tables 1 and 2 that exon u5 is part of the AS-SRO. Version 38 (04) - This product description has been changed to incorporate a new lot (lot number added, small changes in Table 1 and Table 2, new picture included). Various minor textual changes on page 1, data analysis has been modified, tables have been numbered and standard symbols have been added under Table 1. SALSA MS- probemix ME028 Prader Willi / Angelman Page 12 of 12