Supplemental Information

Supplemental Information LKB1 inhibits lung cancer progression through lysyl oxidase and extracellular matrix remodeling Yijun Gao, Qian Xiao, HuiMin Ma, Li Li, Jun Liu, Yan Feng, Zhaoyuan Fang, Jing Wu, Xiangkun Han, Junhua Zhang, Yihua Sun, Gongwei Wu, Robert Padera, Haiquan Chen, Kwok-kin Wong, Gaoxiang Ge, and Hongbin Ji Supplemental Materials and Methods Antibodies and reagents The following antibodies were used: LKB1 (Upstate); S6 ribosomal protein, phospho-s6 ribosomal protein, Src, Src py416, E-Cadherin, Cleaved Caspase-3 (all from Cell Signaling); HIF-1, -catenin, FAK, FAK py397 (all from BD Transduction Laboratories); -Actin and LOX (Sigma-Aldrich); Ki-67 (Novocastra Laboratories Ltd); Biotinylated goat anti-rabbit secondary antibody (ZYMED company); Alexa Fluor 555 or 488 conjugated anti-mouse, rat or rabbit IgG secondary antibodies (Invitrogen); HRP-conjugated rabbit and mouse secondary antibodies (Santa Cruz); Tubulin and 1 integrin antibody were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by the University of Iowa, Department of Biology, Iowa City, IA 52242. 1 integrin antibody was purified from

supernatant of the hybridoma culture. LOX inhibitor BAPN and mtor inhibitor rapamycin were purchased from Sigma-Aldrich and LC laboratories, respectively. Plasmids pbabe-puro-flag-hlkb1 was described previously (1). pgl3 HRE-Luc and mutant HRE-Luc reporter constructs were generously provided by Dr. Celeste Simon (University of Pennsylvania). pbabe-puro-hif-1 wt and pbabe-puro-hif-1 -PA were kindly provided by Dr. William Kaelin (Dana-Farber Cancer Institute, Harvard University). Human LOX promoter (1019 bp) was amplified from human genomic DNA and cloned into pgl3-basic (Promega). The human LOX sequences were amplified from A549 cdna using primers: 5 - GATCGAATTCATGCGCGGCGG-3 (forward) and 5 -GATCGTCGACCTACTTGTCATCGTCATCCTTGTAGTCAGATCTATACGG TGAAATTGTGCAGCCT-3 (reverse). Amplicon was inserted into pbabe-neo. The shrnas towards human LOX were cloned into plko.1 (Addgene). The target sequences are: shlox-1: 5 -GUGCAGAAGAUGUCCAUGU-3 shlox-2: 5 -GGUUCCUGAAUCUGACUAU-3 The shrnas towards human LKB1 was from Sigma-Aldrich. The target sequences are: shlkb1-1: 5 -GCCAACGUGAAGAAGGAAAUU-3 shlkb1-2: 5 -GAUCCUCAAGAAGAAGAAGUU-3

Cell culture, proliferation and anchorage-independent cell growth The human NSCLC cell lines A549, CRL-5807, CRL-5844, CRL-5800 and HTB-182 (ATCC) were maintained in RPMI1640 (Hyclone) supplemented with 10% FBS (Biochrom). 293T cells (ATCC) were cultured in DMEM (Hyclone) with 10% FBS. Viral infection of cells was as previously described (2). For cell proliferation assay, cells were cultured in 60 mm dishes and total cell numbers in each of four independent dishes were counted at indicated time points. Anchorage-independent cell growth was assessed using soft agar assay as described before (1). RT-PCR and real-time PCR Total RNA was prepared as previously described (1) and retrotranscribed into first-strand cdna using RevertAid First Strand cdna Synthesis Kit (Fermentas). The cdnas were then used for either regular PCR or real-time PCR on a 7500 Fast Real-Time PCR System (Applied Biosystems) using SYBR-Green Master PCR mix (Toyobo). GAPDH served as internal control. Primers used were: Human LOX: 5 -CATCATGCGTATGCCTCAG-3 (forward) and 5 -TTCCCACTTCAGAACACCAG-3 (reverse); Mouse Lox: 5 -GGTTACTTCCAGTACGGTCTCC-3 (forward) and 5 -GCAGCGCATCTCAGGTTGT-3 (reverse) Human LKB1: 5 -CTCTGACCTGCTGAAAGGGATG-3 (forward) and 5 -TGTCTGGGCTCGGTGGGATG-3 (reverse);

Human GAPDH: 5 -AGGTGAAGGTCGGAGTCAAC-3 (forward) and 5 -AGTTGAGGTCAATGAAGGGG-3 (reverse). Mouse Gapdh: 5 -TGCCCCCATGTTTGTGATG-3 (forward) and 5 -TGTGGTCATGAGCCCTTCC (reverse). Immunoblotting Immunoblotting was performed as previously described (1). Wound healing assay Wound healing assay was performed as described (3). Wound closure was analyzed with AxioVision LE Rel 4.5 (4). Three-Dimensional cell culture and immunofluorescence Cells were cultured in matrigel (BD Transduction Laboratories) as previously described (5) for 10-14 days at 37 in a humidified incubator. For 3D culture with different stiffness, rat tail type I collagen (Upstate) was added to matrigel at 0, 0.8, 1.6, 2.4 mg/ml final concentration. For antibody co-incubation, 1 integrin blocking antibody (20 g/ml) was added to medium of the cells grown in matrigel with or without type I collagen (1.6 mg/ml). For immunofluorescence, 3D cultures were fixed with 2% PFA in phosphate-buffered saline (PBS) supplemented with 50 mm glycine at room temperature for 30 min, and washed three times for 20 min with PBS containing glycine. Cells were then blocked with 10% goat serum in immunofluorescence (IF) buffer (PBS, 0.1% bovine serum albumin, 0.2% Triton X-100, 0.05% Tween-20) at room temperature for 1 hour, and incubated with primary antibodies with 10% goat serum overnight at 4. Cells were washed three times for

20 min with IF buffer, and incubated with Alexa Fluor 555 or 488 conjugated secondary antibodies with 10% goat serum at room temperature for 40 min. Nuclei were counterstained with DAPI. After washing with IF buffer, cells were mounted in Immu-Mount (Thermo Electron Corporation). Cells were visualized using a laser scanning confocal microscope (Leica TCS ST5-MT). Mouse treatment Kras G12D, Lkb1 L/L and P53 L/L mice were originally generously provided by Dr. T. Jacks and Dr. R. Depinho, respectively. Lung cancer mice models with Kras; Kras, Lkb1 L/L ; Kras, P53 L/L mice were generated as described before (1). All mice were housed in a specific pathogen-free environment at the Shanghai Institute of Biochemistry and Cell Biology and treated in strict accordance with protocols approved by the Institutional Animal Care and Use Committee of the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. For de novo lung cancer mice model, mice were treated with 2x10 6 plague-forming unites of adeno-cre at 6~8 weeks of age as previously described (6). Four weeks later, Kras, Lkb1 L/L mice were randomly divided into two groups (8 each) for intraperitoneal injection with either saline or BAPN (100 mg/kg) daily as described for another 8 weeks (7). As for BAPN treatment in Kras lung cancer mice model, 3 mice each group were used after 8 weeks of adeno-cre treatment. All mice were sacrificed for gross inspection and histopathological examination. Histopathological analysis and immunological studies

Histopahtological analysis and immunological studies were performed as described before (1, 4, 8). Briefly, mice were sacrificed and lung tissues were inflated and fixed in 10% formalin, embedded in paraffin and sectioned for hematoxylin and eosin (HE) staining. Tumor number and size were measured in five continuous slides with 100 M interval in each mouse from 7~8 mice. Staining with picro-sirius red (Direct Red 80, Sigma-Aldrich) were used to assess collagen deposition in lung tumors (9). LOX enzymatic activity assay Serum from mice, human lung cancer patients and phenol red-free conditioned media (CM) from confluent cells were collected for LOX enzymatic activity assessment. Samples were prepared in a final volume of 1 ml containing 1.2 M urea (Amresco), 0.05 M sodium borate (Sigma, ph 8.2), 0.1 units/ml of horseradish peroxidase (Fluka), 50 M Amplex Red (Invitrogen) and 10 mm 1,5-diaminopentane (Sigma-Aldrich) and were incubated at 37 C for 1 hour (10). Fluorescence was measured using a Hitachi F-2000 fluorescence spectrophotometer with excitation and emission wavelengths at 560 nm and 590 nm, respectively. Parallel assays were prepared with 500 M BAPN to completely inhibit the activity of LOX. The LOX activities were calculated as the increase in fluorescent units above the BAPN controls. Human serum sample analysis The study was approved by the local ethic committees in Shanghai Cancer Hospital, Fudan University and sera were collected with the written consent from patients from July 2007 to March 2009. Blood samples were collected in procoagulant tube and

allowed to clot at room temperature within 2 hours. Coagulated blood was spun at 4,000 rpm for 5 min, and the serum samples were immediately aliquoted and frozen for storage at 80 C until thawed for LOX enzymatic activity assay. All the patients involved in this study were initially diagnosed with lung cancer without other types of cancers and had not received any chemotherapy or radiotherapy before. Clinical data including gender, smoking status, past medical history, medications, stage at diagnosis and pathology were collected for each patient. All statistical analyses were carried out using the SPSS 11.5 statistical software package. Student's t-test and one-way ANOVA statistical analysis were used for patient demographic and clinical data. P < 0.05 in all cases was considered statistically significant.

Figure S1. No significant increase of LOX gene expression in mouse lung tumors with P53 deficiency. Real-time PCR quantification of Lox mrna levels in mouse Kras lung tumors with wild-type p53 (n=3) and with p53 deficiency (n=3). Data were presented as means ± SEM. Statistical analyses were performed using Student s t test.

Figure S2. Detection of LOX expression in a panel of human NSCLC cell lines. Western blot was performed to detect LOX protein level in 17 human NSCLC cell lines with known LKB1 mutation status.

Figure S3. HIF-1 mediates LOX transcription downstream of LKB1. (A-D) Re-introduction of HIF-1 rescued the inhibition of LOX promoter activity (A,C) and protein levels (B,D) by ectopic LKB1 expression in CRL-5800 (A-B) and CRL-5807 (C-D). CRL-5807 cells expressing LKB1 and/or HIF1 constructs were treated with 200 m CoCl 2 for 12 hours. Data were presented as means ± SEM. Statistical analyses were performed using Student s t test. * p < 0.05,** p < 0.01.

Figure S4. LKB1 knockdown increases LOX gene transcription. (A-B) Knockdown of LKB1 in HTB-182 lung cancer cells increased LOX expression (A) and enzymatic activities (B). Data were presented as means ± SEM. Statistical analysis were performed using Student s t test. * p < 0.05, *** p < 0.001.

Figure S5. HIF-1 mediates LOX transcription downstream of LKB1. (A) Ectopic LKB1 expression inhibited LOX promoter activity in A549 cells. (B) Ectopic LKB1 expression inhibited the gene transcription under promoter with wild-type hypoxia-responsive element (HRE) in A549 cells. (C and D) Expression of either HIF-1 or PA mutant, a stable form of HIF-1 up-regulated LOX promoter activity (C) and LOX mrna levels (D) in A549 cells. (E and F) Re-introduction of HIF-1 rescued the inhibition of LOX mrna (E) and LOX enzymatic activity (F) by ectopic LKB1 expression in A549 cells. (G and H) Knockdown of HIF-1 decreased the LOX promoter activity (G) and LOX mrna levels (H). A549 cells expressing HIF-1 shrna were treated with 200 m CoCl 2 for 12 hours. Data were presented as

means ± SEM. Statistical analyses were performed using Student s t test. * p < 0.05, ** p < 0.01, *** p < 0.001. Figure S6. LKB1 negatively regulates LOX transcription through mtor-hif-1 signaling axis. (A-B) mtor inhibitor rapamycin treatment significantly decreased LOX promoter activity (A) and LOX mrna level (B) in A549 cells. (C) mtor inhibition by rapamycin down-regulated LOX and HIF-1 protein level. (D) mtor inhibition significantly decreased the transcription activity on promoter with wild-type HRE in A549 cells. (E) Ectopic expression of HIF-1 rescued the down-regulation of LOX enzymatic activity by rapamycin treatment in A549 cells. Data were presented as means ± SEM. Statistical analyses were performed using Student s t test. * p < 0.05, ** p < 0.01, *** p < 0.001.

Figure S7. LOX is not involved in regulation of A549 cell proliferation in two-dimensional cell culture. LOX over-expression in A549 cells (A-C) or CRL-5807 cells (D-E) or LOX shrna knockdown in A549 (F-H) or CRL-5844 cells (I-J) had no effect on cell proliferation in two-dimensional cell culture. Anti-Flag is used for detection of Flag-LKB1 overexpression. Enzymatic activity inhibition by BAPN had no effect on A549 cell proliferation (K). Neither could LOX rescue the inhibition of cell growth by LKB1 in A549 (C) or CRL-5807 (E) cells. Data were presented as means ± SEM. Statistical analyses were performed using Student s t test. *** p < 0.001.

Figure S8. LOX mediates lung cancer cell anchorage-independent growth and migration. (A-B) Ectopic expression of LOX in CRL-5807 cells rescued the inhibitory effect of LKB1 on anchorage-independent cell growth (A) and cell migration (B). (C-D) Knockdown of LOX in CRL-5844 cells significantly impaired anchorage-independent cell growth (C) and cell migration (D). Data are presented as mean ± SEM. Statistical analyses were performed using Student s t test. ** p < 0.01, *** p < 0.001.

Figure S9. LOX confers to Lkb1 deficient tumor progression. (A) Detection of LOX serum activity from Kras, Lkb1 L/L mice treated with BAPN or saline (8 mice each group). (B) Ki-67 immunostaining on lung sections from Kras, Lkb1 L/L mice after 4-week treatment of LOX inhibitor BAPN or saline (left panels) and cleaved Caspase-3 immunostaining on lung sections from Kras, Lkb1 L/L mice treated with either BAPN or saline for 1-week (right panels). Scale bars: 50 m. (C) Histological inspection of lung tumors from intravenous injection of A549 cells with or without LOX knockdown. Scale bar: 200 m (upper panels), 50 m (bottom panels). (D) Quantification of tumor volume in H&E stained lung sections. Data were presented as means ± SEM. Statistical analysis were performed using Student s t test. * p < 0.05, *** p < 0.001.

Figure S10. LOX inhibition does not significantly affect the progression of mouse lung tumors with wildtype Lkb1. (A) BAPN treatment had no effect on the size of Kras murine lung tumors. Scale bars: 500 m (left panels), 100 m (right panels). (B) Quantification of tumor number and volume in H&E stained lung sections from Kras mice treated with BAPN or saline (3 mice each group). Data were presented as means ± SEM. Statistical analyses were performed using Student s t test.

Figure S11. Excess collagen deposition increases lung cancer progression through activation of 1 integrin signaling. (A) Sirius red staining of collagen (right panels) showed evident collagen rich fibrotic loci in lung tumors from Kras, Lkb1 L/L mice but not in those from Kras mice. H&E staining was shown in left panels. Scale bars: 100 m. (B) Diminished collagen rich fibrotic loci in Lkb1-deficient lung tumors after BAPN treatment shown by sirius red staining (right panels). H&E staining was shown in left panels. Scale bars: 100 m. (C) Altered cell morphology of A549 cells grown in matrigel with type I collagen as 3 dimensional spheres. Scale bars: 200 m.

References: 1. Ji H, et al. (2007) LKB1 modulates lung cancer differentiation and metastasis. Nature 448: 807-810. 2. Naldini L, Blomer U, Gage FH, Trono D, Verma IM (1996) Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc Natl Acad Sci U S A 93: 11382-11388. 3. Rodriguez LG, Wu X, Guan JL (2005) Wound-healing assay. Methods Mol Biol 294: 23-29. 4. Ji H, et al. (2006) The impact of human EGFR kinase domain mutations on lung tumorigenesis and in vivo sensitivity to EGFR-targeted therapies. Cancer Cell 9: 485-495. 5. Debnath J, Muthuswamy SK, Brugge JS (2003) Morphogenesis and oncogenesis of MCF-10A mammary epithelial acini grown in three-dimensional basement membrane cultures. Methods 30: 256-268. 6. Jackson EL, et al. (2001) Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras. Genes Dev 15: 3243-3248. 7. Gilad GM, Gilad VH (2001) b-aminopropionitrile treatment can accelerate recovery of mice after spinal cord injury. Eur J Pharmacol 430: 69-72. 8. Ge G, Greenspan DS (2006) BMP1 controls TGFb1 activation via cleavage of latent TGFb-binding protein. J Cell Biol 175: 111-120. 9. Junqueira LC, Bignolas G, Brentani RR (1979) Picrosirius staining plus polarization microscopy, a specific method for collagen detection in tissue sections. Histochem J 11: 447-455. 10. Palamakumbura AH, Trackman PC (2002) A fluorometric assay for detection of lysyl oxidase enzyme activity in biological samples. Anal Biochem 300: 245-251.