Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature
|
|
- Beverley Harrington
- 6 years ago
- Views:
Transcription
1 Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida, Wenling Li, Thomas D. Arnold, Yoshiaki Kubota, Seiji Yamamoto, Masatsugu Ema, and Yoh-suke Mukouyama
2 SUPPLEMENTAL Text & FIGURES Figure S1: Related to Figure 1 Figure S2: Related to Figure 2 Figure S3: Related to Figure 3 Figure S4: Related to Figure 4 Figure S5: Related to Figure 5 Figure S6: Related to Figure 7 Figure S7: Related to Figure 7 Table S1 SUPPLEMENTAL EXPERIMENTAL PROCEDURES 1
3 Figure S1 (related to Figure 1) Pericytes express PDGFR in developing skin vasculature (A-D) Whole-mount triple immunofluorescence confocal microscopy of rostral back skin from E15.5 wild-type embryos was performed with antibodies to PDGFR (green), SMA (red) and PECAM-1 (blue). Close-up images (B and D) show the dotted boxed region in A and C. Scale bars are 50 m. 2
4 3
5 Figure S2 (related to Figure 2). NG2 expression is restricted to pericytes in the skin vasculature (A-B) Whole-mount triple immunofluorescence confocal microscopy of back skin was performed with antibodies to NG2 (A, red) or Tuj1 (B, red), together with anti-eyfp (green) and PECAM-1 (blue). EYFP expression was found in Tuj1 + peripheral nerves, but not in NG2 + pericytes. (C-D) Whole-mount triple labeling with antibodies to NG2 (C, red) or a migrating Schwann cell marker, brain-type fatty acid binding protein (BFABP) (D, red), together with Tuj1 (green) and PECAM-1 (blue) shows that NG2 + cells were not detectable in peripheral nerves. Scale bar is 50 m. 4
6 5
7 Figure S3 (related to Figure 3). Unexpected insufficiency of Cre or CreER activities in myeloid progenitors in Csf1r-iCre;R26R, Csf1r-MER-iCre- MER;R26R, and LysM-Cre;R26R skin Whole-mount triple immunofluorescence confocal microscopy was performed with antibodies to -gal (A-F, red), NG2 (A, C, and E, green,) F4/80 (B, D, and F, green), and PECAM-1 (A-F, blue) in E15.5 Csf1r-iCre;R26R (A and B), Csf1r- MER-iCre-MER;R26R (C and D), LysM-Cre;R26R (E and F) skin. No significant expression of -gal (open arrowheads) was detectable in NG2 + pericytes (A, C, and E). A few -gal + F4/80 + cells (arrowheads) were detectable in Csf1riCre;R26R (B) and Csf1r-MER-iCre-MER;R26R (D) skin, while a subset of F4/80 + cells (~35%) are positive for -gal in LysM-Cre;R26R skin (F). Scale bars are 50 m. Quantification of -gal + /NG2 + pericytes and -gal + /F4/80 + myeloid cells is shown in G and H, respectively. Error bars indicate mean ± SEM. 6
8 7
9 Figure S4 (related to Figure 4). Differentiation capacity of FACS-isolated myeloid and non-myeloid cells in culture (A-C) Triple immunofluorescence confocal microscopy of the cultured CD45 + F4/80 + CD11b + PDGFR - cells and CD45 + F4/80 + CD11b - PDGFR - cells was performed with antibodies to NG2 (red), F4/80 (green), and TO-PRO-3 (blue). CD11b + myeloid progenitors have the more potential to differentiate into pericytes than CD11b - myeloid progenitors. (D-G) Double labeling of the 1-day or 5-day cultured CD45 + F4/80 + PDGFR - cells with antibodies to F4/80 (green) or PDGFR (green), together with TO-PRO-3 (blue) reveals that F4/80 but no PDGFR expression was detectable in the 1-day culture. In the 5-day culture, F4/80 expression was decreased and PDGFR expression was increased with a fibroblastic morphology. (H) Triple labeling of the 5-day cultured CD45 + F4/80 + PDGFR - cells with antibodies to NG2 (red), CD45 (green), and TO-PRO-3 (blue) reveals a striking reduction of CD45 expression in NG2 + pericytes. (I) Comparison of FACS-isolated CD45 + F4/80 + PDGFR - myeloid cells and CD45 + F4/80 - PDGFR - non-myeloid cells was examined in the 5-day culture. Non-myeloid cells have less capacity to differentiate into pericytes. (J and K) FACS-isolated CD45 + F4/80 + PDGFR - cells from skin, lung, intestine, and heart was examined in the 5-day culture. Few myeloid cells from lung and intestine can differentiate into pericytes when 1,000 cells (J) or 50,000 cells (K) were plated. One representative quantification from three independent experiments is shown in C and I. Scale bars are 50 m. 8
10 9
11 Figure S5 (related to Figure 5). Defective pericyte development in Csf1 op/op mutants Whole-mount immunofluorescence confocal microscopy was performed with antibodies to F4/80 (A and B, green), NG2 (D, E, G, and H, green) or SMA (D, E, G, and H, red), together with anti-pecam-1 (A and B, red; D, E, G, and H, blue) in E15.5 Csf1 op/+ and Csf1 op/op skin. Quantification of F4/80 + cells (C), and NG2 + and PDGFR + pericyte coverage in small-diameter vessels (F and J) and large-diameter vessels (I and K) is shown (n=3). Scale bars are 50 m. Error bars indicate mean ± SEM. **, p<0.01, Student s t-test. 10
12 11
13 Figure S6 (related to Figure 7). TGF- promotes pericyte differentiation from myeloid cell progenitors in culture (A-L) FACS-isolated CD45 + F4/80 + PDGFR - cells were cultured for 5 days with or without 3 ng/ml TGF- 1 in a 0.2% FBS-containing medium supplemented with 100 ng/ml M-CSF. Triple immunofluorescence confocal microscopy was performed with antibodies to PDGFR (A and B, red) or Desmin (D and E, red), together with anti-f4/80 (A, B, D, and E, green) and TO-PRO-3 (A, B, D, and E, blue). Triple labeling was also performed with antibodies to a proliferation marker Ki67 (G and H, green) or an apoptosis marker cleaved caspase 3 (J and K, green), together with anti-ng2 (G, H, J, and K, red) and F4/80 (G, H, J, and K, blue). One representative quantification from three independent experiments are shown in C, F, I, and L. Scale bars are 50 m. (M-P) qrt-pcr analysis of pericyte marker and myeloid marker expression in the cultured CD45 + F4/80 + PDGFR - cells (M-CSF versus TGF- + M-CSF) reveals that the TGF- treatment induces pericyte marker expression and reduces myeloid marker expression. Error bars represent mean ± SEM; *, p<0.05, **, p<0.01, Student s t-test. 12
14 13
15 Figure S7 (related to Figure 7). Analysis of vascular and cardiac development in Vav-iCre;Tgfbr2 f/f mutants and TGF- ligand expression in the skin (A-H) Double immunofluorescence confocal microscopy was performed with antibodies to SMA (red) and PECAM-1 (green) in Vav-iCre;Tgfbr2 flox/flox and control littermate skin (A and B) and hearts (E-H). Close-up images (G and H) show the dotted boxed regions in E and F. The Quantification of PECAM-1 + vascular area and SMA + vsmc coverage in the skin vasculature is shown in C and D, respectively. No significant alteration of vascular network formation, vsmc coverage, and of cardiac morphology was observed in the mutants. Scale bars are 50 m. (I) qrt-pcr analysis of TGF- ligand expression in FACS-isolated CD45 - PECAM-1 + dermal endothelial cells, CD45 - F4/80 - PDGFR + dermal pericytes, and CD45 + F4/80 + PDGFR - dermal myeloid cells. TGF-β1 expression is detectable in both dermal endothelial cells and myeloid cells in the embryonic skin, while TGFβ3 is preferentially expressed by dermal pericytes. 14
16 Table S1. Gene-specific oligonucleotide primers for qrt-pcr Gene Sense (5' to 3') Antisense (5' to 3') NG2 AAGCACGATGTCCAGGTGTT GACCAGGGTACAGCAACAGT PDGFR AGCTCACGGTCTGAGCCATT GCTCGGACATTAAGGCTTGCT Desmin GATGAGGCAGATGAGGGAGC CTGTGTAGCCTCGCTGACAA SMA AGCGTGAGATTGTCCGTGACAT GCGTTCGTTTCCAATGGTGA CD45 ATGGTCCTCTGAATAAAGCCCA TCAGCACTATTGGTAGGCTCC F4/80 CTTTGGCTATGGGCTTCCAGTC GCAAGGAGGACAGAGTTTATCGTG CD11b ATGGACGCTGATGGCAATACC TCCCCATTCACGTCTCCCA CD13 AGATTGCCCTGCCTGACTTC ACAGTCACCAGGTTGCCAAA CD169 AGTGATAGCAACCGCTGGTTA GCACAGGTAGGGTGTGGAAC CD206 TTGGACGGATAGATGGAGGG CCAGGCAGTTGAGGAGGTTC TGF- 1 AAGTGGATCCACGAGCCCAA GCTGCACTTGCAGGAGCGCAC TGF- 2 GTTGGGAACGCGTTGCATTT GCGCATAAACTGATCCATGT TGF- 3 GTGCGCGAGTGGCTGTTGAGGA GA GTGTCTGCGCTGCGGAGGTATGG -actin GGACATCCGCAAAGACCTGTA GCTCAGGAGGAGCAATGATCT GAPDH TGCAGTGGCAAAGTGGAGATT TGCCGTTGAATTTGCCGT 15
17 SUPPLEMENTAL EXPERIMENTAL PROCEDURES Whole-mount embryonic skin immunohistochemistry Embryonic skin was dissected and fixed in 4% PFA/PBS at 4 C overnight. The following primary antibodies were used: rabbit anti-pdgfr (kindly gifted from W.B. Stallcup, 1:300) and guinea pig anti-ng2 (kindly gifted from W.B. Stallcup, 1:300) to detect pericytes; Cy3-conjugated anti- SMA (clone 1A4, Sigma, 1:500) to detect vsmcs; Armenian hamster anti-pecam-1 (Chemicon, 1:300) and rat anti-pecam-1 (BD Pharmingen, MEC13.3, 1:300) to detect endothelial cells; rabbit anti- -gal (Cappel, 1:3000) to detect -gal; and rabbit anti-gfp (Thermo Fisher Scientific A11122, 1:300) to detect EYFP; mouse monoclonal anti-neuron specific class III -tubulin antibody (Covance, Tuj1, 1:500) to detect peripheral axons; rabbit anti-bfabp (T. Müller, 1:200) to detect Schwann cells; rat anti- F4/80 (AbDSerotec, MCA497,1:50) to detect macrophages; rabbit RFP (Abcam, 1:200) to detect TdTomato. For immunofluorescence detection, either Alexa-488-, Alexa-568-, Alexa-594-, Cy3-, Alexa-647-, or Dylight 649-conjugated secondary antibodies (Life Technologies 1:250 or Jackson, 1:300, 1 hr. at room temperature) were used. All confocal microscopy was carried out on a Leica TCS SP5 confocal (Leica). Section immunohistochemistry Embryos were fixed in 4% PFA/PBS at 4 C overnight, washed with PBS, and transferred into a 30% sucrose/pbs solution prior to embedding in OCT 16
18 compound (Tissue Tech). Samples were then sectioned into 14 µm sections using a CM1900 cryostat (Leica). Staining was performed using primary antibodies as described above. For immunofluorescence t detection, either Alexa-488-, Alexa-568-, Alexa-594-, Cy3-, Alexa-647-, or Dylight 649-conjugated secondary antibodies (Life Technologies 1:250 or Jackson, 1:300, 1 hr. at room temperature) were used. All confocal microscopy was carried out on a Leica TCS SP5 confocal (Leica). Cell culture FACS-Isolated tissue macrophage progenitors were plated into 96 well plates or cloning rings (6 x 8 mm, Fisher) on 3.5 cm culture plates. Both culture systems were incubated for 5 days in a gas-tight incubator chamber (Billups-Rothenberg), which was flushed daily with a gas mixture of 93% N 2 /6% O 2 /1% CO 2 in order to approximate physiological oxygen levels. Cells were cultured in EBM-2 medium (Lonza) containing FBS (Hyclone Laboratories), Gentamicin-1000, ascorbic acid, IGF, and hydrocortizone taken from EGM-2 SingleQuots kit (Lonza), supplemented with TGF R1 inhibitor, LY (in dimethyl sulfoxide (DMSO), Sigma-Aldrich), TGF- 1 (PeproTech) and/or M-CSF (kindly gifted from S. Suzu). Cloning rings were removed one day after plating Cells were fixed in 4% PFA/PBS for 10 minutes at room temperature. Immunohistochemistry was performed as described above using the following antibodies: rabbit anti-ng2 (Chemicon, 1:200), rabbit anti-pdgfr (kindly gifted from W.B. Stallcup, 1:300), and rabbit anti-desmin (Abcam, 1:200) to detect pericytes; rat anti-f4/80 17
19 (AbDSerotec, MCA497, 1:50) to detect macrophages; rat anti-cd45 (Millipre, 1:100) as a pan-hematopoietic marker; rabbit anti-cleaved caspase 3 (Cell Signaling 1:200) to detect apoptotic cells; rabbit anti-ki67 (Vector 1:1000) to detect proliferating cells. TO-PRO-3 iodide (Life Technologies) was used to detect nuclei. All immunofluorescence confocal microscopy was carried out on a Leica TCS SP5 confocal (Leica) and immunofluorescence microscopy was carried out on Leica DMI4000B (Leica). Statistic significance of samples was assessed using a 2-tailed Student s t-test. 18
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationSupplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationErzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,
Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,
More informationFang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationJCB. Supplemental material. Gu et al.,
Supplemental material Gu et al., http://www.jcb.org/cgi/content/full/jcb.201010075/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. S1P directly induces actin assembly. Actin assembly at the
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationHuarui Zheng, Lou Chang, Neha Patel, Jiong Yang, Lori Lowe, Dennis K. Burns, and Yuan Zhu
Cancer Cell, Volume 13 Supplemental Data Induction of Abnormal Proliferation by Nonmyelinating Schwann Cells Triggers Neurofibroma Formation Huarui Zheng, Lou Chang, Neha Patel, Jiong Yang, Lori Lowe,
More informationSupplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationPretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair
Pretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair Mouse Model of Myocardial Infarction (MI) All animal work was compliant with the Institutional Animal
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationSupplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationSupplemental Information. Autophagy in Oncogenic K-Ras. Promotes Basal Extrusion. of Epithelial Cells by Degrading S1P. Current Biology, Volume 24
Current Biology, Volume 24 Supplemental Information Autophagy in Oncogenic K-Ras Promotes Basal Extrusion of Epithelial Cells by Degrading S1P Gloria Slattum, Yapeng Gu, Roger Sabbadini, and Jody Rosenblatt
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationSupplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
More informationSupplemental Experimental Procedures
Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,
More informationEvaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationSupporting Information
Supporting Information Lu et al. 10.1073/pnas.1719109115 SI Materials and Methods Mice. For tamoxifen-induced recombination, mice were given tamoxifenpreparedincornoil(20mg/ml;sigma)at5mgper25gof body
More informationSupplementary Figure 1
Supplementary Figure 1 Kif1a RNAi effect on basal progenitor differentiation Related to Figure 2. Representative confocal images of the VZ and SVZ of rat cortices transfected at E16 with scrambled or Kif1a
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationNature Neuroscience: doi: /nn.2275
Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationDevelopment Supplementary information
Supplemental Materials and Methods Mosaic clonal analysis GSC and SP clones were induced with the FLP/FRT-mediated mitotic recombination technique (Xu and Rubin, 1993) in files with following genotypes:
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationSerafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
More informationSupplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
More informationGenesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1. Youngsoo Lee, Sachin Katyal, Yang Li, Sherif F. El-Khamisy, Helen R. Russell, Keith W. Caldecott and Peter J. McKinnon.
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
More informationFigure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from
Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from germ cell mutants (dnrar flox/flox, Stra8-Cre +, RARElacZ) (A ), controls (dnrar flox/flox, RARElacZ) (B ),
More informationEndogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation
SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 2 3 4 SUPPLEMENTARY TABLES Supplementary Table S1. Brain Tumors used in the study Code Tumor Classification Age Gender HuTuP51 Glioblastoma 57 Male HuTuP52 Glioblastoma 53 Male
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationFig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.
T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationSupplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
More informationSupplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of
SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
More informationBCR-ABL - LSK BCR-ABL + LKS - (%)
Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationSupplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/3/e1400244/dc1 Supplementary Materials for PlGF-induced VEGFR1-dependent vascular remodeling determines opposing antitumor effects and drug resistance to
More informationSupplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
More informationEndocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
More informationImpact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice
Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Shinichi Hosokawa 1,3,Kenichiro Furuyama 1,3, Masashi Horiguchi 1,3,Yoshiki
More informationDownregulation of angiotensin type 1 receptor and nuclear factor-κb. by sirtuin 1 contributes to renoprotection in unilateral ureteral
Supplementary Information Downregulation of angiotensin type 1 receptor and nuclear factor-κb by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction Shao-Yu Yang 1,2, Shuei-Liong
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing
More informationModeling lymphangiogenesis in a three-dimensional culture system
Modeling lymphangiogenesis in a three-dimensional culture system Françoise Bruyère, Laurence Melen-Lamalle, Silvia Blacher, Guy Roland, Marc Thiry, Lieve Moons, Francis Frankenne, Peter Carmeliet, Kari
More informationSupplemental Information. Fluorescence-based visualization of autophagic activity predicts mouse embryo
Supplemental Information Fluorescence-based visualization of autophagic activity predicts mouse embryo viability Satoshi Tsukamoto*, Taichi Hara, Atsushi Yamamoto, Seiji Kito, Naojiro Minami, Toshiro Kubota,
More informationSupplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols used to differentiate mouse ESCs. (b) Representative
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Iliopsoas and quadratus lumborum motor neurons in the L2 spinal segment.
Supplementary Figure 1 Iliopsoas and quadratus lumborum motor neurons in the L2 spinal segment. (A) IL and QL motor neurons were labeled after CTb-488 (green) muscle injections at birth. At P4, the L2
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationSupplemental Data. Wnt/β-Catenin Signaling in Mesenchymal Progenitors. Controls Osteoblast and Chondrocyte
Supplemental Data Wnt/β-Catenin Signaling in Mesenchymal Progenitors Controls Osteoblast and Chondrocyte Differentiation during Vertebrate Skeletogenesis Timothy F. Day, Xizhi Guo, Lisa Garrett-Beal, and
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationFig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationmm Distance (mm)
b a Magnet Illumination Coverslips MPs Objective 2575 µm 1875 µm 1575 µm 1075 µm 875 µm 545 µm 20µm 2 3 0.5 0.3mm 1 1000 100 10 1 0.1 1000 100 10 1 0.1 Field Induction (Gauss) 1.5 0 5 10 15 20 Distance
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationA549 and A549-fLuc cells were maintained in high glucose Dulbecco modified
Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationSHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
More informationSupporting Information
Supporting Information Fig. S1. Overexpression of Rpr causes progenitor cell death. (A) TUNEL assay of control intestines. No progenitor cell death could be observed, except that some ECs are undergoing
More informationSupporting Information
Supporting Information Sasportas et al. 10.1073/pnas.0806647106 SI Methods Lentiviral Transduction. MSC and glioma cells were transduced with LVs at varying multiplicity of infection (moi) by incubating
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationTGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
More informationNLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
More informationa) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
More informationTumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected
More information*Corresponding author:
LIPID DROPLETS HYPERTROPHY: A CRUCIAL DETERMINING FACTOR IN INSULIN REGULATION BY ADIPOCYTES 1 Bahram Sanjabi #, 2,3 Monireh Dashty #, 4 Behiye. Özcan, 5 Vishtaseb Akbarkhanzadeh, 3 Mehran Rahimi, 7,8
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationThe subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
More informationSupplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and
Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)
More informationTitle: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More informationReferences. Plasma renin activity (PRA) PRA was measured by a radioimmunoassay kit (Wallac, Tokyo, Japan).
Detailed Methods Experiment I enos / mice were purchased from Jackson Laboratory (Bar Harbor, USA). C57BL/6J mice on the same genetic background were purchased from KBT Oriental (Hamamatsu, Japan). Eleven-week-old
More information