Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature

Transcription

1 Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida, Wenling Li, Thomas D. Arnold, Yoshiaki Kubota, Seiji Yamamoto, Masatsugu Ema, and Yoh-suke Mukouyama

2 SUPPLEMENTAL Text & FIGURES Figure S1: Related to Figure 1 Figure S2: Related to Figure 2 Figure S3: Related to Figure 3 Figure S4: Related to Figure 4 Figure S5: Related to Figure 5 Figure S6: Related to Figure 7 Figure S7: Related to Figure 7 Table S1 SUPPLEMENTAL EXPERIMENTAL PROCEDURES 1

3 Figure S1 (related to Figure 1) Pericytes express PDGFR in developing skin vasculature (A-D) Whole-mount triple immunofluorescence confocal microscopy of rostral back skin from E15.5 wild-type embryos was performed with antibodies to PDGFR (green), SMA (red) and PECAM-1 (blue). Close-up images (B and D) show the dotted boxed region in A and C. Scale bars are 50 m. 2

4 3

5 Figure S2 (related to Figure 2). NG2 expression is restricted to pericytes in the skin vasculature (A-B) Whole-mount triple immunofluorescence confocal microscopy of back skin was performed with antibodies to NG2 (A, red) or Tuj1 (B, red), together with anti-eyfp (green) and PECAM-1 (blue). EYFP expression was found in Tuj1 + peripheral nerves, but not in NG2 + pericytes. (C-D) Whole-mount triple labeling with antibodies to NG2 (C, red) or a migrating Schwann cell marker, brain-type fatty acid binding protein (BFABP) (D, red), together with Tuj1 (green) and PECAM-1 (blue) shows that NG2 + cells were not detectable in peripheral nerves. Scale bar is 50 m. 4

6 5

7 Figure S3 (related to Figure 3). Unexpected insufficiency of Cre or CreER activities in myeloid progenitors in Csf1r-iCre;R26R, Csf1r-MER-iCre- MER;R26R, and LysM-Cre;R26R skin Whole-mount triple immunofluorescence confocal microscopy was performed with antibodies to -gal (A-F, red), NG2 (A, C, and E, green,) F4/80 (B, D, and F, green), and PECAM-1 (A-F, blue) in E15.5 Csf1r-iCre;R26R (A and B), Csf1r- MER-iCre-MER;R26R (C and D), LysM-Cre;R26R (E and F) skin. No significant expression of -gal (open arrowheads) was detectable in NG2 + pericytes (A, C, and E). A few -gal + F4/80 + cells (arrowheads) were detectable in Csf1riCre;R26R (B) and Csf1r-MER-iCre-MER;R26R (D) skin, while a subset of F4/80 + cells (~35%) are positive for -gal in LysM-Cre;R26R skin (F). Scale bars are 50 m. Quantification of -gal + /NG2 + pericytes and -gal + /F4/80 + myeloid cells is shown in G and H, respectively. Error bars indicate mean ± SEM. 6

8 7

9 Figure S4 (related to Figure 4). Differentiation capacity of FACS-isolated myeloid and non-myeloid cells in culture (A-C) Triple immunofluorescence confocal microscopy of the cultured CD45 + F4/80 + CD11b + PDGFR - cells and CD45 + F4/80 + CD11b - PDGFR - cells was performed with antibodies to NG2 (red), F4/80 (green), and TO-PRO-3 (blue). CD11b + myeloid progenitors have the more potential to differentiate into pericytes than CD11b - myeloid progenitors. (D-G) Double labeling of the 1-day or 5-day cultured CD45 + F4/80 + PDGFR - cells with antibodies to F4/80 (green) or PDGFR (green), together with TO-PRO-3 (blue) reveals that F4/80 but no PDGFR expression was detectable in the 1-day culture. In the 5-day culture, F4/80 expression was decreased and PDGFR expression was increased with a fibroblastic morphology. (H) Triple labeling of the 5-day cultured CD45 + F4/80 + PDGFR - cells with antibodies to NG2 (red), CD45 (green), and TO-PRO-3 (blue) reveals a striking reduction of CD45 expression in NG2 + pericytes. (I) Comparison of FACS-isolated CD45 + F4/80 + PDGFR - myeloid cells and CD45 + F4/80 - PDGFR - non-myeloid cells was examined in the 5-day culture. Non-myeloid cells have less capacity to differentiate into pericytes. (J and K) FACS-isolated CD45 + F4/80 + PDGFR - cells from skin, lung, intestine, and heart was examined in the 5-day culture. Few myeloid cells from lung and intestine can differentiate into pericytes when 1,000 cells (J) or 50,000 cells (K) were plated. One representative quantification from three independent experiments is shown in C and I. Scale bars are 50 m. 8

10 9

11 Figure S5 (related to Figure 5). Defective pericyte development in Csf1 op/op mutants Whole-mount immunofluorescence confocal microscopy was performed with antibodies to F4/80 (A and B, green), NG2 (D, E, G, and H, green) or SMA (D, E, G, and H, red), together with anti-pecam-1 (A and B, red; D, E, G, and H, blue) in E15.5 Csf1 op/+ and Csf1 op/op skin. Quantification of F4/80 + cells (C), and NG2 + and PDGFR + pericyte coverage in small-diameter vessels (F and J) and large-diameter vessels (I and K) is shown (n=3). Scale bars are 50 m. Error bars indicate mean ± SEM. **, p<0.01, Student s t-test. 10

12 11

13 Figure S6 (related to Figure 7). TGF- promotes pericyte differentiation from myeloid cell progenitors in culture (A-L) FACS-isolated CD45 + F4/80 + PDGFR - cells were cultured for 5 days with or without 3 ng/ml TGF- 1 in a 0.2% FBS-containing medium supplemented with 100 ng/ml M-CSF. Triple immunofluorescence confocal microscopy was performed with antibodies to PDGFR (A and B, red) or Desmin (D and E, red), together with anti-f4/80 (A, B, D, and E, green) and TO-PRO-3 (A, B, D, and E, blue). Triple labeling was also performed with antibodies to a proliferation marker Ki67 (G and H, green) or an apoptosis marker cleaved caspase 3 (J and K, green), together with anti-ng2 (G, H, J, and K, red) and F4/80 (G, H, J, and K, blue). One representative quantification from three independent experiments are shown in C, F, I, and L. Scale bars are 50 m. (M-P) qrt-pcr analysis of pericyte marker and myeloid marker expression in the cultured CD45 + F4/80 + PDGFR - cells (M-CSF versus TGF- + M-CSF) reveals that the TGF- treatment induces pericyte marker expression and reduces myeloid marker expression. Error bars represent mean ± SEM; *, p<0.05, **, p<0.01, Student s t-test. 12

14 13

15 Figure S7 (related to Figure 7). Analysis of vascular and cardiac development in Vav-iCre;Tgfbr2 f/f mutants and TGF- ligand expression in the skin (A-H) Double immunofluorescence confocal microscopy was performed with antibodies to SMA (red) and PECAM-1 (green) in Vav-iCre;Tgfbr2 flox/flox and control littermate skin (A and B) and hearts (E-H). Close-up images (G and H) show the dotted boxed regions in E and F. The Quantification of PECAM-1 + vascular area and SMA + vsmc coverage in the skin vasculature is shown in C and D, respectively. No significant alteration of vascular network formation, vsmc coverage, and of cardiac morphology was observed in the mutants. Scale bars are 50 m. (I) qrt-pcr analysis of TGF- ligand expression in FACS-isolated CD45 - PECAM-1 + dermal endothelial cells, CD45 - F4/80 - PDGFR + dermal pericytes, and CD45 + F4/80 + PDGFR - dermal myeloid cells. TGF-β1 expression is detectable in both dermal endothelial cells and myeloid cells in the embryonic skin, while TGFβ3 is preferentially expressed by dermal pericytes. 14

16 Table S1. Gene-specific oligonucleotide primers for qrt-pcr Gene Sense (5' to 3') Antisense (5' to 3') NG2 AAGCACGATGTCCAGGTGTT GACCAGGGTACAGCAACAGT PDGFR AGCTCACGGTCTGAGCCATT GCTCGGACATTAAGGCTTGCT Desmin GATGAGGCAGATGAGGGAGC CTGTGTAGCCTCGCTGACAA SMA AGCGTGAGATTGTCCGTGACAT GCGTTCGTTTCCAATGGTGA CD45 ATGGTCCTCTGAATAAAGCCCA TCAGCACTATTGGTAGGCTCC F4/80 CTTTGGCTATGGGCTTCCAGTC GCAAGGAGGACAGAGTTTATCGTG CD11b ATGGACGCTGATGGCAATACC TCCCCATTCACGTCTCCCA CD13 AGATTGCCCTGCCTGACTTC ACAGTCACCAGGTTGCCAAA CD169 AGTGATAGCAACCGCTGGTTA GCACAGGTAGGGTGTGGAAC CD206 TTGGACGGATAGATGGAGGG CCAGGCAGTTGAGGAGGTTC TGF- 1 AAGTGGATCCACGAGCCCAA GCTGCACTTGCAGGAGCGCAC TGF- 2 GTTGGGAACGCGTTGCATTT GCGCATAAACTGATCCATGT TGF- 3 GTGCGCGAGTGGCTGTTGAGGA GA GTGTCTGCGCTGCGGAGGTATGG -actin GGACATCCGCAAAGACCTGTA GCTCAGGAGGAGCAATGATCT GAPDH TGCAGTGGCAAAGTGGAGATT TGCCGTTGAATTTGCCGT 15

17 SUPPLEMENTAL EXPERIMENTAL PROCEDURES Whole-mount embryonic skin immunohistochemistry Embryonic skin was dissected and fixed in 4% PFA/PBS at 4 C overnight. The following primary antibodies were used: rabbit anti-pdgfr (kindly gifted from W.B. Stallcup, 1:300) and guinea pig anti-ng2 (kindly gifted from W.B. Stallcup, 1:300) to detect pericytes; Cy3-conjugated anti- SMA (clone 1A4, Sigma, 1:500) to detect vsmcs; Armenian hamster anti-pecam-1 (Chemicon, 1:300) and rat anti-pecam-1 (BD Pharmingen, MEC13.3, 1:300) to detect endothelial cells; rabbit anti- -gal (Cappel, 1:3000) to detect -gal; and rabbit anti-gfp (Thermo Fisher Scientific A11122, 1:300) to detect EYFP; mouse monoclonal anti-neuron specific class III -tubulin antibody (Covance, Tuj1, 1:500) to detect peripheral axons; rabbit anti-bfabp (T. Müller, 1:200) to detect Schwann cells; rat anti- F4/80 (AbDSerotec, MCA497,1:50) to detect macrophages; rabbit RFP (Abcam, 1:200) to detect TdTomato. For immunofluorescence detection, either Alexa-488-, Alexa-568-, Alexa-594-, Cy3-, Alexa-647-, or Dylight 649-conjugated secondary antibodies (Life Technologies 1:250 or Jackson, 1:300, 1 hr. at room temperature) were used. All confocal microscopy was carried out on a Leica TCS SP5 confocal (Leica). Section immunohistochemistry Embryos were fixed in 4% PFA/PBS at 4 C overnight, washed with PBS, and transferred into a 30% sucrose/pbs solution prior to embedding in OCT 16

18 compound (Tissue Tech). Samples were then sectioned into 14 µm sections using a CM1900 cryostat (Leica). Staining was performed using primary antibodies as described above. For immunofluorescence t detection, either Alexa-488-, Alexa-568-, Alexa-594-, Cy3-, Alexa-647-, or Dylight 649-conjugated secondary antibodies (Life Technologies 1:250 or Jackson, 1:300, 1 hr. at room temperature) were used. All confocal microscopy was carried out on a Leica TCS SP5 confocal (Leica). Cell culture FACS-Isolated tissue macrophage progenitors were plated into 96 well plates or cloning rings (6 x 8 mm, Fisher) on 3.5 cm culture plates. Both culture systems were incubated for 5 days in a gas-tight incubator chamber (Billups-Rothenberg), which was flushed daily with a gas mixture of 93% N 2 /6% O 2 /1% CO 2 in order to approximate physiological oxygen levels. Cells were cultured in EBM-2 medium (Lonza) containing FBS (Hyclone Laboratories), Gentamicin-1000, ascorbic acid, IGF, and hydrocortizone taken from EGM-2 SingleQuots kit (Lonza), supplemented with TGF R1 inhibitor, LY (in dimethyl sulfoxide (DMSO), Sigma-Aldrich), TGF- 1 (PeproTech) and/or M-CSF (kindly gifted from S. Suzu). Cloning rings were removed one day after plating Cells were fixed in 4% PFA/PBS for 10 minutes at room temperature. Immunohistochemistry was performed as described above using the following antibodies: rabbit anti-ng2 (Chemicon, 1:200), rabbit anti-pdgfr (kindly gifted from W.B. Stallcup, 1:300), and rabbit anti-desmin (Abcam, 1:200) to detect pericytes; rat anti-f4/80 17

19 (AbDSerotec, MCA497, 1:50) to detect macrophages; rat anti-cd45 (Millipre, 1:100) as a pan-hematopoietic marker; rabbit anti-cleaved caspase 3 (Cell Signaling 1:200) to detect apoptotic cells; rabbit anti-ki67 (Vector 1:1000) to detect proliferating cells. TO-PRO-3 iodide (Life Technologies) was used to detect nuclei. All immunofluorescence confocal microscopy was carried out on a Leica TCS SP5 confocal (Leica) and immunofluorescence microscopy was carried out on Leica DMI4000B (Leica). Statistic significance of samples was assessed using a 2-tailed Student s t-test. 18