APPL1 binds to adiponectin receptors and mediates adiponectin signalling and function

LETTERS binds to adiponectin receptors and mediates adiponectin signalling and function Xuming Mao, Chintan K. Kikani 2, Ramon A. Riojas 2, Paul Langlais 2, Lixin Wang, Fresnida J. Ramos, Qichen Fang,5, Christine Y. Christ-Roberts, Jenny Y. Hong 3, Ryang-Yeo Kim, Feng Liu,2,4 and Lily Q. Dong,3,4,6, also known as Acrp3, is an adipose tissuederived hormone with anti-atherogenic, anti-diabetic and insulin sensitizing properties 3. Two seven-transmembrane domain-containing proteins, AdipoR and AdipoR2, have recently been identified as adiponectin receptors 4, yet signalling events downstream of these receptors remain poorly defined. By using the cytoplasmic domain of AdipoR as bait, we screened a yeast two-hybrid cdna library derived from human fetal brain. This screening led to the identification of a phosphotyrosine binding domain and a pleckstrin homology domain-containing adaptor protein, (adaptor protein containing pleckstrin homology domain, phosphotyrosine binding (PTB) domain and leucine zipper motif). interacts with adiponectin receptors in mammalian cells and the interaction is stimulated by adiponectin. Overexpression of increases, and suppression of level reduces, adiponectin signalling and adiponectin-mediated downstream events (such as lipid oxidation, glucose uptake and the membrane translocation of glucose transport 4 (GLUT4)). stimulates the interaction between and Rab5 (a small GTPase) interaction, leading to increased GLUT4 membrane translocation. also acts as a critical regulator of the crosstalk between adiponectin signalling and insulin signalling pathways. These results demonstrate a key function for in adiponectin signalling and provide a molecular mechanism for the insulin sensitizing function of adiponectin. is an adipose tissue-derived hormone that has important functions in the regulation of lipid and glucose metabolism 3. In mice, targeted deletion of the adiponectin gene leads to insulin resistance 5,6. In addition, administration by continuous systemic infusion of adiponectin significantly increased insulin sensitivity in type 2 diabetic mice 7. In humans, a reduced serum concentration of adiponectin has been shown to correlate with obesity 8, insulin resistance 7,9 and type 2 diabetes 9. Collectively, these findings suggest that adiponectin has an essential function in regulating whole-body energy homeostasis and indicate that this adipose hormone is a strong candidate for the development of drugs to treat insulin resistance and type 2 diabetes. The signalling mechanisms responsible for the action of adiponectin remain largely unknown. Two adiponectin receptors, AdipoR and AdipoR2, have recently been identified 4. These receptors contain seven transmembrane domains and are structurally and functionally distinct from G-protein-coupled receptors (GPCR). Unlike GPCRs, the amino (N)-termini of AdipoR and AdipoR2 are intracellular 4 (see Supplementary Information, Fig. Sa). In agreement with this result, it was found that adiponectin interacts with the carboxyl (C)- terminus of AdipoR when the yeast two-hybrid system was used to identify adiponectin interacting proteins (see Supplementary Information, Fig. Sb). To identify proteins that interact with the adiponectin receptor, a yeast two-hybrid cdna library derived from human fetal brain 2 was screened using the intracellular portion of mouse AdipoR (amino acids 4 42) as bait. Sequence analysis revealed that 7 of the 7 positive clones contained a cdna encoding the C-terminus of an adaptor protein previously named APPL 3 or DIP3α 4 (deleted in colorectal cancer (DCC)-interacting protein; Fig. a). A putative APPL-related protein was identified in the GeneBank database (accession number BC4896 (mouse) and NM_87 (human)) that shares a 54% identity in protein sequence to APPL, suggesting the presence of an isoform of this protein (APPL2). Western blot analysis revealed that is highly expressed in differentiated C2C2 myotubes, INS insulinoma cells and L6 cells (Fig. b). Moderate expression of was detected in HEK293, mouse hepatocytes and non-differentiated C2C2 myoblasts (Fig. b and data not shown). expression was also observed in mouse brain, skeletal muscle, fat, heart, spleen and to a lesser extent, pancreas and kidney tissues (Fig. c). The findings that is highly expressed in both differentiated C2C2 myotubes and mouse skeletal muscle suggest a potential role for this adaptor protein in regulating the insulin-sensitizing effect of adiponectin in skeletal muscle. In agreement with this, AdipoR was highly expressed in this insulin-sensitive tissue (Fig. c). Departments of Pharmacology, 2 Biochemistry, 3 Cellular and Structural Biology, and 4 the Barshop Center for Longevity and Aging Studies, University of Texas Health Science Center, San Antonio, TX 78229 39, USA. 5 Permanent address: Shanghai Diabetes Institute, Shanghai Jiaotong University Affiliated Sixth Hospital, Shanghai 2233, People s Republic of China. 6 Correspondence should be addressed to L.Q.D. (e-mail: dongq@uthscsa.edu) Received 8 November 25; accepted 7 March 26; published online 6 April 26; corrected after print June 26; DOI:.38/ncb44 56 NATURE CELL BIOLOGY VOLUME 8 NUMBER 5 MAY 26

LETTERS a 79 Prey (455 79) BAR PH PTB PTB Prey (455 79) # (455 63) b M r (K) HEK HEP C2C2 HeLa INS L6 # (455 63) #2 (455 52) PTB #2 (455 52) 79 - #3 ( 52) #4 ( 47) BAR BAR PH PH #5 ( 269) #3 ( 52) 55 - β-tubulin #5 ( 269) BAR #4 ( 47) c M r (K) 79-38 - 55 - B L M F H K S P AdipoR β-tubulin d M r (K) 38-38 - Pull down: M r (K) AdipoR (bound) AdipoR (input) 54-26 - + + GST GST c GST c GST e M r (K) 38-79 - Lysates + + IP: Nlg Anti- AdipoR AdipoR.2.8.6.4.2 + Ratio of intensity Figure Identification of as an AdipoR interacting protein. (a) cdnas encoding different regions of human were amplified by PCR and subcloned into the yeast two-hybrid plasmid pb42ad. The interaction between fragments and AdipoR amino terminus (NT) in EGY48 (p8op lacz) yeast cells was examined by β-galactosidase filter assays. A positive interaction (blue colour) was visualized within 3 min. No interaction was detected for 24 h. BAR, Bin amphiphysin Rvs domain; PH, pleckstrin homology domain; PTB, phospho-tyrosine binding domain. (b) expression in mammalian cells. Lysates from HEK293 (HEK), mouse hepatocytes (HEP), differentiated C2C2 myotubes (C2C2), HeLa, INS and L6 cells were separated by SDS PAGE and examined by western blot using an anti- antibody. Equal loading of protein in cell lysates was determined by western blot using an anti-β-tubulin antibody. (c) expression in mouse tissues. Proteins from mouse brain (B), liver (L), skeletal muscle (M), fat (F), heart (H), kidney (K), spleen (S) and pancreas (P) tissue homogenates were resolved by SDS PAGE and immunoblotted with antibodies specific for and AdipoR. Equal loading of protein in tissue homogenates was determined by western blot using an anti-β-tubulin antibody. (d) Pull-down of endogenous AdipoR with GST. C2C2 myotubes were serum-starved and treated with (+) or without ( ) full-length adiponectin (2 µg ml ) for 5 min. The bound endogenous AdipoR and AdipoR expression control (input) were detected with anti-adipor antibodies. The GST fusion proteins were visualized by Coomassie blue staining. (e) Coimmunoprecipitation of endogenous AdipoR with endogenous. C2C2 myotubes were serum-starved and treated with or without full-length adiponectin (2 µg ml ) for min. Immunoprecipitated and coimmunoprecipitated AdipoR were detected with the antibodies to the proteins. Error bars represent mean ± s. e.m. from three independent experiments. Single asterisk indicates P <.5; double asterisk indicates P <. To test whether and AdipoR interact directly, a GST C-terminus (amino acids 455 693; c) fusion protein was generated. Endogenous AdipoR interacted with GST c but not with the GST control protein (Fig. d), demonstrating that can directly interact with AdipoR in vitro. Coimmunoprecipitation experiments revealed that endogenous AdipoR interacted specifically with in C2C2 myocytes (Fig. e). In addition, treatment of C2C2 myocytes with adiponectin led to a significant increase in the interaction between endogenous AdipoR and (Fig. e). Interestingly, was also found to interact with AdipoR2 in a yeast two-hybrid library screen that used the N-terminus of AdipoR2 (amino acids 4 36) as bait (data not shown). Coimmunoprecipitation studies revealed that interacted with AdipoR2 in cells overexpressing these proteins (see Supplementary Information, Fig. S2a). The findings that interacts with both AdipoR and AdipoR2 suggest that a common mechanism may be used by both AdipoR and AdipoR2 to transduce adiponectin-stimulated signalling to downstream targets. To map the region in responsible for interacting with AdipoR, a series of yeast two-hybrid prey plasmids encoding different regions of were generated (Fig. a). interacted with AdipoR only when its PTB domain was intact (Fig. a), suggesting that the PTB domain of is critical for its interaction with AdipoR. To test whether the PTB domain is essential for to interact with AdipoR in intact cells, AdipoR was coexpressed with either full length or with the PTB-domain deleted ( PTB ). Consistent with the finding from the yeast two-hybrid study (Fig. a), coimmunoprecipitation NATURE CELL BIOLOGY VOLUME 8 NUMBER 5 MAY 26 57

LETTERS M r (K) 2 3 4 5 6 38 - P-p38 MAPK 38 - p38 MAPK 79 - + + + Mock PTB b c M r (K) 2 3 4 38 - P-p38 MAPK M r (K) 2 3 4 38 - p38 MAPK 28 - P-ACC P-AMPK 28 - + + ACC AMPK Scrambled + + sirna sirna Scrambled sirna d a Ratio (Fatty-acid oxidation) 3. 2.. sirna sirnai: Scrambled P-AMPK AMPK PTB experiments indicated that PTB, which interacted with endogenous (see Supplementary Information, Fig. S2c), did not bind AdipoR in C2C2 myoblasts (see Supplementary Information, Fig. S2b). As the PTB domain of is required for interaction with AdipoR, it is possible that an adiponectin-stimulated tyrosine phosphorylation of AdipoR is involved in the interaction. However, in vivo labelling studies revealed little tyrosine phosphorylation of AdipoR under either basal or adiponectin-stimulated conditions (data not shown). Mutations of all three tyrosine residues in the intracellular part of mouse AdipoR (Y85F, Y97F or Y9F) had no effect on its binding to (data not Saline Figure 2 The role of in adiponectin signalling. (a) The effects of overexpressed on AMPK and p38 MAPK phosphorylation. C2C2 myoblasts overexpressing or PTB were serum starved and treated with or without full-length adiponectin ( µg ml ) for 5 min. Phosphorylation of p38 MAPK (Thr 8 and Tyr 82) and AMPK (Thr 72), and the protein levels of p38 MAPK, AMPK and input were detected by western blot with specific antibodies as indicated. (b) The effects of sirna on AMPK and p38 MAPK phosphorylation. Scrambled control and -suppressed C2C2 myotubes with same treatment as shown in a. (c) C2C2 and -suppressed C2C2 myotubes were serum starved overnight and treated with or without globular adiponectin ( µg ml ) for 5 min. ACC phosphorylation at Ser 79 and expression were detected by western blot using specific antibodies as indicated. (d) Fatty-acid oxidation in the scramble control C2C2 or -suppressed C2C2 myotubes treated with or without adiponectin. Error bars represent mean ± s.e.m. from three independent experiments. Single asterisk indicates P <.5; double asterisks indicates P <.. shown). These results are consistent with previous findings that the PTB domain of interacts with DCC 4 and human follicle-stimulating hormone (FSH) receptor 5 in a phosphotyrosine-indepenent manner. Taken together, these results suggest a previously unidentified mechanism for regulating the AdipoR interaction. The finding that contains multiple functional domains suggests that may function as an adaptor protein that mediates adiponectin signal transduction. Overexpression of in C2C2 myoblasts led to a significant increase in the phosphorylation of both p38 mitogen-activated protein kinase (MAPK) and AMP-activated protein kinase (AMPK; Fig. 2a and see Supplementary Information, Fig. S2d). On the other hand, overexpression of the PTB, which does not bind AdipoR in both yeast (Fig. a) and C2C2 myoblasts (see Supplementary Information, Fig. S2b), resulted in a decrease in adiponectin-stimulated phosphorylation of p38 MAPK and AMPK (Fig. 2a and see Supplementary Information, Fig. S2d). The effects of on adiponectin-stimulated p38 MAPK phosphorylation were also observed in mouse hepatocyte cells (see Supplementary Information, Fig. S2e). These results indicate that positively regulates adiponectin signalling and suggest that the PTB mutant may function as a dominant negative inhibitor of adiponectin-mediated downstream events, probably by interaction and sequestration of endogenous (see Supplementary Information, Fig. S2c). To determine the physiological role of, C2C2 stable cell lines in which the expression of is suppressed by small interference (si) RNA were generated (see Supplementary Information, Fig. S2f). -stimulated phosphorylation of p38 MAPK was significantly reduced in the -suppressed C2C2 myotubes compared with the scrambled sirna-treated control cells (Fig. 2b and see Supplementary Information, Fig. S2g). Interestingly, both the protein and phosphorylation levels of AMPK were significantly reduced in the -deficient cells (Fig. 2b and see Supplementary Information, Fig. S2g). These results suggest that may have a function not only in adiponectin signalling but also in regulating the expression of proteins functioning in the adiponectin signalling pathway. However, the mechanism by which regulates AMPK levels in cells is currently unknown. It is possible that may mediate adiponectin or other membrane receptor signals to regulate AMPK gene expression, mrna and/or protein stability. Further studies will be needed to test these possibilities. AMPK has an important function in adiponectin-stimulated fattyacid oxidation in muscle as it mediates the phosphorylation and inhibition of acetyl-coa carboxylase (ACC) 4,6,7. Therefore, we examined whether is involved in regulating adiponectin-mediated lipid metabolism through phosphorylation of ACC. In agreement with previous findings 6,7, treatment of C2C2 myotubes with globular adiponectin greatly increased ACC phosphorylation and this phosphorylation was reduced in -deficient cells (Fig. 2c and see Supplementary Information, Fig. S2h). Furthermore, the adiponectinstimulated fatty-acid oxidation was markedly reduced in the - suppressed C2C2 myotubes (Fig. 2d). stimulates GLUT4 membrane translocation and glucose uptake in muscle cells 4,8. To test whether has a function in adiponectin-stimulated GLUT4 membrane translocation, an exofacially HA-tagged GLUT4 was coexpressed in L6 myoblasts together with either or PTB. As expected, GLUT4 plasma membrane translocation was greatly stimulated by treatment of cells with insulin 58 NATURE CELL BIOLOGY VOLUME 8 NUMBER 5 MAY 26

LETTERS a b DAPI GLUT4 Overlay Treatment DAPI Treatment Control GLUT4 Overlay Control Insulin Insulin c DAPI GLUT4 Treatment Overlay PTB Control PTB Insulin PTB d Fold (glucose update) 2.5 2.5.5 + + sirna Scrambled sirna Figure 3 The role of in glucose metabolism. (a c) Confocal microscopy images depict the localization of the exofacial HA-tagged GLUT4 and the Myctagged or PTB in L6 myoblasts treated with or without insulin or adiponectin. The localization of GLUT4 (red) and expression of or PTB (green) were determined by specific antibodies as described in the Methods. The cell nuclei were stained with DAPI (blue). The scale bars represent µm except in rows 2 and 3 of panel b where they represent 5 µm. (d) C2C2 and -suppressed C2C2 myotubes were serum starved for 6 h and treated with or without globular adiponectin ( µg ml ) for 3 min. 2deoxy-D-2-3H-glucose (.5 µci ml ) and µm 2-deoxyglucose were added to the cells. Uptake was allowed at 37 C for min. After intense washing, cells were lysed, followed by measurements of 2-deoxy-D-2-3H-glucose radioactivity. The error bars represent mean ± s.e.m from three independent experiments. Single asterisk indicates P <.5; double asterisks indicates P <.. (Fig. 3a and see Supplementary Information, Fig. S2i). A significant amount of GLUT4 membrane translocation was also detected in cells treated with either globular adiponectin (Figs. 3a and see Supplementary Information, Figs S2i, j and S3c) or full length adiponectin (data not shown). In addition, overexpression of was sufficient to enhance GLUT4 membrane translocation to a level comparable with that induced by adiponectin (Fig. 3b). The adiponectin- or insulin-stimulated GLUT4 membrane translocation, however, was markedly reduced in cells coexpressing the dominant negative PTB (Fig. 3c and see Supplementary Information, Fig. S2i). -stimulated glucose uptake was also markedly reduced in the -suppressed C2C2 myotubes compared with the control C2C2 myotubes (Fig. 3d). Taken together, these results suggest that is involved in both adiponectin and insulin-stimulated GLUT4 translocation in muscle cells. Significant membrane translocation of was not detected in cells treated with adiponectin. However, it has previously been shown that is NATURE CELL BIOLOGY VOLUME 8 NUMBER 5 MAY 26 59

LETTERS a b Mr(K) Mr(K) 25 25 + Pull down: GST c Rab5 (bound) 25 - Rab5 Rab5 (input) 79 - + GST Rab5 Lysates c + Nlg + Anti- d YFP + DAPI DAPI GLUT4 GLUT4 + DAPI Treatment DAPI Treatment Rab5 GLUT4 Overlay WT Control Control WT S34N Control Control S34N BAR e Membrane GLUT4 density (fold) Control BAR 3 2.5 2.5.5 Saline WT Rab5 Rab5S34N Figure 4 The role of Rab5 in the adiponectin signalling pathway. (a) Serumstarved C2C2 myoblasts were treated with (+) or without ( ) µg ml globular adiponectin for min. The endogenous Rab5 were pulled down by GST or GST c fusion proteins. The bound endogenous Rab5 and Rab5 expression level (input) were detected with the anti-rab5 antibodies. (b) The endogenous protein was immunoprecipitated with an anti or a control antibody from C2C2 myoblasts as described in a. The immunoprecipitated and coimmunoprecipitated endogenous Rab5 were detected with the antibodies to the respective proteins. Total lysates are also indicated. NIg, normal immunoglobulin. (c) HA-tagged GLUT4 was cotransfected with the YFP-tagged or BAR into L6 myoblasts. Cells were treated with or without µg ml globular adiponectin for 3 min. The localization of GLUT4 (red) and expression of YFP or BAR (green) were determined as described in the Methods. The cell nuclei were stained with DAPI (blue). The scale bar represents µm. (d) HA-tagged GLUT4 (red) was cotransfected with FLAG-tagged Rab5 (green) or enzyme inactive Rab5 (S34N; green) into L6 myoblasts. The transfected cells were treated as described in c. The scale bar represents µm. (e) Graphical representation of the relative density of GLUT4 on the cell membrane shown in d. The scale bars represent mean ± s.e.m (n = 4). The asterisk indicates P <.5. localized in both cytosol and at the membrane9. Thus, adiponectin may stimulate the interaction between AdipoR and the fraction of that is already in close proximity to AdipoR. Nevertheless, we cannot exclude the possibility that a fraction of localized to a specific subcellular compartment is stimulated by adiponectin. As mediates adiponectin-stimulated phosphorylation of AMPK and p38 MAPK in muscle cells (Fig. 2a, b), we examined whether adiponectin-stimulated GLUT4 translocation occurs through AMPK or p38 MAPK-dependent pathways. Coexpression of either kinase-inactive AMPK or kinase-inactive p38 MAPK with HA-tagged GLUT4 only partially suppressed adiponectin-stimulated GLUT4 membrane translocation (see Supplementary Information, Fig. S3a), which is consistent with a previous report for the function of p38 MAPK and AMPK in adiponectin-stimulated glucose uptake4. These results suggest that an AMPK and p38 MAPK-independent pathway may also be involved in adiponectin-stimulated GLUT4 membrane translocation. Recently, the 52 NATURE CELL BIOLOGY VOLUME 8 NUMBER 5 MAY 26

LETTERS a b c M r (K) 42-42 - Insulin M r (K) 79 - Insulin M r (K) 79 - Insulin 2 3 4 5 6 5 3 5 3 Scrambled sirnai 2 3 4 5 6 + + + 2 3 4 5 6 7 8 + + + + Scrambled sirnai sirnai P-Akt T38 Time (min) P-Akt T38 + + + + sirnai P-Akt T38 small GTPase, Rab5, has been shown to interact with (ref. 9) and to regulate GLUT4 internalization in an insulin-dependent mechanism 2. Consistent with this finding, we found that Rab5 interacts with the N-terminal BAR domain of (Fig. 4a and see Supplementary Information, Fig. S3b). further stimulates the interaction Akt P-MAPK MAPK Akt PTB Akt Figure 5 The role of in the cross talk between insulin signalling and adiponectin signalling. (a) C2C2 myotubes and -suppressed C2C2 myotubes were serum starved for 6 h and treated with insulin ( nm) for the indicated times. Akt and MAP kinase phosphorylation (P) was detected by western blot using phospho-specific antibodies as indicated. The expression of Akt and MAP kinase was detected by specific antibodies to these proteins. (b) C2C2 myoblasts overexpressing Myc-tagged wild-type or PTB were treated with nm insulin for 5 min. Akt phosphorylation on Thr 38 and expression were detected by western blot using specific antibodies as indicated. The expression of or/and PTB was detected with anti-myc monoclonal antibodies. The results are representative of three independent experiments with similar findings. (c) Serum-starved C2C2 myotubes and -suppressed C2C2 myotubes were pretreated with globular adiponectin ( µg ml ) for 5 min, followed by addition of nm insulin for 5 min. Akt phosphorylation on Thr38 and expression were detected by western blot using specific antibodies as indicated. The expression levels were detected with an specific antibody. between and Rab5 (Fig. 4a, b). As only binds to the GTP form of Rab5 (ref. 9), this result suggests that adiponectin stimulates Rab5 activation. To test whether Rab5 has a function in adiponectin signalling, an exofacially HA-tagged GLUT4 was coexpressed in L6 myoblasts together with or BAR, a mutant form of that does not bind Rab5 (ref. 9). The adiponectin-stimulated GLUT4 membrane translocation was reduced in cells that coexpressed BAR (Fig. 4c and see Supplementary Information, Fig. S2j), suggesting that interaction with Rab5 may be necessary for to mediate adiponectin signalling. We also examined whether Rab5 enzyme activity was essential for mediating adiponectin-stimulated GLUT4 membrane translocation. Overexpression of a dominant-negative Rab5 (Rab5 S34N ) 2 blocked adiponectin-stimulated GLUT4 membrane translocation in L6 cells (Fig. 4d, e). Together, our findings suggest that the interaction between and Rab5 has a function in mediating adiponectin-stimulated GLUT4 membrane translocation. Interestingly, overexpression of Rab5 S34N inhibited adiponectin-stimulated p38 MAPK but not AMPK phosphorylation (see Supplementary Information, Fig. S3d), suggesting that Rab5 may regulate specific signalling pathways downstream of the adiponectin receptor. has been shown to act as an insulin sensitizer 2, yet the molecular mechanism underlying the crosstalk between the insulin and adiponectin signalling pathways remains largely unknown. is an adaptor protein containing multiple functional domains and has been found to interact with several important signalling molecules in the insulin signalling pathway, including the p catalytic subunit of phophatidylinositol-3-oh (PI(3)K) and Akt 3. To investigate the potential role of in insulin signal transduction, the effect of expression on Akt activation was examined. Knocking down expression in C2C2 myotubes by sirna resulted in a significant reduction in insulinstimulated Akt phosphorylation, but not of MAP kinase (also known as p42/44 Erk) phosphorylation (Fig. 5a). In addition, overexpression of full-length slightly enhanced insulin-stimulated Akt phosphorylation, whereas PTB significantly reduced this phosphorylation (Fig. 5b). Taken together, our results indicate that has important functions in both the insulin and adiponectin signalling pathways. We further examined whether is involved in the crosstalk between the adiponectin and insulin signalling pathways. Treatment of C2C2 myoblasts with adiponectin alone had no effect on Akt phosphorylation (Fig. 5c). However, a notable synergistic effect on Akt activation was observed when the cells were treated with both adiponectin and insulin (Fig. 5c). Furthermore, down-regulation of expression by sirna reduced the synergistic effect of adiponectin on insulin-stimulated Akt phosphorylation (Fig. 5c). Thus, -mediated crosstalk between the adiponectin and insulin signalling pathway is one mechanism that may explain the insulin-sensitizing effect of adiponectin in muscle cells. As adiponectin has shown significant anti-diabetic, anti-atherogenic and anti-inflammatory properties, elucidating the adiponectin signalling pathway is essential to harness the therapeutic application of this hormone. Here, we have identified as the first signalling molecule that binds to the adiponectin receptors and positively mediates adiponectin signalling in muscle cells. Our study also suggests that is a potential link between the adiponectin and insulin pathways. The molecular interaction between and adiponectin receptors may be the mechanism by which adiponectin sensitizes insulin signalling and action. NATURE CELL BIOLOGY VOLUME 8 NUMBER 5 MAY 26 52

LETTERS METHODS Plasmids, adiponectin and antibodies. The full-length cdnas encoding adiponectin,, AdipoR and AdipoR2 were cloned from human and mouse testis cdna libraries using pcr2. TOPO cloning kits (Invitrogen, Carlsbad, CA), respectively. cdnas encoding full-length and truncated human were subcloned into the mammalian expression vector pcdna3. Myc His(+) (Invitrogen) and cdnas encoding full-length of AdipoR or AdipoR2 were subcloned into the mammalian expression vector pbex and pcdna3. Myc-His(+). For the deletion mutant constructs, DNA fragments corresponding to different regions were subcloned into the respective expression vectors. Full-length adiponectin was purchased from Biovison Inc (Mountain View, CA) and globular adiponectin was produced as a His-tagged protein in BL2(DE3) bacterial cells (see Supplementary Information, Fig. S4a, b). Antisera to or to AdipoR were raised in rabbits and mice using a GST c (amino acids 455 79) or GST AdipoRn (amino acids 4 42), respectively (see Supplementary Information, Fig.S4c, d). An antibody to ACC was purchased from Alpha Diagnostic (San Antonio, TX) and anti-rab5 antibody was from Biovision Inc (Mountain View, CA). All other antibodies were obtained from Cell Signaling Technologies (Danvers, MA). Yeast two-hybrid cdna library screening. The adiponectin bait plasmid was generated by subcloning a cdna fragment encoding mouse adiponectin without the signal peptide (amino acids 3 244) into the plexa two-hybrid vector (Clontech, Mountain View, CA). The AdipoR bait plasmid was generated by subcloning a cdna fragment encoding the intracellular portion of AdipoR (amino acids 4 42) into the plexa vector. The bait plasmid (adiponectin or AdipoR) was cotransformed with a yeast two-hybrid cdna library derived from human fetal brain. Positive clones were identified by selection on leucine-deficient media and then screened for expression of the β-galactosidase reporter gene by β-galactosidase filter assays as previously described 22. Cell culture. CHO IR cells were maintained in Ham s F-2 medium (Invitrogen) supplemented with % newborn calf serum and % penicillin streptomycin. C2C2 and L6 myoblasts (from the American Type Culture Collection (ATCC), Manassas, VA) were grown in DMEM (ATCC) supplemented with % fetal bovine serum and % penicillin streptomycin. C2C2 myotubes were induced by growing the cells in low-serum differentiation medium (98% DMEM, 2% (v/v) horse serum, 4. mm glutamine, 25 mm HEPES). The medium was changed daily and multinucleated myotubes were normally observed by days 5 7. The mouse hepatocyte cells 23 were maintained in AMEM supplemented with mm l-glutamine, 2 nm dexamethasone and 4% FBS at 33 C with 5% CO 2. In vitro binding studies, coimmunoprecipitation, in vivo labelling and phosphoamino acid analysis. The experimental procedures for in vitro binding, coimmunoprecipitation, in vivo labelling and phosphoamino acid analysis were as previously described 22 with only minor modifications. RNA interference and generation of -suppressed cells. The sense and anti-sense sequences of sirna were chemically synthesized and ligated into the psiren RetroQ (BDKnockout RNAi system, BD, San Jose, CA). The sense sequence corresponds to nucleotides 53 73 of mouse (AAGAGTGGATCTGTACAATAA). The sequence for the sirna scrambled control is AATATTATTAAGGCGACAGAG. For generation of sirna stable cell lines, C2C2 myoblasts were transfected with the sirna construct or scrambled control and selected with 5 µg ml puromycin as previously described 24. Western blot and statistical analyses. The expression and phosphorylation levels of various proteins were detected by western blot of cell lysates or immunoprecipitates with specific antibodies. Quantification of the relative increase in protein phosphorylation (expressed as percentage of basal phosphorylation; arbitrarily set as.) was performed by analysing western blots using the ChemiImaging 44 program (Alpha Innotech Corporation, San Leandro, CA) and was normalized for the amount of protein expressed in each experiment. Statistical evaluation of the data was done using paired t-test or one-way analysis of variance (ANOVA). Immunofluorescence microscopy studies. L6 myoblasts were transfected with plasmids encoding GLUT4 with an exofacial HA tag with or without Myc-tagged, YFP or FLAG-tagged Rab5. Twenty-four hours after transfection, cells were serum-starved, treated with µg ml globular adiponectin or 2.5 µg ml full length adiponectin for 3 min and then fixed in PBS containing 4% paraformaldehyde for h at 4 C. GLUT4 expression on the membrane was detected with an anti-ha antibody (polyclonal) without permeabilizing the cells, followed by addition of the Alexa 568 conjugated secondary antibody (red). After three washes with PBS, cells were permeabilized, incubated with a monoclonal anti-myc antibody or anti-flag antibody and then with Alexa 568-conjugated goat anti-rabbit IgG and Alexa 488 conjugated goat anti-mouse IgG secondary antibodies (green; Molecular Probes, Eugene, OR). Nuclear staining was performed with 4, 6-diamidno-2-phenylindole (DAPI; Sigma, St Louis, MO). The YFP-fused proteins were directly visualized under a confocal microscope. Images were acquired on an Olympus FV-5 laser-scanning confocal microscope. The fluorescence intensity on the cell membrane (red) was measured using ImageJ (National Institutes of Health (NIH), Bethesda, MD) and calculated as the relative density (fold) of GLUT4. Statistical evaluation of the data was done using paired t-test or one-way analysis of variance (ANOVA). Fatty-acid oxidation. C2C2 myoblasts were serum-starved for 2 h and incubated with preincubation buffer (DMEM, 2 mm glucose, 4 mm glutamine, 25 mm HEPES, % free fatty acid (FFA)-free BSA and.25 mm oleate) for h in 24-well plates as previously described 25. Following addition of 4 C-oleic acid ( µci ml ; American Radiolabeled Chemicals, St Louis, MO), cells were incubated for.5 h at 37 C in the presence or absence of globular adiponectin ( µg ml ). Each well was covered with a piece of filter paper (Whatman paper #3; Whatman, Florham Park, NJ). After incubation,. ml of 7% perchloric acid (Sigma) was injected into the wells with a syringe and.2 ml of 3 M NaOH was injected onto the Whatman paper. The filter paper was removed from the wells after collection of CO 2 for h. The amount of 4 C-radioactivity was determined by a liquid scintillation counter. Glucose uptake. 2-deoxylglucose uptake measurements were carried out as described previously 26 with minor modifications. Briefly, C2C2 myoblasts stably expressing sirna and scrambled sirna control cell lines were seeded to 6-well plates, differentiated with DMEM containing 2% horse serum. Cell were washed, starved and then stimulated with µg ml of globular adiponectin for 3 min at 37 C. 2-deoxy-d-2-3 H-glucose (.5 µci ml ; American Radiolabeled Chemicals) and µm 2-deoxyglucose (Sigma) were added to the cells. Uptake was allowed at 37 C for min. Cells were subsequently washed with cold PBS and lysed in.5 ml of. M NaOH. The non-specific uptake was measured in the presence of µm cytochalasin B (Sigma). Note: Supplementary Information is available on the Nature Cell Biology website. ACKNOWLEDGEMENTS We thank M. A. Lim for generation of the RNAi-suppressed cell lines, D. Hu and M, Chung for excellent technical assistance and V. Frohlich (Digital Optical Imaging Facility, UTHSCSA) for assistance with confocal microscopy studies. We also thank T. W. Wang for providing the yeast two-hybrid cdna library, D. Accili for mouse hepatocyte cells, X. Y. Huang for wild-type and dominant negative (S34N) Rab5, J. H. Han for p38 MAPK constructs and M. J. Quon for the HA GLUT4 and AMPK constructs. This work was supported in part by a Career Development Award from the American Diabetes Association (L.Q.D.) and National Institute of Health grants RO DK6993 (L.Q.D.), RO DK52933 (F.L.), pre-doctoral fellowship F3DK68874 (R.A.R.) and training grant T32 AG289 (F.J.R. and J.Y.H.). COMPETING FINANCIAL INTERESTS The authors declare that they have no competing financial interests. Published online at http://www.nature.com/naturecellbiology/ Reprints and permissions information is available online at http://npg.nature.com/ reprintsandpermissions/. Berg, A. H., Combs, T. P. & Scherer, P. E. ACRP3 adiponectin: an adipokine regulating glucose and lipid metabolism. Trends. Endocrinol. Metab. 3, 84 89 (22). 2. Kadowaki, T. & Yamauchi, T. and adiponectin receptors. Endocr. Rev. 26, 439 45 (25). 3. Tsao, T. S., Lodish, H. F. & Fruebis, J. ACRP3, a new hormone controlling fat and glucose metabolism. Eur. J.Pharmacol. 44, 23 22 (22). 4. Yamauchi, T. et al. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423, 762 769 (23). 522 NATURE CELL BIOLOGY VOLUME 8 NUMBER 5 MAY 26

LETTERS 5. Kubota, N. et al. Disruption of adiponectin causes insulin resistance and neointimal formation. J. Biol. Chem. 277, 25863 25866 (22). 6. Maeda, N. et al. Diet-induced insulin resistance in mice lacking adiponectin ACRP3. Nature Med. 8, 73 737 (22). 7. Yamauchi, T. et al. The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nature Med. 7, 94 946 (2). 8. Hu, E., Liang, P. & Spiegelman, B. M. AdipoQ is a novel adipose-specific gene dysregulated in obesity. J. Biol.Chem. 27, 697 73 (996). 9. Weyer, C. et al. Hypoadiponectinemia in obesity and type 2 diabetes: close association with insulin resistance and hyperinsulinemia. J. Clin. Endocrinol. Metab. 86, 93 935 (2).. Statnick, M. A. et al. Decreased expression of apm in omental and subcutaneous adipose tissue of humans with type 2 diabetes. Int. J. Exp. Diabetes Res., 8 88 (2).. Hotta, K. et al. Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients. Arterioscler. Thromb. Vasc. Biol. 2, 595 599 (2). 2. Liu, X. et al. A novel ability of Smad3 to regulate proteasomal degradation of a Cas family member HEF. EMBO J. 9, 6759 6769 (2). 3. Mitsuuchi, Y. et al. Identification of a chromosome 3p4.3 2. gene, APPL, encoding an adaptor molecule that interacts with the oncoprotein-serine/threonine kinase AKT2. Oncogene 8, 489 4898 (999). 4. Liu, J. et al. Mediation of the DCC apoptotic signal by DIP3α. J. Biol. Chem. 277, 2628 26285 (22). 5. Nechamen, C. A. et al. Human follicle-stimulating hormone (FSH) receptor interacts with the adaptor protein in HEK 293 cells: potential involvement of the PI3K pathway in FSH signaling. Biol. Reprod. 7, 629 636 (24). 6. Tomas, E. et al. Enhanced muscle fat oxidation and glucose transport by ACRP3 globular domain: acetyl-coa carboxylase inhibition and AMP-activated protein kinase activation. Proc. Natl Acad. Sci. USA 99, 639 633 (22). 7. Yamauchi, T. et al. stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nature Med. 8, 288 295 (22). 8. Ceddia, R. B. et al. Globular adiponectin increases GLUT4 translocation and glucose uptake but reduces glycogen synthesis in rat skeletal muscle cells. Diabetologia 48, 32 39 (25). 9. Miaczynska, M. et al. APPL proteins link Rab5 to nuclear signal transduction via an endosomal compartment. Cell 6, 445 456 (24). 2. Huang, J., Imamura, T. & Olefsky, J. M. Insulin can regulate GLUT4 internalization by signaling to Rab5 and the motor protein dynein. Proc. Natl Acad. Sci. USA 98, 384 389 (2). 2. Chen, X. & Wang, Z. Regulation of epidermal growth factor receptor endocytosis by wortmannin through activation of Rab5 rather than inhibition of phosphatidylinositol 3-kinase. EMBO Rep. 2, 842 849 (2). 22. Dong, L. Q. et al. Phosphorylation of PKN by PDK mediates insulin signals to the actin cytoskeleton. Proc. Natl Acad. Sci. USA 97, 589 594 (2). 23. Rother, K. I. et al. Evidence that IRS-2 phosphorylation is required for insulin action in hepatocytes. J. Biol. Chem. 273, 749 7497 (998). 24. Langlais, P. et al. Negative regulation of insulin-stimulated MAP kinase signaling by Grb. Mol. Endocrinol. 8, 35 358 (24). 25. Wong, G. W., Wang, J., Hug, C., Tsao, T. S. & Lodish, H. F. A family of Acrp3 adiponectin structural and functional paralogs. Proc. Natl Acad. Sci. USA, 32 37 (24). 26. Somwar, R. et al. GLUT4 translocation precedes the stimulation of glucose uptake by insulin in muscle cells: potential activation of GLUT4 via p38 mitogen-activated protein kinase. Biochem. J. 359, 639 649 (2). 27. Arai, M. et al. ConPred II: a consensus prediction method for obtaining transmembrane topology models with high reliability. Nucleic Acids Res. 32,W39 W393 (24). NATURE CELL BIOLOGY VOLUME 8 NUMBER 5 MAY 26 523

a b AdipoR 9 356 375 N- IT TM ET -C Prey 3 375 ET Supplementary Fig.. Lily Q. Dong et al

Fig. S. Interaction of adiponectin with AdipoR. To understand how the adiponectin signal is transduced in cells, we were initially interested in identifying the adiponectin receptor. We screened a yeast two-hybrid cdna library derived from human fetal brain 2 using adiponectin as bait. One of the positives contained an insert encoding the C- terminus (aa 3 to 375) of a novel protein, which was later reported by Yamauchi et al. as AdipoR 4. (a) Proposed structure of AdipoR made using ConPred II program 27. The arrows indicate the region that binds to adiponectin in yeast two-hybrid system as described in (b) and the method. (b) Schematic representation of human AdipoR construct and the region in AdipoR ( Prey ) identified by the yeast two-hybrid screening. IT: intracellular domain; TM, transmembrane domain; ET, extracellular domain.

a. M.W. (kda) 38 ---- 2 3 4 WB: HA-AdipoR2 79 ---- Myc- NIg Myc IP Lysate b. M.W. (kda) 38 ---- 2 3 4 5 6 WB: HA-AdipoR 79 ---- Myc- --- - + - + - + IP NIg Anti-myc Myc-(DPTB) c. M.W. (kda) 79 ---- 2 3 WB: 79 ---- --- PTB IP: NIg Anti-myc d. Relative phosphorylation 5 4 3 2 Saline Mock DPTB Mock DPTB Phospho-p38 MAPK Phospho-AMPK e. M.W. (kda) 38 ---- 2 3 4 5 6 P-p38 MAPK 38 ---- p38 MAPK --- P-AMPK (T72) --- AMPK 79 ---- --- - + - + - + (DPTB) Supplementary Fig. 2. Lily Q. Dong et al

f. M.W. (kda) 79 ---- 2 55 ---- RNAi - + b-tubulin g 3 Relative phosphorylation 2.5 2.5.5 Saline RNAi: Scrambled Scrambled P38 MAPK AMPK h 3 2.5 Ratio (P-ACC) 2.5 Saline.5 RNAi: Scrambled i Membrane GLUT4 Density (fold) 7 6 5 4 3 2 Saline Insulin Control plasmid ( PTB) Supplementary Fig. 2 (Cont.). Lily Q. Dong et al

j 2.5 Membrane GLUT4 Density (fold) 2.5.5 Saline Control plasmid YFP/ YFP/( BAR) Supplementary Fig. 2 (Cont.). Lily Q. Dong et al

Fig. S2. in adiponectin signaling. (a) Interaction of with AdipoR2. Myc-tagged full-length and HA-tagged AdipoR2 were co-expressed in C2C2 myoblasts. was immunoprecipitated with anti-myc antibody (lower panel, lane 2) or normal Ig (NIg) control (lower panel, lane ). Co-immunoprecipitated AdipoR2 was detected with anti-ha antibody (upper panel, lane 2). (b) The PTB domain of is essential for binding AdipoR. C2C2 myoblasts overexpressing HA-tagged AdipoR and myc-tagged (full-length or PTB domain truncated mutant) were serum starved for 6 hours, followed by treatments with or without 2 g/ml adiponectin. Fulllength and truncated forms of were immunoprecipiated with anti-myc antibody or normal Ig (NIg) control. Immunoprecipitated (lower panel) and coimmunoprecipitated AdipoR (upper panel) were detected with anti-myc and anti-ha monoclonal antibodies, respectively. (c) forms dimmer in cells. Myc-tagged fulllength or PTB domain truncated form of proteins were overexpressed in C2C2 myoblasts and immunoprecipitated with anti-myc antibody or NIg control. Coimmunoprecipitated endogenous was detected with an anti- antibody (upper panel). Overexpressed was detected with an anti-myc monoclonal antibody (lower panel). (d) Graphic representation of phosphorylation of p38 MAPK and AMPK shown in Fig. 2a. Bars represent mean ± SEM from four independent experiments., p<.5;, p<.. (e) The role of in adiponectin signaling in hepatocytes. Murine hepatocytes overexpressing or ( PTB) were serum starved and treated with or without full-length adiponectin ( µg/ml) for 5 min. Phosphorylation and the protein levels of p38 MAPK (first and second panels), AMPK (third and fourth panels) and expression of or ( PTB) (bottom panel) were

detected with specific antibodies as indicated. (f) sirna. The sense and antisense sequences of RNAi were chemically synthesized and ligated into the psiren-dnr vector (BD, BD TM Knockout RNAi system). The successful generation of the psiren/ RNAi and its scrambled control were confirmed by DNA sequencing. For generation of RNAi stable cell lines, C2C2 myogenic cells were transfected with the RNAi construct or the scrambled control and selected with 5 g/ml puromycin as previously described 24. The effect of RNAi on expression was tested by Western blot (Top panel). Equal loading of protein in cell lysates was determined by Western blot using an anti- β-tubulin antibody (bottom panel). (g) Graphic representation of phosphorylation of p38 MAPK and AMPK shown in Fig. 2b. Bars represent mean ± SEM from four independent experiments., p<.5;, p<.. (h) Graphic representation of phosphorylation of ACC shown in Fig. 2c. Bar represents mean ± SEM from four independent experiments. (i) The amount of GLUT4 on the cell membrane was measured and calculated as the relative density of GLUT4 (fold) shown in Fig. 3a. Bars represent mean ± SEM from three independent experiments. (j) Graphic representation of the relative density of GLUT4 (folds) on the cell membrane shown in Fig. 4c. Bars represent mean±sem (N=3)., p<.5.

a Membrane GLUT4 Density (fold) 2.5.5 Saline AMPK(WT) AMPK(KD) p38mapk(wt) p38mapk(kd) b M.W. (kda) GST/ 54 GST/c c 3 Membrane GLUT4 Density (fold) 2.5 2.5.5 Saline Rab5(WT) Rab5(S34N) Supplementary Fig. 3. Lily Q. Dong et al

d M.W. (kda) 38 2 3 4 P-p38MAPK (T8/Y82) 38 p38mapk 63 P-AMPK (T72) 63 AMPK 25 Rab5 - + - + Rab5 WT S34N Supplementary Fig. 3 (Cont.) Lily Q. Dong et al

Fig. S3. The roles of AMPK, p38mapk and Rab5 in the adiponectin stimulated GLUT4 translocation. (a) The HA-tagged GLUT4 was co-transfected with the myctagged AMPK or Flag-p38 MAPK (wild type (WT) or kinase dead (KD)) into L6 myoblasts. The GLUT4 expression on the membrane was detected with an anti-ha (polyclonal) without permeabilizing the cells, followed by addition of the Alexa 568 conjugated secondary antibody. The expressions of AMPK and p38 MAPK were detected with antibodies specific to myc and Flag (monoclonal) after permeabilization of the cells, respectively, followed by addition of the Alexa 488 conjugated secondary antibody (green). The presence and localization of GLUT4 (red) and p38 MAPK or AMPK (green) were visualized with a confocal microscope. The nuclei of cells were stained with DAPI. The amount of GLUT4 on the cell membrane was measured and calculated as the relative density of GLUT4 (fold). Bars represent mean±sem from three independent experiments. (b) The GST fusion proteins used in Fig. 4a were visualized by Coomassie blue staining. (c) Graphic representation of the relative density of the relative density of GLUT4 (folds) on the cell membrane shown in Fig. 4d. Bars represent mean ± SEM (N=4)., p<.5. (d) The effects of Rab5 on adiponectin signaling. Flag-tagged Rab5 or Rab5 (S34N) was transiently transfected into C2C2 myoblasts, and detected using anti- Flag antibody (fifth panel). The phosphorylation of p38 MAPK (first panel) and AMPK (third panel), and the expressions of endogenous p38 MAPK (second panel) and AMPK (fourth panel) were detected with indicated specific antibodies, respectively. (N=3).

a. M.W. (kda) 5 2 g b. M.W. (kda) 2 3 4 5 6 P-AMPK (T72) AMPK g (mg/ml).8 3.6 5.2 f(mg/ml) 5 c. M.W. (kda) 2 79 - Myc-Tagged 79 - - myc - + Myc-tagged Endogenous d. M.W. (kda) 2 WB: 38 ---- a-ha 38 ---- a-adipor AdipoR AdipoR2 Supplementary Fig. 4. Lily Q. Dong et al

Fig. S4. Generation of recombinant globular adiponectin and specific antibodies against AdipoR and. (a) Purification of globular adiponectin (g). The C-terminal part of human adiponectin (amino acids 6-244) was cloned into the pet5b bacterial expression vector and expressed as a His-tagged protein in BL2DE3 bacterial cells. His-tagged g was affinity purified using Ni-Agarose beads, extensively washed, and eluted from the Ni-Agarose resin. Recombinant g was subjected to dialysis and the purity of the sample was visualized by Coommassie blue staining of a SDS-PAGE gel. (b) Activity of recombinant g. C2C2 myoblasts were subjected to serum starvation overnight and either left untreated or treated with the indicated amounts of g for 3 minutes. Clarified cell extracts were separated by SDS-PAGE and transferred onto nitrocellulose membrane, followed by Western blot with the indicated antibodies. (c) Generation of antibody. The C- terminus (455-79 aa) of human was cloned into pgex4t vector and the GST- c fusion protein was purified and used as an antigen for generating antibody in rabbits. To test the specificity of the antibody, Myc-tagged was transfected into C2C2 myoblasts. Cells were lysed and the expression of was tested by using antibodies against the Myc-tag (Upper panel). Immunoblot analysis indicated that the resulting serum antibodies recognize both endogenous and overexpressed (Bottom panel). (d) Generation of AdipoR antibody. The N-terminus (-75 aa) of mouse AdipoR was cloned into pgex4t vector and the GST-AdipoR fusion protein was purified and used as an antigen to immunize wild type C57BL/6 mice. After the 6 th boost, mice were sacrificed and the blood was collected. To test the specificity of the antibody, HA tagged AdipoR and AdipoR2 were transfected into CHO/IR cells,

separately. Cells were lysed and the expression of AdipoR and AdipoR2 were tested by using antibodies against HA-tag (Upper panel). Immunoblot analysis indicated that AdipoR antibody from the serum recognized AdipoR protein, but not AdipoR2 (Bottom panel).

ERRATUM In the letter by Mao et al. (Nature Cell Biol. 8, 56 523; 26), the labelling of the molecular weight markers in Fig. d was incorrect. This figure has been corrected online and is shown below. d M r (K) 38 - M r (K) AdipoR (bound) 54 - GST c 38 - Pull down: + + GST GST c AdipoR (input) 26 - GST NATURE CELL BIOLOGY VOLUME 8 NUMBER 6 JUNE 26 642