Nature Medicine doi: /nm.3150

Similar documents
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Review. ATP-Binding Cassette Transporters, Atherosclerosis,

UvA-DARE (Digital Academic Repository) HDL cholesterol: atherosclerosis and beyond Bochem, A.E. Link to publication

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

2.5. AMPK activity

Nature Immunology: doi: /ni.3412

ApoE regulates hematopoietic stem cell proliferation, monocytosis, and monocyte accumulation in atherosclerotic lesions in mice

Supplementary Figure 1. Successful excision of genes from WBM lysates and

Neutrophil-derived S100 calcium-binding proteins A8/A9 promote reticulated thrombocytosis and atherogenesis in diabetes

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

Quantitative Real-Time PCR was performed as same as Materials and Methods.

UvA-DARE (Digital Academic Repository) HDL cholesterol: atherosclerosis and beyond Bochem, A.E. Link to publication

Chronic variable stress activates hematopoietic stem cells

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Effective Targeting of Quiescent Chronic Myelogenous

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).

Neutrophil-derived S100 calcium-binding proteins A8/A9 promote reticulated thrombocytosis and atherogenesis in diabetes

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

SUPPLEMENTARY INFORMATION

Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice

Transfer protocol of human HSC into NOG mice

Supplementary material page 1/10

Hematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human)

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ

SUPPLEMENTARY INFORMATION

Supplemental Table I.

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR

Summary and concluding remarks

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Supplementary Table 1. List of primers used in this study

Supplement: Infusing mature megakaryocytes into mice yields functional platelets

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L.

Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

SUPPLEMENTARY FIGURES

Quantitative PPARγ expression affects the balance between tolerance and immunity

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Supplementary Materials for

Supplementary Figures

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Material

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

Schumacher et al. Journal of Hematology & Oncology (2015) 8:64 DOI /s

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Materials for

pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki

Hematopoietic ABCA1 deletion promotes monocytosis and worsens diet-induced insulin resistance in mice

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Supplementary Figure 1

Supplemental Information. Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection. Cell Host & Microbe, Volume 15

SUPPLEMENTARY INFORMATION

CHAPTER Cir. Res. 2010; 107(12): e

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

Supplemental Figures:

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

SUPPLEMENTARY INFORMATION

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

Nature Genetics: doi: /ng Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Supporting Information

Technical Bulletin No. 100

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Data. (continued)

Commensal Bacteria at the Crossroad Between Cholesterol Homeostasis and Chronic Inflammation. in Atherosclerosis

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed

Journal of the American College of Cardiology Vol. 50, No. 24, by the American College of Cardiology Foundation ISSN /07/$32.

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

TITLE: Control of Atherosclerosis Regression by PRMT2 in Diabetes

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!

Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney

Transcription:

Nature Medicine doi:10.1038/nm.3150

Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG AGCCGTAGATGGACAGGATG Abcg4 CGTGCTCACCTTTCCCTTAG CGATGCTGCAGTACACCACT Hmgcs1 GCCGTGAACTGGGTCGAA GCATATATAGCAATGTCTCCTGCAA Ldlr GAGGAACTGGCGGCTGAA GTGCTGGATGGGGAGGTCT Scarb1 TCCCCATGAACTGTTCTGTGAA GTTTGCCCGATGCCCTTGA β-actin AGCCATGTACGTAGCCATCC GTGGTGGTGAAGCTGTAGCC 36B4 CCTGAAGTGCTCGACATCAC CCACAGACAATGCCAGGAC Supplementary Figure Legends:

Supplementary Fig. 1. Abcg4 -/- atherosclerotic lesion and blood phenotype. Irradiated Ldlr -/- mice (n=12/group) were transplanted with donor BM cells from WT or Abcg4 -/- mice and fed a WTD diet for 12 weeks. (a) Representative of H&E-stained of the proximal aortas. Scale bar=50µm. (b) HDL, (c) non-hdl cholesterol and (d) triglyceride levels. (e) Peripheral white blood cell, (f) monocyte, (g) red blood cell (h) and reticulocyte counts. (i) Platelet-associated Ly6C hi monocyte or neutrophils in WTDfed Ldlr -/- mice transplanted with WT or Abcg4 -/- BM cells. Data are means ± SEM, *P<0.05 WT versus Abcg4 -/- and ^P<0.05 for treatment effect. Supplementary Fig. 2. Platelet cholesterol efflux. Platelets from WT and Abcg4 -/- mice fed the chow diet were isolated and used to determine (a) percentage cholesterol efflux and (b) cholesterol content. Data are means ± SEM. Supplementary Fig. 3. Flow cytometry overview. Flow cytometry analysis of BM HSPC, GMP, CMP and MEP populations. Supplementary Fig. 4. Expression of ABC transporters in hematopoietic cells. (a) Abca1 and Abcg1 mrna expression in WT BM HSPC, CMP, GMP and MEP cells. Error bars are S.E.M (n=10). * P<0.05. (b) Abcg4, Abcg1 and Abca1 mrna expression in MEPs isolated from WT mice treated with or without the LXR agonist TO901317. Data are means ± SD (n=4). * P<0.05.

Supplementary Fig. 5. ABCG4 localization in MkPs. Immunofluorescence confocal microscopy of WT MkPs stained with anti-abcg4 (red) and anti-c-mpl (green). Scale bar=5µm. Supplementary Fig. 6. Platelet production pathway. (a) Plasma TPO levels from the WTD-fed female WT or Abcg4 -/- BMT Ldlr -/- mice (n=10) were determined by ELISA. Cell surface c-mpl levels from (b) BM megakaryocyte or (c) platelets of the WTD-fed female WT or Abcg4 -/- BMT Ldlr -/- mice (n=3) were determined by flow cytometry. (d) Cell proliferation assessed by EdU incorporation for 16 h into BM cell populations from Chow-fed mice (n=5). Data are means ± SEM, *P<0.05. Supplementary Fig. 7. Megakaryocyte quantification in the BM and spleen. Representative and quantification of megakaryocyte staining (anti-vwf antibody) of (a) BM (20X) and (b) spleen (10x) sections from the WT or Abcg4 -/- BM Ldlr -/- recipient mice fed WTD for 12 weeks. Scale bar= (A)50µm and (B)100µm. Data are means ± SEM, * P<0.05. Supplementary Fig. 8. Expression of cholesterol related genes. Gene expression was determined by q-pcr in (a) MEPs or (b) GMPs from the WT or Abcg4 -/- BM Ldlr -/- recipient mice (n=5) fed WTD for 12 weeks. Error bars are S.D (n=10). *P<0.05. (c) MK- CFU assays using total BM cells from WT or Abcg4 -/- mice with or without pretreatment with CD (3 mm) for 30 minutes. Data are means ± SEM, *P<0.05.

Supplementary Fig. 9. Tolimidone decreased c-mpl. Cell surface c-mpl levels in MkPs from chow-fed WT and Abcg4 -/- mice with or without tolimidone treatment (10 µm) for 2 h in the presence of TPO. Data are means ± SEM, *P<0.05 indicates genotype effect, ^P<0.05 indicates treatment effect. Supplementary Fig. 10. rhdl infusion decreases platelet production. (a) BM MkP cell cycle and megakaryocytes in the (b) BM and (c) spleen of vehicle or rhdl infused mice. Data are means ± SEM, *P<0.05. References 61. Wang, N., Ranalletta, M., Matsuura, F., Peng, F. & Tall, A.R. LXR-induced redistribution of ABCG1 to plasma membrane in macrophages enhances cholesterol mass efflux to HDL. Arteriosclerosis, thrombosis, and vascular biology 26, 1310-1316 (2006). 62. Yvan-Charvet, L., et al. ATP-binding cassette transporters and HDL suppress hematopoietic stem cell proliferation. Science 328, 1689-1693. 63. Koppikar, P., et al. Efficacy of the JAK2 inhibitor INCB16562 in a murine model of MPLW515L-induced thrombocytosis and myelofibrosis. Blood 115, 2919-2927 (2010). 64. Chan, V.W., Meng, F., Soriano, P., DeFranco, A.L. & Lowell, C.A. Characterization of the B lymphocyte populations in Lyn-deficient mice and the role of Lyn in signal initiation and down-regulation. Immunity 7, 69-81 (1997). 65. Murphy, A.J., et al. ApoE regulates hematopoietic stem cell proliferation, monocytosis, and monocyte accumulation in atherosclerotic lesions in mice. The Journal of clinical investigation 121, 4138-4149 (2011). 66. Tong, W., Ibarra, Y.M. & Lodish, H.F. Signals emanating from the membrane proximal region of the thrombopoietin receptor (mpl) support hematopoietic stem cell self-renewal. Exp Hematol 35, 1447-1455 (2007). 67. Bersenev, A., Wu, C., Balcerek, J. & Tong, W. Lnk controls mouse hematopoietic stem cell self-renewal and quiescence through direct interactions with JAK2. The Journal of clinical investigation 118, 2832-2844 (2008).