SALSA MLPA KIT P050-B2 CAH

SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to previous lots. CONGENITAL ADRENAL HYPERPLASIA (CAH) results from a deficiency in one of the enzymes involved in cortisol biosynthesis. CAH affects about 1 in 5,000 births, with a carrier frequency of 1 in 35. As a result of defective cortisol synthesis, ACTH levels increase, resulting in overproduction and accumulation of cortisol precursors. This causes excessive production of adrenal androgens from early fetal life, resulting in virilization. In about 95% of cases, CAH is caused by deficiency of the 21-hydroxylating enzyme encoded by the CYP21A2 (CYP21) gene on chromosome 6p21.3. Other genes near CYP21A2 include the inactive pseudogene CYP21A1P (=CYP21P), the complement C4A, C4B, TNXB (Tenascin-XB) and its pseudogene TNXA. TNXA is a small duplicated part of the TNXB gene. Interestingly, the sequences of CYP21A2, CYP21A1P, C4A and C4B are almost identical. Orientation of genes from the 6p telomere to the centromere is as follows: C4A- CYP21A1P-TNXA-C4B-CYP21A2-TNXB-ATF6B(CREBL1). CAH due to 21-hydroxylase deficiency is unusual among genetic diseases in that approximately 95% of the mutant alleles are due to the recombination between a gene (CYP21A2) and its pseudogene (CYP21A1P). Approximately 20% of mutant alleles have DNA deletions of 30 kb that have been generated by unequal meiotic crossing-over, whereas 75% are gene conversions of deleterious mutations normally present in CYP21A1P which have been transferred to CYP21A2 (White and Speiser, 2000).. The P050 CAH probemix is designed to detect large deletions and large gene conversions in the CYP21A2, C4 and TNXB genes on 6p21.3. This P050-B2 CAH probemix contains 5 probes for CYP21A2 (exons 1, 3, 4, 6 and 8); among these are the 8 bp deletion, I172N, Cluster E6 and Q318X mutation. Furthermore, this P050-B2 CAH probemix contains 3 CYP21A1P-specific probes, 3 TNXB probes, 1 C4A probe, 1 C4B probe, and 1 probe for the CREBL1 gene located q-telomeric of TNXB. In addition, 2 other probes located on chromosome 6p21.3, 1 Y-chromosome specific probe (UTY gene) and 16 reference probes are included. This SALSA MLPA kit is designed to detect deletions/duplications of one or more exons of the aforementioned genes. Heterozygous deletions of recognition sequences should give a 35-50% reduced relative peak area of the amplification product of that probe. Note that a mutation or polymorphism in the sequence detected by a probe can also cause a reduction in relative peak area, even when not located exactly on the ligation site! In addition, some probe signals are more sensitive to sample purity and small changes in experimental conditions. Therefore, deletions and duplications detected by MLPA should always be confirmed by other methods. Not all deletions and duplications detected by MLPA will be pathogenic; users should always verify the latest scientific literature when interpreting their findings. Finally, note that most defects in this gene are expected to be small mutations which will not be detected by this MLPA test. SALSA kits are sold by for research purposes and to demonstrate the possibilities of the MLPA technique. This kit is not CE/FDA certified for use in diagnostic procedures. SALSA MLPA kits are supplied with all necessary buffers and enzymes. Purchase of the SALSA MLPA test kits includes a limited license to use these products for research purposes. The use of this MLPA kit requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA technique has been first described in Nucleic Acid Research 30, e57 (2002). Related SALSA MLPA kits P155 Ehlers-Danlos syndrome III & IV: contains probes for COL3A1, TNXB More information Website : www.mlpa.com E-mail : info@mlpa.com (information & technical questions); order@mlpa.com (for orders) Mail : bv; Willem Schoutenstraat 6, 1057 DN Amsterdam, the Netherlands SALSA kit P050 CAH Page 1 of 6

P050 genes The TNXB gene spans 80 kb and has at least 43 exons. Disruption of both copies of TNXB is the cause of a recessive form of the Ehlers-Danlos syndrome (MIM 606408). Haploinsufficiency of the TNXB gene can cause the hypermobility type of Ehlers-Danlos syndrome (Zweers et al. 2003). The C4A and C4B genes both encode a functional complement protein. C4A is usually approximately 22 kb long, whereas the C4B gene is polymorphic in size, either 22 or 16 kb, due to the presence/absence of a 6 kb intron. The 2 proteins differ by only 4 amino acids. The A stands for the acidic version, the B for the basic version. About half of the rare C4A + C4B null genes are the result of DNA deletions, which can extend into the CYP21A2 gene. Null alleles of either the C4A or C4B loci are however very common, occurring in about 10 to 16% of unaffected people respectively. It has been reported that homozygous deficiency of C4A is associated with systemic lupus erythematosus and with type I diabetes mellitus; homozygous deficiency of C4B is associated with susceptibility to bacterial meningitis. The usual copy number in the white population of C4A + C4B is between 2 and 6 copies per cell. This diversity may be related to different intrinsic strengths among humans to defend themselves against infections and susceptibility to autoimmune diseases. Studies show that the frequency of the C4B null allele in young and old men is 17.6 and 3.4% respectively; suggesting the C4B null allele may be a negative factor for survival. Figure 1: A schematic representation of the chromosome 6p21.3 region. Data analysis The P050-B2 probemix contains 33 different MLPA probes with amplification products between 130 and 391 nt. In addition, it contains 9 control fragments generating an amplification product smaller than 120 nt: four DNA Quantity fragments (Q-fragments) at 64-70-76-82 nt, three DNA denaturation control fragments (Dfragments) at 88-92-96 nt, one X-fragment at 100 nt and one Y-fragment at 105 nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. Data generated by this probemix can first be normalised intra-sample by dividing the peak area of each probe s amplification product by the total area of only the reference probes in this probemix (block normalisation). Secondly, inter-sample normalisation can be achieved by dividing the intra-normalised probe ratio in a sample by the average intra-normalised probe ratio of all reference samples. Please note that this type of normalisation assumes no changes occurred in the genomic regions recognised by the reference probes. Data normalisation should be performed within one experiment. Only samples purified by the same method should be compared. Confirmation of most exons deletions and amplifications can be done by e.g. Southern blotting, long range PCR, qpcr, FISH. Note that Coffalyser, the MLPA analysis tool developed at, can be downloaded free of charge from our website www.mlpa.com. This probemix was developed by A.O.H. Nygren and J.P. Schouten at. In case the results obtained with this probemix lead to a scientific publication, it would be very much appreciated if the first probemix designer could be made a coauthor. Info/remarks/suggestions for improvement: info@mlpa.com. SALSA kit P050 CAH Page 2 of 6

Table 1. SALSA MLPA P050-B2 CAH probemix Length Chromosomal position SALSA MLPA probe (nt) Reference Other CAH 64-70-76-82 Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA 88-92-96 D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 100 X-fragment: Specific for the X chromosome 105 Y-fragment: Specific for the Y chromosome 130 Reference probe 00797-L00463 5q31 136 LTA probe 00662-L00158 6p21 142 Reference probe 04199-L03535 20q13 148 Reference probe 00594-L00011 11q13 154 ± C4B probe 02357-L02586 C4B Exon 19 160 ± Reference probe 05266-L04649 2p22 166 Reference probe 01565-L01137 22q12 172 * CYP21A2 probe 01974-L01507 Exon 3 178 C4A probe 04802-L04177 C4A Exon 26 184 Reference probe 02516-L01947 17q11 193 Reference probe 00486-L00083 11p13 202 CYP21A2 probe 04804-L04179 Exon 1 210 CYP21A2 probe 01975-L01508 Exon 4 220 Reference probe 05038-L04424 9p13 229 CYP21A2 probe 01976-L01509 Exon 6 240 UTY probe 01071-L00464 Yq11 247 Reference probe 01604-L01186 13q13 256 Reference probe 02469-L01913 15q21 265 CYP21A1P(=CYP21P) probe 04805-L04180 5 exon 1 274 Reference probe 02319-L01810 19p13 283 CYP21A2 probe 05477-L04895 Exon 8 292 TNXB probe 01982-L01515 Exon 32 300 Reference probe 01575-L01147 22q12 309 TNXB probe 03033-L02588 Exon 15 319 TNXB probe 01980-L01513 Exon 1 328 Reference probe 01918-L01462 1q21 337 ATF6B probe (CREBL1) 01979-L01512 ATF6B 346 BAK probe 01994-L00363 6p21 352 CYP21A2P(=CYP21P) probe 04807-L04182 Exon 10 364 ± Reference probe 01252-L00902 2p16 373 Reference probe 04362-L03782 7p13 382 ± CYP21A1P(=CYP21P) probe 04806-L04181 Intron 2 391 Reference probe 02184-L01682 6q26 ± The 154 nt C4B probe, 160 nt and 364 nt reference probes and 382 nt CYP21A1P probe have been reported to be more variable. * The 172 nt probe can give false deletions as a SNP exists under the first G of the target sequence (underlined and bold in the sequence in the next table). The probe could also be influenced by the 8bp deletion located in exon 3. The 178 nt probe may be less reliable. The 210 nt CYP21A2 probe has been reported to detect the mutation I172N. The 229 nt and 283 nt probes could be influenced by the exon 6 mutation cluster. The 283 nt probe is influenced by a mutation in the pseudogene (mutation Q318X; 1996C>T) which can cause false duplications. Always confirm a single exon change by another method. The signal of the 274 reference probe is higher in lot 0510 than in previous lots. SALSA kit P050 CAH Page 3 of 6

Please note The C4A-C4B region has been found to be very variable. Teisberg et al. (1988) studied RFLP patterns in the C4 gene region, determining C4 haplotype pattern and C4 gene number. Among 76 haplotypes, 12 had 1 C4 gene, 58 had 2 C4 genes, and 6 had 3 C4 genes. All probes specific to the 6p21 region (but outside the 6p21.3 region) should not be used as reference probe since larger genomic rearrangements are known to occur within this region. Exon numbering might be different as compared to literature! Please notify us of any mistakes. The identity of the genes detected by the control probes is available on request: info@mlpa.com. Table 2. 6p21.3 specific probes arranged according to chromosomal location Length (nt) SALSA MLPA probe Exon 178 04802-L04177 C4A Exon 26 265 04805-L04180 382 04806-L04181 352 04807 L04894 CYP21A1P 5 Exon 1 CYP21A1P Intron 2 CYP21A1P Exon 10 154 02357-L02586 C4B Exon 19 202 04804-L04179 172 210 229 283 01974-L01507 Wildtype of exon 3 Delta 8 bp 01975-L01508 Wildtype of I172N mutation 01976-L01509 Wildtype of exon 6 cluster 05477-L04895 Wildtype of Q318X CYP21A2, 18 nt before exon 1, reverse CYP21A2 Exon 3 CYP21A2 Exon 4 CYP21A2 Exon 6 CYP21A2 Exon 8 292 01982-L01515 TNXB Exon 32 309 03033-L02588 TNXB Exon 15 319 01980-L01513 TNXB Exon 1 337 01979-L01512 ATF6B Exon 1 Complete Probe Target Sequences CCAGGACCCCTGTCCAGTGTTAGA- CAGGAGCATGCAGGGGGGTTTGGTGGGCAAT CCCAGGTCGGGGCGGACACCC- TTGCCTGCACGGGTGATGTGGAACCAGAAAG GGAAGCTCTTGGGGGGCATATCTTC- AGGAGAAGAAGCAGGTGTTGAGGAGGCAGAAGAAGGTC GGATTAAGCCTCAATCCTCTGCGGCA- GAGGGTCAGGAAGGGAGCTCTGCGGGGAG AAGGCCCCTGCGGACCTGCG- GGGTGTTGCCCACAACAACCTCATGGCAATGGCC CTTGACCCCACCTTCAGGTACCC -TCCCACCGACCCGCCCACAGAGTGGCCCTTTTCT CCCGGACCTGTCCTTGGGAGACT- ACTCCCTGCTCTGGAAAGCCCACAAGAAGCTCACCCGC CTCTCTCCTCACCTGCAGCATCAT- CTGTTACCTCACCTTCGGAGACAAGATCAAGGTGCCTCACAG CCCC GCAGGCCATAGAGAAGAGGGATCACAT- CGTGGAGATGCAGCTGAGGCAGCACAAGGTGGGACTGTA TCCCCAGATTCAGCAGCGACTGC- AGGAGGAGCTAGACCACGAACTGGGCCCTGGTGC CGTGGCTGAGGAGACCTCCAGCTCTCT- GCGCCTGTCCTGGACGGTAGCCCAGGGCCCCTTT CAGGCCAGTTCGACTCTTTTGTGGTCCAGTT- CAAGGACAAAGACGGGCCCCAGGTGGTGCCCGT GACGCCGCCCTCCCGGGGTT- GGGGACAGAGCAGGTGCAGAGGCACTGCAGCTGCTCG CGCGTTTCTTCACCGACAACCTGCTT- AGCCCGGAGGACTGGGGTCTGCAGAGTGAGGCAC Distance to next probe Note: Exon numbering used here may differ from literature! Complete probe sequences are available on request: info@mlpa.com. Please notify us of any mistakes: info@mlpa.com. 11.2 kb 0.8 kb 2.6 kb 20.0 kb 9.5 kb 0.8 kb 0.3 kb 0.3 kb 0.3 kb 6 kb 23.9 kb 38.0 kb 18.9 kb SALSA kit P050 CAH Page 4 of 6

SALSA MLPA kit P050-B2 CAH sample pictures 65000 60000 274,02 55000 50000 45000 146,30 40000 128,36 164,66 159,27 192,45 220,25 256,35 247,70 35000 105,72 91,39 133,37 152,78 170,32 177,34 201,51 209,65 282,47 299,33 30000 25000 20000 96,43 85,94 100,88 139,99 183,93 229,31 239,31 264,32 335,87 318,45 292,98 308,50 373,89 345,11 363,31 327,60 351,18 390,93 15000 381,54 10000 Dye Signal 5000 0 100 150 200 250 300 350 400 Size (nt) Figure 2. Capillary electrophoresis pattern from a sample of approximately 50 ng human male control DNA analyzed with SALSA MLPA kit P050-B2 CAH (lot 0510). 80000 273,97 70000 60000 146,37 50000 100,93 128,41 152,85 164,73 159,31 192,50 220,24 256,30 247,65 170,38 209,67 40000 30000 85,99 91,44 96,53 133,43 140,07 177,40 183,98 201,55 229,31 264,26 299,33 282,43 318,45 292,92 308,53 335,89 351,23 363,36 373,91 327,61 345,13 20000 381,60 390,98 10000 Dye Signal 0 100 150 200 250 300 350 400 Size (nt) Figure 3. Capillary electrophoresis pattern from a sample of approximately 50 ng human female control DNA analyzed with SALSA MLPA kit P050-B2 CAH (lot 0510). SALSA kit P050 CAH Page 5 of 6

Figure 4. Top: schematic representation of the 6p21.3 region. Double-headed arrows indicate the extent of deletions identified by MLPA. Bottom: Capillary electrophoresis pattern of four DNA samples analysed with the P050 CAH kit (lot 1005). a) male reference DNA; b) male CAH patient carrying a homozygous deletion of C4B and CYP21A2; c) male CAH patient carrying a homozygous deletion spanning exon 1-6 of CYP21A2; d) female with a homozygous deletion of C4A and CYP21A1P. 1, 3, 4, 6, 8 and 10 are peaks corresponding to the respective exons of CYP21A2. P1, P2 are CYP21A1P-specific probes; T1, T2, T3 are specific to TNXB; C4A and C4B to corresponding genes. Implemented Changes compared to the previous product description version. Version 25 (46) - Product description adapted to a new lot (lot number added, small changes in Table 1 and 2, new picture included). - Small changes of probe lengths in Table 1 and 2 in order to better reflect the true lengths of the amplification products. Version 24 (43) - Altered product description to incorporate a new lot (lot number added, new picture included). - Small textual changes made on page 1. - Notes added for the 364 nt and 211 nt probes on page 3, Table 1. Version 23 - The text This SALSA MLPA kit is designed on page 1 has been modified. - Several textual changes have been made to Table 2. - The CREBL1 gene name has changed to ATF6B. - Warnings have been added for 154,160, 172,178 and 382 nt probes on page 3, Table 1. - Tables have been numbered. - Data analysis method has been modified. SALSA kit P050 CAH Page 6 of 6