Industrial production of Human Milk Oligosaccharides through industrial biotechnology Prof. Wim Soetaert
Inbiose at a glance Core competence in the development and production of specialty carbohydrates through industrial biotechnology Proprietary production platform based on fermentative synthesis of specialty carbohydrates (cell factory) Specialty carbohydrates Started in 2013 Ghent University spin-off Fast growing: >30 FTE in 2016 Access to pilot and production facilities Capacity up to 100tpa Experienced team with industrial and academic background Confidential 2
Carbohydrates are everywhere 3
Carbohydrates are everywhere glucose From the simplest form typically used as food Specialty carbohydrate To very complex structures used as an active ingredient 4
What are specialty carbohydrates? Very complex carbohydrates with unconventional structures Rare in nature or difficult to impossible to produce Price range: 10 /kg 1.000 /kg (reference sugar: 0.5 /kg) Quantities: 1 kg 10.000 tpa High-end applications in pharmaceuticals, nutraceuticals, cosmetics, chemicals, plant protection,... 5
What are specialty carbohydrates? Carbohydrates consisting of unconventional building blocks: L-Fucose Sialic acid Glucosamine Glucose Galactose Example: Human Milk Oligosaccharides
Disialyl-Lacto-N-Tetraose (dslnt) as an example of a very complex specialty carbohydrate N-acetylneuraminate HO OH HO O HN CH 3 HO OH OH HO O O HO HO O O HN HO CH 3 OH O O O HO O O OHHO O O HO NH CH 3 O OH O OH OH O O OH OH OH Lacto-N-Tetraose Lactose
Occurrence What are specialty carbohydrates? sucrose glucose fructose lactose galactose xylose chitin deoxyribose FOS N-acetylglucosamine mannose D-ribose LactoNbiose lactontetraose sialic acid L-fucose Complexity/difficulty to produce L-ribose Lewis X
Price What are specialty carbohydrates? Lewis X galactose glucose fructose lactose sucrose GOS XOS xylose L-ribose HMO L-fucose sialic acid lactontetraose lactonbiose Deoxyribose D-ribose mannose N-acetylglucosamine FOS chitosan chitin Complexity/difficulty to produce
Specialty carbohydrate production Extraction Chemical synthesis Enzymatic synthesis Microbial synthesis Natural source required, availability problems High price volatility due to natural variability Complex extraction procedures Very complex synthesis and costly substrates Low yields Use of toxic chemicals and high waste generation Simple and cheap Only for simple one-step conversions Equilibrium can be unfavourable Very complex carbohydrates produced in one step Cheap and readily available substrates Environmentally sustainable Confidential
Inbiose production platform Metabolically engineered microbes Fermentation Microbes at work Down-stream processing Specialty carbohydrate 11
Microbial synthesis of building blocks Sucrose Microbes at work Carbohydrate building blocks 12
Microbial assembly of the building blocks Assembly of the different monosaccharide building blocks into an oligosaccharide Pathway engineering 13
Biochemical pathway assembly Cloned genes with tunable elements such as promoters and ribosome binding sites Assemble in an artificial chromosome 14
Biochemical pathway assembly Transfer into the base strain Specialty carbohydrate Sucrose 15
Selection of best strain from the library carbohydrate carbohydrate carbohydrate carbohydrate carbohydrate carbohydrate carbohydrate carbohydrate 16
Strain development Technology platform for high throughput development of specialty carbohydrate production strains Enzyme engineering Analytics Fermentation technology Synthetic Biology & Automation Bioinformatics & Statistics Confidential 17
Integrated technology development bug Metabolic engineering of the production organism Process Development of the fermentation process Product Development of the product recovery process 18
Integrated technology development Bug Biochemical pathway design Expression of suitable genes in the production host Strain selection for optimal producer organism ATGGTTGCAGTAGCGATAGC GCCTTTATAAAT GCTATAGATCT GATCTTCGGAA CTGAGCTTCAA CTATGCGGCTTA TAATATTTATTCCAAA CC TTATCCTTCTCGGAGGCTCT AGGGGCCTTAAAATTCCCGA GCSSDSGLYKCRYGYRSIGFG SSESRDLSFNSEIYAAYRRLI FIPNSLSFSEALGALKFPNSM LKKIDPAQTESWKRLGRHYDG VKDLAMDDLFQQDPDRFKRLS MAFKDMVVDVSKNRITDKTLA LLMDLARETGVKEAIAMMFRG DRINETEGRSVLHVALRNLAD TPVLVDGKDVMPGVRGVLEDR Identify the optimal biosynthesis pathway in the production host Screen biosynthesis associated genes and proteins in DNA and protein databases Pathway library assembly 19
Integrated technology development Process Development of the fermentation process Optimisation of yield and production rate Scale-up of the fermentation process Titer Time 20
HMO strain & process improvement 60 50 54 g/l Final titer (g/l) 40 30 20 16 g/l 10 0 23 mg/l 182 mg/l 2,3 g/l 5,7 g/l 21
Scale-up of the fermentation process 22
Integrated technology development Product Development of down-stream processing of fermentation broth Product recovery and purification Product conditioning 23
Scale-up of the down-stream process Confidential 24
Build-up of production capacity Two new 15 m 3 fermenters are operational HMO Production capacity: 100 tonnes per year 25
Industrial biotechnology process hall
Industrial biotechnology process hall
Industrial biotechnology process hall
Industrial biotechnology process hall
Actiefoto s
Our technology in a nutshell Sucrose or glucose Cell factory HMOs 33
Integrated technology development 34
Human Milk Oligosaccharides Human mother s milk composition: Protein: 8 g/l Fat: 42 g/l Lactose: 70 g/l Human Milk Oligosaccharide: 15 g/l Galactose Fucose Glucose Inbiose s first target is 2 fucosyllactose as the most abundant HMO 35
Human Milk Oligosaccharides 1 st market Infant milk formula Prebiotics Functional foods Feed/Pet care Confidential
1953 1957 1962 1965 1968 1971 1974 1977 1980 1983 1986 1989 1992 1995 1998 2001 2004 2007 2010 2013 2016 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 HMOs are currently our main targets 120 Pubmed - human milk oligosaccharide publication count per yr HMO Applications Patent Families by Year 100 100 40 80 78 35 30 28 34 32 60 40 41 39 25 20 15 15 21 20 0 10 5 0 1 1 1 1 1 1 0 0 1 1 1 1 4 5 Confidential 37
2 FL is our first HMO Enabling Closest to breast milk Enabling Health Benefits to the infant Confidential 38
Inbiose - DuPont Partnership Licence and JDA DuPont to commercialize 2 FL and possibly 2 other fucosylated HMO s for Human Nutrition DuPont to lead up-scaling, manufacturing and sales Inbiose is supporting customers with samples until commercial launch by DuPont Parties working diligently to support customers to launch new products with HMO s Strategic and technology fit Science 50 yrs in (early life) nutrition (proteins, cultures, pre- & probiotics, hydrocolloids, enzymes) Leader in microbiome science Production Strong position in large scale fermentation, carbohydrate production and DSP Market reach Global market access and reach with local support Can supply customers with scale, supply security and good safety track record Confidential 39
In a nutshell Generic and scaleable technology platform for producing HMOs through industrial biotechnology Inbiose can produce any complex carbohydrate for which a biotechnological pathway can be designed Inbiose can quickly develop new processes through its base strains Inbiose process starts from cheap substrates and delivers high yields and productivities Inbiose can currently produce 100 tpa of HMOs 40
www.inbiose.com Turning specialty carbohydrates into an industrial reality 2016 Inbiose NV