SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry Hua Zhang 1, Yan Li 2, Hong-Bo Wang 3, Ao Zhang 1, Mei-Ling Chen 1, Zhi-Xin Fang 1, Xiao-Dong Dong 1, Shi-Bing Li 1, Yong Du 1, Dan Xiong 1, Jiang-Yi He 1, Man-Zhi Li 1, Yan-Min Liu 1, Ai-Jun Zhou 1, Qian Zhong 1, Yi-Xin Zeng 1, Elliott Kieff 4, Zhiqiang Zhang 5,6, Benjamin E. Gewurz 4, Bo Zhao 4 * and Mu-Sheng Zeng 1 * 1 Sun Yat-sen University Cancer Center; State Key Laboratory of Oncology, South China; Collaborative Innovation Center for Cancer Medicine, Guangzhou, China. 2 Department of Pathology, Sun Yat-sen University Cancer Center, Guangzhou, China. 3 Guangdong Provincial Key Laboratory of Liver Disease Research, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China. 4 Department of Medicine, Brigham and Women s Hospital, Harvard Medical School, Boston, MA, USA. 5 Immunobiology and Transplant Science Center, Houston Methodist Research Institute, Houston, TX, USA. 6 Department of Surgery, Weill Cornell Medical College of Cornell University, New York, NY, USA. Hua Zhang, Yan Li and Hong-Bo Wang contributed equally to this study. *e-mail: bzhao@bwh.harvard.edu; zengmsh@sysucc.org.cn Nature Microbiology www.nature.com/naturemicrobiology 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Ephrin receptor A2 is an epithelial cell receptor for EBV entry File name: Supplementary information Description: Supplementary Figures and Supplementary Tables
Supplementary Figure 1. Detection of the percentage of EBV-EGFP positively infected HNE1 cells by Flow cytometry. HNE1 were grown in the culture medium for 24h, followed by infection with EBV at an MOI of 1,000. EBV infection efficiency was determined as the percentage of EGFP positive cells by flow cytometry at 24h post-infection. Non-EBV infected HNE1 cells (blue line) served as negative control and the positive signal was set to 0.2%, then the positive signal of EBV infected HNE1 cells (red line) was measured and the positive signal was 6.52%.
Supplementary Figure 2. Establishment of an efficient cell-free EBV infection model for epithelial cells. HNE1, CNE1 and CNE2 cells were grown in the culture medium containing additional EGF (10ng/mL) for 24h, followed by infection with EBV at an MOI of 1,000. EBV infection efficiency was shown as the percentage of EBV-EGFP positively infected cells by flow cytometry at 24h post-infection. Results are expressed as mean ± s.e.m. from three biological replicates. **, p < 0.01; ***, p < 0.001.
Supplementary Figure 3. Confirmation of upregulated membrane genes in EGF treated HNE1 and CNE2 cells by qrt-pcr. The HNE1 and CNE2 cells were treated with or without additional EGF (10ng/mL) for 24h. The mrna expression of AREG, NT5E, EPHA2, F3, EGFL5 and DCBLD2 were examined by qrt-pcr. The results were quantified relative to the signal of ACTB and shown as fold-change of mrna abundance normalized to Vehicle treated NPECs. Results are expressed as mean ± s.e.m. from three biological replicates. ns, not significant; *, p < 0.05; **, p < 0.01; ***, p < 0.001.
Supplementary Figure 4. sirnas screen to identify potential entry factors for EBV infection in HNE1-EGF and CNE2-EGF cells. (a) Determination of knockdown efficiency of AREG, NT5E, EPHA2, F3 and DCBLD2 in HNE1-EGF and CNE2-EGF cells. HNE1-EGF and CNE2- EGF cells were transfected with sirna duplexes targeting indicated genes for 24 h, followed by qrt-pcr analysis for their respective target genes. The results were quantified relative to the signal of ACTB and shown as fold-change of mrna abundance normalized to sictrl transfected NPECs-EGF. (b) Determination of EBV infection efficiency in indicated sirna duplexes transfected HNE1-EGF and CNE2-EGF cells. Cells transfected with indicated sirna duplexes were exposed to EBV at an MOI of 1,000 for 3h. The EBV infection efficiency was analyzed by flow cytometry at 24h post-infection. The results were shown as % of EBV infection efficiency normalized to sictrl transfected NPECs-EGF. Results are expressed as mean ± s.e.m. from three biological replicates. ns, not significant; **, p < 0.01; ***, p < 0.001.
Supplementary Figure 5. The impact of downregulation of EphA2 on EBV infection in HNE1 cells. (a) HNE1 cells were transfected with sirna duplexes targeting EphA2 (siepha2) or control (sictrl) for 24h. The mrna expression was detected by qrt-pcr. The results were quantified relative to the signal of ACTB and shown as fold-change of mrna abundance normalized to sictrl transfected HNE1 cells. (b) HNE1 cells were transfected with sirna duplexes targeting EphA2 (siepha2) or control (sictrl) for 24h, followed by EBV infection at an MOI of 1,000 for 3h. The EBV infection efficiency was analyzed by flow cytometry at 24h postinfection. (c) NPEC1-Bmi1 and NPEC2-Bmi1 with sphere-like cells growing (NPECs- Bmi1/SLCs) were transfected with sirna duplexes targeting EphA2 (siepha2) or control (sictrl) for 24h. The protein expression was detected by WB. α-tubulin was used as the loading control. (d) NPEC1-Bmi1 and NPEC2-Bmi1 with sphere-like cells growing (NPECs-Bmi1/SLCs) were transfected with sirna duplexes targeting EphA2 (siepha2) or control (sictrl) for 24h, followed by EBV infection at an MOI of 1,000 for 3h. The EBV infection efficiency was analyzed by flow cytometry at 24h post-infection. The results were shown as % of EBV infection efficiency
normalized to sictrl transfected HNE1 cells. Results are expressed as mean ± s.e.m. from three biological replicates. **, p < 0.01; ***, p < 0.001.
Supplementary Figure 6. The protein expression of EphA2 in B cells. The protein expression of EphA2 in B cells (Akata, Akata-EBV and Raji) was examined by WB analysis. HNE1 cells were served as the positive control for EphA2. β-actin was used as the loading control. Shown are representative blots from three independent experiments.
Supplementary Figure 7. The affinity constant of GST-EphA2 EC and sgp350-flag. Microtitre plates were coated with 200ng soluble gp350-flag (sgp350-flag) and incubated with various concentrations of GST fused EphA2 ectodomain (GST-EphA2 EC ), followed by incubation with the rabbit anti-gst and the HRP-conjugated anti-rabbit IgG secondary antibody. The binding of GST-EphA2 EC and sgp350-flag was analyzed by ELISA. Data are representative of three independent experiments.
Supplementary Figure 8. The effect of GST-EphA2 EC on EBV infection in HNE1-EGF and CNE2-EGF cells. EBV were pre-incubated with 10 μg/ml purified GST-EphA2 EC for 1h at 4, followed by infecting HNE1-EGF and CNE2-EGF cells for 3h at 37. EBV infection efficiency was determined by flow cytometry at 24h post-infection. The results were shown as % of EBV infection efficiency normalized to GST pre-incubated NPECs-EGF. Results are expressed as mean ± s.e.m. from three biological replicates. **, p < 0.01; ***, p < 0.001.
Supplementary Figure 9. The impact of IgG or Fc on EBV infection in HNE1-EGF, CNE2- EGF and AGS cells. HNE1-EGF, CNE2-EGF or AGS cells were pre-incubated with various concentrations of IgG (0, 5, 10, or 50 μg/ml) or Fc (0, 0.25, 0.5 or 1.0 μg/ml) for 1h at 4, followed by infection with EBV in the presence of IgG or Fc for 3h at 37.EBV infection efficiency was determined by flow cytometry at 24h post-infection. Results are expressed as mean ± s.e.m. from three biological replicates. ns, not significant; *, p < 0.05.
Supplementary Figure 10. The impact of 2,5-dimethylpyrrolyl benzoic acid or EphrinA1-Fc on cell viability of HNE1-EGF and CNE2-EGF cells. HNE1-EGF and CNE2-EGF cells were incubated with various concentrations of 2,5-dimethylpyrrolyl benzoic acid (0, 20 or 40 μm) or EphrinA1-Fc (0.0, 0.8 or 1.0 μg/ml) for 1h at 37. Followed by cultured for 48h at 37. Cell viability of treated cells were determined by MTT assay. DBC, 2,5-dimethylpyrrolyl benzoic acid. Results are expressed as mean ± s.e.m. from four biological replicates. ns, not significant.
Supplementary Figure 11. Schematic showing the potential role of EphA2 in mediating EBV infection. Step 1: EBV binds to the cellular surface of epithelial cells through the interaction between EBV glycoprotein gh/gl and undefined receptor(s), NMHCIIA or integrins; Step 2: EBV recruits endocytic signaling to facilitate EBV internalization, with the assist of NRP1 and EphA2; Step 3: EBV gh/gl/gb complex interact with EphA2 and integrins to accomplish EBV-endosome membrane fusion and release EBV capsid and EBV genome into cytosol.
Supplementary Figure 12. Complete images from blots used throughout the manuscript with the corresponding molecular weight markers are shown. Cropped areas in every blot are marked and the antibody used in each case is named.
Supplementary Figure 12 (continued). Complete images from blots used throughout the manuscript with the corresponding molecular weight markers are shown. Cropped areas in every blot are marked and the antibody used in each case is named.
Supplementary Table 1 Primer sequences for qrt-pcr Symbol Sense (5-3 ) Antisense (5-3 ) AREG GCACCTGGAAGCAGTAACA CACAGCAGACATAAAGGCAG NT5E GTATCCGGTCGCCCATTGAT AAAGGCCTTCTTCAGGGTGG EPHA2 CCCGATGAGATCACCGTCAG GGCACCGATATCCTGGAAGG F3 GCTTTTACACAACAGACACA TTGTCTCCAGGTAAGGTGTG EGFL5 GCTGACCCCTTTGCCTAACT TGGCCAAATACGCAAAGCAC DCBLD2 TGTCAAACACGTTGGGCG TGAGGATCCGCGATCACAC ACTB GTGAAGGTGACAGCAGTCGGT AAGTGGGGTGGCTTTTAGGA EBV BamHI CCCAACACTCCACCACACC TCTTAGGAGCTGTCCGAGGG GAPDH-DNA CCCCACACACATGCACTTACC CCTAGTCCCAGGGCTTTGATT