Originl Article Inhiition of diethylnitrosmine-initited lcohol-promoted heptic inflmmtion nd precncerous lesions y flvonoid luteolin is ssocited with incresed sirtuin ctivity in mice Brun Pol Murino Rfcho,2, Cmill Pech Stice, Chun Liu, Andrew S. Greenerg 3, Lynne M. Ausmn,4, Xing-Dong Wng,4 Nutrition nd Cncer Biology Lortory, Jen Myer USDA Humn Nutrition Reserch Center on Aging (HNRCA) t Tufts University, Boston, MA, USA; 2 Deprtment of Internl Medicine, Botuctu School of Medicine, São Pulo Stte University (UNESP), Botuctu, São Pulo, Brzil; 3 Oesity nd Metolism Lortory, Jen Myer USDA Humn Nutrition Reserch Center on Aging (HNRCA) t Tufts University, Boston, MA, USA; 4 Friedmn School of Nutrition Science nd Policy, Tufts University, Boston, MA 2, USA Correspondence to: Xing-Dong Wng, MD, PhD. Nutrition nd Cncer Biology Lortory, Jen Myer USDA Humn Nutrition Reserch Center on Aging t Tufts University, 7 Wshington Street, Room 54, Boston, MA 2, USA. Emil: xing-dong.wng@tufts.edu. Bckground: Chronic nd excessive lcohol consumption is n estlished risk for heptic inflmmtion nd crcinogenesis. Luteolin is one of the most common flvonoids present in plnts nd hs potentil eneficil effects ginst cncer. In this study, we exmined the effect nd potentil mechnisms of luteolin supplementtion in crcinogen initited lcohol-promoted pre-neoplstic liver lesion mouse model. Methods: C57BL/6 mice were injected with diethylnitrosmine (DEN) [i.p. 25 mg/kg of ody weight (BW)] t 4 dys of ge. At 8 weeks of ge mice were group pir-fed with Lieer-DeCrli liquid control diet or lcoholic diet [ethnol (EtOH) diet, 27% totl energy from ethnol] nd supplemented with dose of 3 mg luteolin/kg BW per dy for 2 dys. Results: DEN-injected mice fed EtOH diet displyed significnt induction of pre-neoplstic lesions, mrker ssocited with presence of stetosis nd inflmmtion. Dietry luteolin significntly reduced the severity nd incidence of heptic inflmmtory foci nd stetosis in DEN-injected mice fed EtOH diet, s well the presence of preneoplstic lesions. There ws no difference on heptic protein levels of sirtuin (SIRT) mong ll groups; however, luteolin supplementtion significntly reversed lcohol-reduced SIRT ctivity ssessed y the rtio of cetylted nd totl forkhed ox protein O (FoXO) nd SIRT trget prolifertorctivted receptor gmm, coctivtor lph (PGCα). Conclusions: Dietry intke of luteolin prevents lcohol promoted pre-neoplstic lesions, potentilly medited y SIRT signling pthwy. Keywords: Luteolin; diethylnitrosmine (DEN); liver cncer; inflmmtion; sirtuin (SIRT) Sumitted Aug 2, 24. Accepted for puliction Sep 2, 24. doi:.3978/j.issn.234-388.24.8.6 View this rticle t: http://dx.doi.org/.3978/j.issn.234-388.24.8.6 Introduction Liver cncer is the third leding ftl cncer in the world (). Chronic nd excessive lcohol consumption is mjor risk fctor for liver cncer in the United Sttes nd it hs een estimted tht 32-45% of ll cses re due to lcohol use (2). Alcohol redily diffuses cross memrnes nd distriutes through ll cells nd intercts with proteins nd cell memrnes (3), disrupts ftty cid oxidtion, therey contriuting to stetosis onset nd liver injury (4). We nd others hve shown tht lcohol hs promoter ction on the development of chemiclly induced heptic cncer (2,5,6). Although the moleculr mechnisms of lcohol induced crcinogenesis re not fully understood, incresing evidence suggests link etween lcohol metolism nd cncer HeptoBiliry Surgery nd Nutrition. All rights reserved. www.thehsn.org HeptoBiliry Surg Nutr 25;4(2):24-34
HeptoBiliry Surgery nd Nutrition, Vol 4, No 2 April 25 25 (7-). Alcohol metolism involves the enzymes ldehyde dehydrogense (ALDH), lcohol dehydrogense (ADH), cytochrome P452E (CYP2E), nd ctlse, generting cetldehyde nd rective oxygen species (ROS) (3). Acetldehyde dducts nd ROS cn ctivte the dptive immune response nd the production of proinflmmtory cytokines (4,,2), leding to inflmmtion of the liver (7,3). Indeed, cellulr nd moleculr normlities due to inflmmtory condition might represent n erly step of heptocrcinogenesis nd is considered key fctor in the development of cncer (,4). Sirtuin (SIRT), the mmmlin ortholog of yest sirtuin silent informtion regultor 2, is conserved NAD + - dependent protein decetylse expressed in vrious tissues including the liver (5). It hs een implicted in vrious iologicl processes, nd its expression nd ctivity in the liver cn e ltered y lcohol intke (6,7). SIRT ctivtion hs een descried s protective fctor in mny diseses (8-2), including high ft diet promoted heptocrcinogenesis (5,2). Despite this evidence, the role of SIRT nd liver cncer is controversil, reported oth s tumor promoter nd s tumor suppressor protein (22-24). SIRT hs lso een trget for dietry intervention in mny models, including liver injury (23), ddressing questions to whether dietry compounds cn modulte SIRT expression nd/or ctivity nd exhiit nticrcinogenic effects. Epidemiologicl studies hve shown tht diet rich in plnt-derived foods is consistently ssocited with reduced risk of developing chronic diseses, supporting recommendtions to increse the consumption of plntderived foods (25,26). Although it is not cler which compounds in plnt foods re responsile for this preventive effect, evidence suggests tht flvonoids my prticipte in this ctivity (26,27). Luteolin is one of the most common flvonoids present in edile plnts, with celery, prsley, roccoli, peppers, cges, nd herl spices s the min food sources of luteolin (28). It hs een shown tht luteolin exhiits nti-inflmmtory nd nticncer properties y inhiiting pro inflmmtory cytokines, inducing poptosis nd preventing DNA dmge nd crcinogen metolic ctivtion (25,29-3), ut most of the studies were conducted in vitro. One previous study descried nticrcinogenic potentil of luteolin ginst heptocellulr crcinom in rts (32). So fr to our knowledge, there is no in vivo study ddressing whether luteolin protection ginst lcohol induced heptic crcinogenesis. The present study investigted dietry intervention with luteolin t 3 mg/kg of ody weight for 2 dys in DEN-initited ethnol-promoted heptic crcinogenesis in mice. The presence of stetosis, inflmmtion, nd preneoplstic lesions nd the involvement of SIRT pthwy nd CYP2E in this model were exmined. Methods Study design The experimentl protocol ws dpted from wellestlished niml model to study liver crcinogenesis (6,33-35). All niml protocols were pproved y the Institutionl Animl Cre nd Use Committee t the Jen Myer-USDA Humn Nutrition Reserch Center on Aging t Tufts University. Mle C57BL6 mice were distriuted into four groups y weight-mtching, ccording to diet nd tretment. Diethylnitrosmine (DEN, Sigm Aldrich, St. Louis, MO; i.p. 25 mg/kg of BW) ws injected into two DEN treted groups t 2 weeks of ge. After n dpttion period, ll mice were group pir-fed with Lieer-DeCrli (Dyets Inc., Bethlehem, PA, USA) liquid control diet or lcoholic diet (EtOH diet, 27% totl energy from ethnol) nd supplemented with dose of 3 mg luteolin/kg BW per dyfor tretment period of 2 dys. In the control diet, ethnol ws replced y n isocloric mount of mltodextrin (Purin Test diets, Richmond, IN, USA). Therefore, the niml groups were: (I) control group (no DEN injection or ethnol feeding; (II) control + DEN (DEN injected, no ethnol feeding); (III) DEN + EtOH (DEN injected nd ethnol feeding); (IV) DEN + EtOH + L (DEN injected nd ethnol feeding + luteolin tretment). After the tretment period, ll mice were terminlly exsnguinted under nesthesi nd liver tissue ws collected nd frozen for nlysis. The study design is presented in Figure. Luteolin supplementtion Luteolin commercil compound ws purchsed from Sigm Aldrich (St. Louis, MO, USA), nd ws incorported directly into the diet to chieve homogenous diet mixture. The rtionle for luteolin dose of 3 mg/kg of ody weight ws sed on previous studies reporting n nti-crcinogenic ction of luteolin (36,37), dily humn intke of luteolin, nd dt out luteolin sorption in rodents nd humns HeptoBiliry Surgery nd Nutrition. All rights reserved. www.thehsn.org HeptoBiliry Surg Nutr 25;4(2):24-34
26 Rfcho et l. Luteolin inhiits lcohol ssocited liver injury Figure Study design. DEN, diethylnitrosmine; BW, ody weight; EtOH, ethnol. tht demonstrted tht luteolin hs similr phrmcokinetics in the two species (38,39). Luteolin intke in the Americn popultion is reltively low, vrying from. to 8.88 mg/d, with n verge of. mg/d (27,4,4). Using n estlished eqution to clculte the dosge equivlence for humn consumption (42,43), the dose of 3 mg/kg of ody weight in mice is equivlent to.8 mg/kg of ody weight for humns, mening dose within the physiologic rnge. Histopthologicl evlution 5 μm sections of formlin-fixed, prffin-emedded liver tissue were stined with H&E. Liver histopthology ws grded ccording to stetosis mgnitude (oth mcro- nd micro-vesiculr ft ccumultion), nd the degree of liver inflmmtion severity s descried previously (5,44). Briefly, the degree of stetosis ws grded -4 (grding 5%, =5-25%, 2=26-5%, 3=5-75%, 4>75%), sed on the verge percent of ft-ccumulted heptocytes per field t mgnifiction under H&E stining in 2 rndom fields. Inflmmtory foci which minly constitute mononucler inflmmtory cells were evluted y the numer of inflmmtory-cell clusters in 2 rndom fields t mgnifiction, s reported s numer of inflmmtory foci per cm 2. Preneoplstic lesions were evluted nd presented y the incidence nd numer of sophilic nd eosinophilic foci per cm 2 in 2 rndom fields t mgnifiction (45). Protein isoltion nd western lotting Liver sections were lysed in cold whole cell lysis uffer (25 mm Hepes t Ph =7.5, 3 mm NCl,.5 mm MgCl 2, mm EDTA, % glycerol, % Triton X-) contining protese inhiitors. The lystes were centrifuged t 5, g for min t 4, nd the superntnt used. The protein concentrtion of the superntnt ws mesured y the Coomssie Plus protein quntifiction method (Thermo Fisher Scientific, USA). For western lotting nlysis, equl mounts of protein (5 µg) of ech smple were oiled in reducing Lemmli smple uffer nd resolved y 8-% SDS-PAGE. Proteins were then trnsferred onto Immoilon-P memrnes (Millipore Corportion, MA, USA) locked with 5% non-ft milk in TBST uffer, nd incuted with selected primry ntiody: cetylted-foxo, forkhed ox protein O (FoxO), SIRT, prolifertor-ctivted receptor gmm, coctivtor lph (PGCα) (Snt Cruz, TX, USA), NFκB, phosphorylted NF-κB nd CYP2E (Cell signling, MA, USA), nd respective second ntiodies (Snt Cruz, TX, USA). Proteins were detected y horserdish peroxidse-conjugted secondry ntiody (Bio-Rd, CA, USA). The specific nds were visulized y Super Signl West Pico Chemiluminescent Sustrte Kit (Pierce, IL, USA) ccording to the mnufcturer s instructions. glycerldehyde-3-phosphte dehydrogense (GAPDH) ntiody ws used s internl control. Intensities of protein nds were quntified using GS-7 Clirted Imging Densitometer (Bio-Rd, CA, USA). RNA extrction nd quntittive rel-time PCR (qrt-pcr) Totl RNA ws extrcted from frozen liver sections with Trizol regent (Invitrogen, NY, USA), s previously descried (5). cdna ws prepred from the RNA smples using M-MLV reverse trnscriptse (Invitrogen, NY, USA) nd n utomted therml cycler PTC-2 HeptoBiliry Surgery nd Nutrition. All rights reserved. www.thehsn.org HeptoBiliry Surg Nutr 25;4(2):24-34
HeptoBiliry Surgery nd Nutrition, Vol 4, No 2 April 25 27 Tle Body weight, liver weight, nd liver weight nd finl ody weight rtio Groups DEN + DEN + EtOH DEN + EtOH + L Numer of nimls 4 3 Initil ody weight (g) 2.5±.5 2.6±.6 2.3±.3 2.7±.3 Finl ody weight (g) 28.6±.8 27.4±.9 23.8±.2 23.7±.4 Liver weight (g).9±.6.36±.6,.42±.2.47±.3 LW/FBW 2 4.±. 4.9±.4 5.9±.4 c 6.2±.5 c, ll dt re expressed s men ± SD; 2, rtio etween liver weight (LW) nd finl ody weight (FBW).,,c, different letters represent significnt difference (P<.5) etween groups. DEN, diethylnitrosmine; EtOH, ethnol; L, luteolin. (MJ Reserch, USA). qrt-pcr ws performed using FstStrt Universl SYBR Green Mster (ROX) (Roche, USA). Reltive gene expression ws determined using the 2- CT method. The sequences for TNFα, IL-6 nd IL-β were: tumor necrosis fctor lph (Tnf-α) forwrd-caaaccaccaagtggaggag, reverse- CGGACTCCGCAAAGTCTAAG; IL-6 forwrd- GGATACCACTCCCAACAGACCT, reverse- GCCATTGCACAACTCTTTTCTC; IL-β forwrd- AGCCAAGCTTCCTTGTGCAAGTGT, reverse- GCAGCCCTTCATCTTTTGGGGTCC. GAPDH ws used s internl control, nd the sequences were: forwrd 5'-ATCACCATCTTCCAGGAGCGA-3' nd reverse 5'-AGCCTTCTCCATGGTGGTGAA-3'. Heptic NAD/NADH rtio evlution Quntifiction of oxidized nicotinmide denine dinucleotide (NAD) nd reduced nicotinmide denine dinucleotide (NADH) in the liver ws crried out using NAD/NADH ssy kit from BioVision (Milpits, CA, USA), ccording to the mnufcturer s instructions. Briefly, livers were snp frozen in liquid nitrogen nd extrcted t 4 with extrction uffer provided with the NAD/NADH ssy kit. NAD nd NADH vlues were normlized y protein concentrtion. Sttisticl nlysis Grph Pd Prism (Grph Pd Softwre, CA, USA) ws used to perform the sttisticl nlysis, nd resulting vlues were expressed s men ± SEM or men ± SD, s indicted in the footnotes. Group mens were compred using one-wy ANOVA nlysis with djustments for multiple comprisons. P vlue ws set t.5 for the comprisons to rech sttisticl significnce. Different letters indicte significnt differences etween groups. Results Luteolin inhiited stetosis nd DEN-initited ethnol promoted heptic crcinogenesis Ethnol fed groups hd significntly lower finl ody weight nd significntly higher liver weight in comprison to nd + DEN groups (Tle ). Luteolin hd no significnt effect on finl ody weight or liver weight when compring DEN + EtOH nd DEN + EtOH + L groups (Tle ). Regrding pthology dt, ll mice in DEN + EtOH group developed stetosis (62% in grde nd 39% in grde 2, Figure 2). Luteolin inhiited stetosis in DEN + EtOH + L group, in which 2% of mice presented stetosis in grde 2, 7% with grde nd % hd no stetosis (Figure 2). In DEN injection group without ethnol feeding, one niml presented stetosis in grde (DEN +, Figure 2) nd stetosis ws not detected in the group. Similrly, preneoplstic foci, mrkers of precncerous lesions, were not oserved in the sence of ethnol in DEN-injection group (DEN +, Figure 3A). DEN + EtOH group showed incidence of 54% of preneoplstic foci (Figure 3A). Preneoplstic foci were not detected fter luteolin supplementtion (DEN + EtOH + L group nd in nd DEN + groups (Figure 3A). Luteolin reduces heptic inflmmtion in DEN-initited EtOH-promoted heptic crcinogenesis DEN + EtOH group hd significntly greter numer of inflmmtory foci s compred to nd DEN + groups (y pproximtely 5 fold, Figure 3B). Luteolin supplementtion significntly reduced y 5% the numer of heptic inflmmtory foci in comprison to DEN + EtOH group (Figure 3B). Regrding inflmmtory HeptoBiliry Surgery nd Nutrition. All rights reserved. www.thehsn.org HeptoBiliry Surg Nutr 25;4(2):24-34
28 Rfcho et l. Luteolin inhiits lcohol ssocited liver injury A Norml liver Stetosis A # Inflmmtory foci/cm 2 6 5 4 3 2 Inflmmtory foci c B Incidence of stetosis (%) C Distriution of stetosis (n) 2 8 6 4 2 % 8% 6% 4% 2% % DEN+ 93 Stetosis grde Stetosis grde Stetosis grde 2 Stetosis grde 3 cytokines, no chnges in Tnf-α nd Il-6 mrna expression were detected etween ll groups. mrna expression of Il- β ws significntly higher in DEN + group in comprison to group. DEN + EtOH + L group presented significntly lower Il-β mrna expression s compred to DEN + group, s shown in Figure 4. Western lot nlysis ws conducted to evlute totl NF-κB protein expression, ut no differences were oserved mong the groups (dt not shown). 62 38 2 7 DEN+ Figure 2 (A) Representtive histopthology figure of stetosis oserved in DEN + EtOH group; (B) incidence of stetosis etween groups. Dt represented in percentge; (C) stetosis grde distriution etween groups determined y histopthology of liver. Dt re expressed in percentge. DEN, diethylnitrosmine; EtOH, ethnol; L, luteolin.,, different letters represent significnt difference (P<.5). 7 B Incidence of preneoplstic lesion (%) 6 5 4 3 2 DEN+ Bsophilic foci DEN+ Figure 3 (A) Numer of inflmmtory foci in the liver with representtive histopthology figure of inflmmtory foci; (B) incidence of preneoplstic lesions in the liver with representtive histopthology figure of sophilic foci, mrker of preneoplstic lesion. Dt re expressed s men ± SEM. DEN, diethylnitrosmine; EtOH, ethnol; L, luteolin.,,c, different letters represent significnt difference (P<.5). Reduction in DEN-initited EtOH-promoted heptic crcinogenesis y luteolin ws ssocited with restored SIRT ctivity nd incresed PGCα protein expression Western lot nlyses were conducted to evlute SIRT protein expression nd ctivity in the liver, s well s its downstrem trget PGCα. To evlute SIRT ctivity, the cetyltion of FoxO ws determined. No difference in SIRT protein expression ws oserved mong the groups (Figure 5A). DEN-EtOH group showed decresed SIRT decetylse ctivity (Figure 5B) in comprison to group, s represented y the incresed cetylted FoxO rtio, nd diminished PGCα protein expression (Figure 5C). Luteolin supplementtion significntly incresed SIRT decetylse ctivity nd PGCα protein expression in DEN + EtOH + L group s compred to DEN + EtOH group (Figure 5B,C). No chnges in NAD + /NADH rtio in the liver were oserved mong ll groups (dt not shown). CYP2E protein expression ws significntly incresed in the liver of oth ethnol fed groups (DEN + EtOH nd HeptoBiliry Surgery nd Nutrition. All rights reserved. www.thehsn.org HeptoBiliry Surg Nutr 25;4(2):24-34
HeptoBiliry Surgery nd Nutrition, Vol 4, No 2 April 25 29 A IL-6 reltive gene exprseeion (reltive to GAPDH).6.4.2.8.6.4.2 DEN+ A SIRT protein fold chnge.8.6.4 SIRT GAPDH DEN+.2 B IL-β reltive gene expression (reltive to GAPDH) 2.5.5 DEN+ c c B 6 DEN+ DEN+ AC FOXO TOTAL FOXO C Tnf-α reltive gene expression (reltive to GAPDH).8.6.4.2.8.6.4.2 DEN+ Foxo cetyltion fold chnge C 4 2 PGCα GAPDH DEN+ DEN+ Figure 4 Gene expression of inflmmtory cytokines reltive to glycerldehyde-3-phosphte dehydrogense (GAPDH) in the liver. mrna from liver tissue (n=-2 per group) were nlyzed y rel-time PCR nd GAPDH ws used s loding control. (A) Reltive gene expression of IL-6; (B) reltive gene expression of IL-β; (C) reltive gene expression of TNF-α. Dt shown re men ± SEM. DEN, diethylnitrosmine; EtOH, ethnol; L, luteolin.,,c, different letters represent significnt difference (P<.5). DEN + EtOH + L) in comprison with nd DEN + groups, nd luteolin did not ffect its expression (dt not shown). Discussion In the present study, ethnol tretment cused significnt increse in preneoplstic lesions ssocited with stetosis nd inflmmtory foci fter 9 weeks of exposure in DENinitited mice. The sence of preneoplstic lesions in the mice given the sme dose of the DEN crcinogen lone suggests the promoting effect of lcohol intke on heptic crcinogenesis in this model. This notion ws supported y our previous study in rt model (35). Furthermore, the significntly decresed finl ody weight PGCα Protein fold chnge.6.2.8.4 DEN+ Figure 5 Protein expression in liver lystes nlyzed y western lotting (n=-2 per group) with representtive western lots with smple per group in order:, DEN +, DEN + EtOH nd DEN + EtOH + L in: (A) grphicl representtion of fold chnges in sirtuin (SIRT); (B) grphicl representtion of fold chnges in FoxO cetyltion (totl FoxO s loding control), representing SIRT ctivity; (C) grphicl representtion of fold chnges in prolifertor-ctivted receptor gmm, coctivtor lph (PGCα). GAPDH ws used s loding control unless specified otherwise. Dt shown re men ± SEM. DEN, diethylnitrosmine; EtOH, ethnol; L, luteolin.,, different letters represent significnt difference (P<.5). nd significntly incresed liver weight found in DEN initited ethnol fed groups provided evidence of the deleterious effect of lcohol intke in growth nd liver function in this model. To our knowledge this is the first report showing tht tretment with luteolin significntly inhiited DEN- HeptoBiliry Surgery nd Nutrition. All rights reserved. www.thehsn.org HeptoBiliry Surg Nutr 25;4(2):24-34
3 Rfcho et l. Luteolin inhiits lcohol ssocited liver injury initited lcohol-promoted liver pre-cncerous lesions ssocited with inhiition of stetosis nd inflmmtory foci in mice. Besides the promotion of crcinogenesis, the effects of long-term lcohol intke include numer of iochemicl nd moleculr ltertions nd pthologicl lesions such s stetosis (4,35). The nti-stetosis effect of luteolin reported in the present study is supported y previous reports showing tht luteolin nd her extrcts contining luteolin cn inhiit lipid ccumultion in the liver (46,47). Our findings lso complement previous studies with cell lines nd different murine models showing tht luteolin hs nti-cncer (29,32,48-5) nd nti-inflmmtory properties (29,5,52). It is lso importnt to note tht the protective effect of luteolin ws not ssocited with chnges in the ody weight of mice, suggesting miniml toxicity of luteolin intke. It is well known tht crcinogenesis is process tht involves the trnsition of norml cell into preneoplstic lesion tht might develop into mlignnt tumor, ut the precise mechnism of lcohol-ssocited crcinogenesis is not fully understood. In our findings, the presence of preneoplstic lesions in DEN + EtOH group ws ssocited with significnt increse in the numer of inflmmtory foci nd IL-β, suggesting the role of inflmmtion in the progression of cncer in this model (). To support this concept, heptic inflmmtory foci hve een shown to hve good correltion with crcinogenicity (45,53). Luteolin tretment inhiited inflmmtory foci nd reduced gene expression of IL-β nd IL-6 in comprison to DEN + EtOH group. TNF-α expression ws not incresed in DEN + EtOH group, ut it is importnt to note tht luteolin restored its gene expression to levels similr to the control group. Therefore, the nti-inflmmtory properties of luteolin could e relted to the nti-crcinogenic effect oserved in this work. This notion is supported y Lin et l. (28) tht postulted tht the nti-crcinogenic potentil of luteolin is relted to reduced TNFα nd IL- y inhiition of NF-κB signling. In this study, we did not detect chnges in NF-κB protein expression nd the effect found in inflmmtory cytokine expression, such s TNFα ws mrginl. This could e due to the use of homogentes of heptic tissue with vrying sites of lesions tht might mke the differences difficult to detect. In order to explore the mechnisms y which luteolin prevents lcohol induced liver injury, we evluted the SIRTprotein expression nd decetylse ctivity. In the present study, DEN-EtOH group presented n increse in FoxO cetyltion nd decrese in SIRT downstrem trget PGCα protein expression, suggesting decresed SIRT decetylse ctivity. This finding is supported y previous work of our lortory showing tht lcohol intke impirs the function of SIRT (6). Interestingly, the protective effect of luteolin ws ccompnied y induction of SIRT ctivity, demonstrted y decresed cetyltion of FoxO nd incresed PGCα protein expression. Decresed SIRT ctivity hs een linked to chronic inflmmtion, nd it ws previously reported in liver cncer (54). SIRT regultes mny cellulr processes through decetylting FoxO fmily trnscriptor fctors, such s FoxO (55). Decresed SIRT decetyltion leds to incresed FoxO expression, enhncing inflmmtion y ffecting the trnscription of pro-inflmmtory genes like TNFα nd IL-6 (54). Our results re in ccordnce with these oservtions, since DEN + EtOH group showed incresed cetylted FoxO in ssocition with inflmmtory response. Luteolin seems to inhiit inflmmtion through SIRT ctivtion, since the FoxO cetyltion nd inflmmtory foci were decresed in luteolin treted mice. No previous studies hve een found out luteolin nd sirtuins, ut similr results re descried for resvertrol, flvonoid considered SIRT ctivtor, with nti-inflmmtory nd nti-crcinogenic ction (56-59). PGC-α is the mster regultor of mitochondril iogenesis nd function (6,6). SIRT decetyltes PGC-, enhncing PGCα ctivity (6,62). In the present study, decresed SIRT ctivity oserved in the DEN + EtOH group ws ccompnied y decresed PGCα protein expression. This oservtion is supported y previous reports showing tht overexpression of SIRT in livers of mice significntly increses the expression of genes tht re under the control of PGC-α, wheres SIRT knockdown ttenuted this effect (63). Deletion of SIRT cn lter ftty cid metolism in the liver nd PGCα cn ctivte the oxidtive metolism y incresing mitochondril iogenesis nd incresing ftty cid oxidtion (6,63-65). In the present study, the diminished SIRT-PGCα signling could e ssocited to the incresed stetosis found fter ethnol feeding in DEN initited mice. Decresed PGCα expression hs lso een reported in vriety of cncers, nd PGCα seems to regulte crosstlk etween energy metolism nd inflmmtion (66). Some reports suggest tht overexpression of PGCα cn suppress the secretion of pro inflmmtory cytokines (65,67). The incresed SIRT ctivity induced y luteolin could ctivte PGCα, reduce stetosis nd inflmmtion cused y DEN nd ethnol, thus contriuting HeptoBiliry Surgery nd Nutrition. All rights reserved. www.thehsn.org HeptoBiliry Surg Nutr 25;4(2):24-34
HeptoBiliry Surgery nd Nutrition, Vol 4, No 2 April 25 3 to the nti-tumorigenic ction found in this study. Similrly, Wng nd collegues descried tht ctivtion of SIRT y resvertrol tretment reduced tumorigenesis in mice, ssocited with incresed levels of PGCα (68). In order to investigte how luteolin cn ffect SIRT ctivity, we evluted NAD + /NADH rtio in the liver. SIRT function is tightly regulted y NAD + vilility (54), nd this vilility cn e reduced y lcohol oxidtion (3,69). However, the decresed SIRT ctivity found in our study seems to e medited y different mechnism, since no differences on NAD + /NADH rtio ws oserved etween ll groups. Since CYP2E is n importnt pthwy of ethnol metolism, nd its induction y chronic lcohol intke results in n enhnced ctivtion of procrcinogens to crcinogens nd relese of inflmmtory meditors (7), we evluted the role of CYP2E expression in the present study. DEN initited ethnol fed mice showed significntly incresed protein expression of the enzyme s compred to control diet groups, ut luteolin did not reverse CYP2E expression. These dt support our notion tht the potentil protective effect of luteolin is relted to SIRT signling. Conclusions This study demonstrted tht luteolin prevents lcohol promoted heptic crcinogenesis potentilly medited y SIRT signling pthwy. Our findings support the potentil use of dietry mens for preventing lcohol induced liver lesions nd open new venue for reserch on interction etween luteolin nd SIRT. Acknowledgements The uthors would like to thnk Dr. Donld Smith for his ssistnce in niml study nd Ms. Junrui Cheng for her ssistnce on this mnuscript. Funding: This study ws supported y US Deprtment of Agriculture grnt 95-5-74S nd the NIH/NCI CA76256 grnt. Any opinions, findings, conclusions, nd recommendtions expressed in this puliction re those of the uthor(s) nd do not necessrily reflect the views of the sponsors. Brun Pol Murino Rfcho received Reserch Internships Arod (BEPE) fellowship from So Pulo Reserch Foundtion (FAPESP, Process numer: FAPESP 22/23759-). Disclosure: The uthors declre no conflict of interest. Ethicl Sttement: All niml protocols were pproved y the Institutionl Animl Cre nd Use Committee t the Jen Myer-USDA Humn Nutrition Reserch Center on Aging t Tufts University. References. Tin H, Ge C, Li H, et l. Rionucleotide reductse M2B inhiits cell migrtion nd spreding y erly growth response protein -medited phosphtse nd tensin homolog/akt pthwy in heptocellulr crcinom. Heptology 24;59:459-7. 2. Ye Q, Lin F, Chvez PR, et l. Cytochrome P45 2E inhiition prevents heptic crcinogenesis induced y diethylnitrosmine in lcohol-fed rts. Heptoiliry Surg Nutr 22;:5-8. 3. Zkhri S. Overview: how is lcohol metolized y the ody? Alcohol Res Helth 26;29:245-54. 4. Ormn ES, Oden G, Btller R. Alcoholic liver disese: pthogenesis, mngement, nd novel trgets for therpy. J Gstroenterol Heptol 23;28 Suppl :77-84. 5. Tkd A, Mtsud Y, Tkse S. Effects of dietry ft on lcohol-pyrzole heptitis in rts: the pthogenetic role of the nonlcohol dehydrogense pthwy in lcohol-induced heptic cell injury. Alcohol Clin Exp Res 986;:43-. 6. Brndon-Wrner E, Wlling TL, Schrum LW, et l. Chronic ethnol feeding ccelertes heptocellulr crcinom progression in sex-dependent mnner in mouse model of heptocrcinogenesis. Alcohol Clin Exp Res 22;36:64-53. 7. Seitz HK, Stickel F. Moleculr mechnisms of lcoholmedited crcinogenesis. Nt Rev Cncer 27;7:599-62. 8. Homnn N, Seitz HK, Wng XD, et l. Mechnisms in lcohol-ssocited crcinogenesis. Alcohol Clin Exp Res 25;29:37-2. 9. Kew MC. The role of cirrhosis in the etiology of heptocellulr crcinom. J Gstrointest Cncer 24;45:2-2.. Purohit V, Rpk R, Kwon OS, et l. Roles of lcohol nd tocco exposure in the development of heptocellulr crcinom. Life Sci 23;92:3-9.. Arvlli RN. Role of innte immunity in the development of heptocellulr crcinom. World J Gstroenterol 23;9:75-4. 2. Drexler SK, Yzdi AS. Complex roles of inflmmsomes in crcinogenesis. Cncer J 23;9:468-72. 3. Seitz HK, Wng XD. The role of cytochrome P45 2E in ethnol-medited crcinogenesis. Sucell Biochem HeptoBiliry Surgery nd Nutrition. All rights reserved. www.thehsn.org HeptoBiliry Surg Nutr 25;4(2):24-34
32 Rfcho et l. Luteolin inhiits lcohol ssocited liver injury 23;67:3-43. 4. Bricu C, Burz C, Berindn-Negoe I, et l. Heptocellulr Crcinom: Tumorigenesis nd Prediction Mrkers. Gstroenterology Res 29;2:9-9. 5. Ip BC, Hu KQ, Liu C, et l. Lycopene metolite, po-'-lycopenoic cid, inhiits diethylnitrosmineinitited, high ft diet-promoted heptic inflmmtion nd tumorigenesis in mice. Cncer Prev Res (Phil) 23;6:34-6. 6. Nscimento AF, Ip BC, Luvizotto RA, et l. Aggrvtion of nonlcoholic stetoheptitis y moderte lcohol consumption is ssocited with decresed SIRT ctivity in rts. Heptoiliry Surg Nutr 23;2:252-9. 7. Wng Y, Seitz HK, Wng XD. Moderte lcohol consumption ggrvtes high-ft diet induced stetoheptitis in rts. Alcohol Clin Exp Res 2;34:567-73. 8. Kume S, Hned M, Knski K, et l. Silent informtion regultor 2 (SIRT) ttenutes oxidtive stress-induced mesngil cell poptosis vi p53 decetyltion. Free Rdic Biol Med 26;4:275-82. 9. Li Y, Xu S, Giles A, et l. Heptic overexpression of SIRT in mice ttenutes endoplsmic reticulum stress nd insulin resistnce in the liver. FASEB J 2;25:664-79. 2. Zhng C, Feng Y, Qu S, et l. Resvertrol ttenutes doxoruicin-induced crdiomyocyte poptosis in mice through SIRT-medited decetyltion of p53. Crdiovsc Res 2;9:538-45. 2. Herrnz AS, Gonzlo-Goerndo R, Reimers D, et l. Applictions of humn umilicl cord lood cells in centrl nervous system regenertion. Curr Stem Cell Res Ther 2;5:7-22. 22. Portmnn S, Fhrner R, Lechleiter A, et l. Antitumor effect of SIRT inhiition in humn HCC tumor models in vitro nd in vivo. Mol Cncer Ther 23;2:499-58. 23. Yun H, Su L, Chen WY. The emerging nd diverse roles of sirtuins in cncer: clinicl perspective. Onco Trgets Ther 23;6:399-46. 24. Chen HC, Jeng YM, Yun RH, et l. SIRT promotes tumorigenesis nd resistnce to chemotherpy in heptocellulr crcinom nd its expression predicts poor prognosis. Ann Surg Oncol 22;9:2-9. 25. López-Lázro M. Distriution nd iologicl ctivities of the flvonoid luteolin. Mini Rev Med Chem 29;9:3-59. 26. Kushi LH, Doyle C, McCullough M, et l. Americn Cncer Society Guidelines on nutrition nd physicl ctivity for cncer prevention: reducing the risk of cncer with helthy food choices nd physicl ctivity. CA Cncer J Clin 22;62:3-67. 27. Wng L, Lee IM, Zhng SM, et l. Dietry intke of selected flvonols, flvones, nd flvonoid-rich foods nd risk of cncer in middle-ged nd older women. Am J Clin Nutr 29;89:95-2. 28. Lin Y, Shi R, Wng X, et l. Luteolin, flvonoid with potentil for cncer prevention nd therpy. Curr Cncer Drug Trgets 28;8:634-46. 29. Domitrović R, Cvijnović O, Pugel EP, et l. Luteolin meliortes cispltin-induced nephrotoxicity in mice through inhiition of pltinum ccumultion, inflmmtion nd poptosis in the kidney. Toxicology 23;3:5-23. 3. Ju W, Wng X, Shi H, et l. A criticl role of luteolininduced rective oxygen species in lockge of tumor necrosis fctor-ctivted nucler fctor-kppb pthwy nd sensitiztion of poptosis in lung cncer cells. Mol Phrmcol 27;7:38-8. 3. Kpoor S. Luteolin nd its inhiitory effect on tumor growth in systemic mlignncies. Exp Cell Res 23;39:777-8. 32. Blmurugn K, Krthikeyn J. Evlution of Luteolin in the Prevention of N-nitrosodiethylmine-induced Heptocellulr Crcinom Using Animl Model System. Indin J Clin Biochem 22;27:57-63. 33. Anderson LM, Crter JP, Driver CL, et l. Enhncement of tumorigenesis y N-nitrosodiethylmine, N-nitrosopyrrolidine nd N6-(methylnitroso)-denosine y ethnol. Cncer Lett 993;68:6-6. 34. Anderson LM, Crter JP, Logsdon DL, et l. Chrcteriztion of ethnol s enhncement of tumorigenesis y N-nitrosodimethylmine in mice. Crcinogenesis 992;3:27-. 35. Chvez PR, Lin F, Chung J, et l. Long-term ethnol consumption promotes heptic tumorigenesis ut impirs norml heptocyte prolifertion in rts. J Nutr 2;4:49-55. 36. Smy RP, Goplkrishnkone P, Igncimuthu S. Anti-tumor promoting potentil of luteolin ginst 7,2-dimethylenz()nthrcene-induced mmmry tumors in rts. Chem Biol Interct 26;64:-4. 37. Seelinger G, Merfort I, Wölfle U, et l. Anticrcinogenic effects of the flvonoid luteolin. Molecules 28;3:2628-5. 38. Shimoi K, Okd H, Furugori M, et l. Intestinl sorption of luteolin nd luteolin 7-O-et-glucoside in rts nd humns. FEBS Lett 998;438:22-4. 39. Li LP, Wu XD, Chen ZJ, et l. Interspecies difference of luteolin nd pigenin fter orl dministrtion of HeptoBiliry Surgery nd Nutrition. All rights reserved. www.thehsn.org HeptoBiliry Surg Nutr 25;4(2):24-34
HeptoBiliry Surgery nd Nutrition, Vol 4, No 2 April 25 33 Chrysnthemum morifolium extrct nd prediction of humn phrmcokinetics. Phrmzie 23;68:95-2. 4. Gtes MA, Tworoger SS, Hecht JL, et l. A prospective study of dietry flvonoid intke nd incidence of epithelil ovrin cncer. Int J Cncer 27;2:2225-32. 4. Smpson L, Rimm E, Hollmn PC, et l. Flvonol nd flvone intkes in US helth professionls. J Am Diet Assoc 22;2:44-2. 42. Shrm V, McNeill JH. To scle or not to scle: the principles of dose extrpoltion. Br J Phrmcol 29;57:97-2. 43. Regn-Shw S, Nihl M, Ahmd N. Dose trnsltion from niml to humn studies revisited. FASEB J 28;22:659-6. 44. Chung J, Koo K, Lin F, et l. Apo-'-lycopenoic cid, lycopene metolite, increses sirtuin mrna nd protein levels nd decreses heptic ft ccumultion in o/o mice. J Nutr 22;42:45-. 45. Bnnsch P, Hertel T, Su Q. Significnce of heptic preneoplsi in risk identifiction nd erly detection of neoplsi. Toxicol Pthol 23;3:34-9. 46. Liu C, Bronson RT, Russell RM, et l. β-cryptoxnthin supplementtion prevents cigrette smoke-induced lung inflmmtion, oxidtive dmge, nd squmous metplsi in ferrets. Cncer Prev Res (Phil) 2;4:255-66. 47. Dvtseren M, Hur HJ, Yng HJ, et l. Trxcum officil (dndelion) lef extrct llevites high-ft diet-induced nonlcoholic ftty liver. Food Chem Toxicol 23;58:3-6. 48. Amin AR, Wng D, Zhng H, et l. Enhnced nti-tumor ctivity y the comintion of the nturl compounds (-)-epiglloctechin-3-gllte nd luteolin: potentil role of p53. J Biol Chem 2;285:34557-65. 49. Lee EJ, Oh SY, Sung MK. Luteolin exerts nti-tumor ctivity through the suppression of epiderml growth fctor receptor-medited pthwy in MDA-MB-23 ER-negtive rest cncer cells. Food Chem Toxicol 22;5:436-43. 5. Hwng JT, Prk OJ, Lee YK, et l. Anti-tumor effect of luteolin is ccompnied y AMP-ctivted protein kinse nd nucler fctor-κb modultion in HepG2 heptocrcinom cells. Int J Mol Med 2;28:25-3. 5. Kim JE, Son JE, Jng YJ, et l. Luteolin, novel nturl inhiitor of tumor progression locus 2 serine/threonine kinse, inhiits tumor necrosis fctor-lph-induced cyclooxygense-2 expression in JB6 mouse epidermis cells. J Phrmcol Exp Ther 2;338:3-22. 52. Seelinger G, Merfort I, Schempp CM. Anti-oxidnt, ntiinflmmtory nd nti-llergic ctivities of luteolin. Plnt Med 28;74:667-77. 53. Kochi T, Shimizu M, Terkur D, et l. Non-lcoholic stetoheptitis nd preneoplstic lesions develop in the liver of oese nd hypertensive rts: suppressing effects of EGCG on the development of liver lesions. Cncer Lett 24;342:6-9. 54. Liu TF, McCll CE. Decetyltion y SIRT Reprogrms Inflmmtion nd Cncer. Genes Cncer 23;4:35-47. 55. Olmos Y, Brosens JJ, Lm EW. Interply etween SIRT proteins nd tumour suppressor trnscription fctors in chemotherpeutic resistnce of cncer. Drug Resist Updt 2;4:35-44. 56. Lin HC, Chen YF, Hsu WH, et l. Resvertrol helps recovery from ftty liver nd protects ginst heptocellulr crcinom induced y heptitis B virus X protein in mouse model. Cncer Prev Res (Phil) 22;5:952-62. 57. de l Lstr CA, Villegs I. Resvertrol s n ntiinflmmtory nd nti-ging gent: mechnisms nd clinicl implictions. Mol Nutr Food Res 25;49:45-3. 58. Singh NP, Singh UP, Hegde VL, et l. Resvertrol (trns-3,5,4'-trihydroxystilene) suppresses EL4 tumor growth y induction of poptosis involving reciprocl regultion of SIRT nd NF-κB. Mol Nutr Food Res 2;55:27-8. 59. Villl JM, Alcín FJ. Sirtuin ctivtors nd inhiitors. Biofctors 22;38:349-59. 6. Jening EH, Schoonjns K, Auwerx J. Reversile cetyltion of PGC-: connecting energy sensors nd effectors to gurntee metolic flexiility. Oncogene 2;29:467-24. 6. Austin S, St-Pierre J. PGCα nd mitochondril metolism--emerging concepts nd relevnce in geing nd neurodegenertive disorders. J Cell Sci 22;25:4963-7. 62. Preyt N, Leo O. Sirtuin decylses: moleculr link etween metolism nd immunity. J Leukoc Biol 23;93:669-8. 63. Rodgers JT, Puigserver P. Fsting-dependent glucose nd lipid metolic response through heptic sirtuin. Proc Ntl Acd Sci U S A 27;4:286-6. 64. Sugden MC, Cton PW, Holness MJ. PPAR control: it's SIRTinly s esy s PGC. J Endocrinol 2;24:93-4. 65. Purushothm A, Schug TT, Xu Q, et l. Heptocytespecific deletion of SIRT lters ftty cid metolism nd results in heptic stetosis nd inflmmtion. Cell Met 29;9:327-38. HeptoBiliry Surgery nd Nutrition. All rights reserved. www.thehsn.org HeptoBiliry Surg Nutr 25;4(2):24-34
34 Rfcho et l. Luteolin inhiits lcohol ssocited liver injury 66. Kuppinen A, Suuronen T, Ojl J, et l. Antgonistic crosstlk etween NF-κB nd SIRT in the regultion of inflmmtion nd metolic disorders. Cell Signl 23;25:939-48. 67. Kim HJ, Prk KG, Yoo EK, et l. Effects of PGC-lph on TNF-lph-induced MCP- nd VCAM- expression nd NF-kppB ctivtion in humn ortic smooth muscle nd endothelil cells. Antioxid Redox Signl 27;9:3-7. 68. Wng RH, Sengupt K, Li C, et l. Impired DNA dmge response, genome instility, nd tumorigenesis in SIRT mutnt mice. Cncer Cell 28;4:32-23. 69. Pöschl G, Stickel F, Wng XD, et l. Alcohol nd cncer: genetic nd nutritionl spects. Proc Nutr Soc 24;63:65-7. 7. Mueller S. Phrmcologicl lockge of CYP2E nd lcohol-medited liver cncer: is the time redy? Chin J Cncer Res 23;25:269-7. Cite this rticle s: Rfcho BP, Stice CP, Liu C, Greenerg AS, Ausmn LM, Wng XD. Inhiition of diethylnitrosmineinitited lcohol-promoted heptic inflmmtion nd precncerous lesions y flvonoid luteolin is ssocited with incresed sirtuin ctivity in mice. HeptoBiliry Surg Nutr 25;4(2):24-34. doi:.3978/j.issn.234-388.24.8.6 HeptoBiliry Surgery nd Nutrition. All rights reserved. www.thehsn.org HeptoBiliry Surg Nutr 25;4(2):24-34