B16F1 B16F10 Supplemental Figure S1

Similar documents
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases

Cardiovascular Disease Products

TITLE: Genetic and epigenetic biomarkers for recurrent prostate cancer after radiotherapy

Supplementary Figures

In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell

Supplementary Materials for

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Temporal expression analysis of angiogenesis-related genes in brain development

Supplemental Figure Legends

Mechanisms underlying chemotherapy-induced vascular proliferation in ovarian cancer

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

SUPPLEMENTARY INFORMATION

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury

Tissue repair. (3&4 of 4)

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Increased adipose tissue hypoxia and capacity for angiogenesis and inflammation in young diet-sensitive C57 mice compared with diet-resistant FVB mice


Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of

antibody and ELISA experts Cancer Research Products

Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend

Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical

Supplementary Figure 1!

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )

Supporting Information

Supplemental Table 1. Primer sequences for transcript analysis

VEGFR2 but not VEGFR3 governs integrity and remodeling of thyroid angiofollicular unit in normal state and during goitrogenesis

SUPPLEMENTARY FIGURES AND TABLE

EMT and ECM. Jesse Liang, Ph.D. Sample & Assay Technologies

Heterotypy and Angiogenesis

HTG EdgeSeq Immuno-Oncology Assay Gene List

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis

Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.

RT-qPCR analysis of laser capture micro-dissected material from CD31 stained FFPE tissue sections

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)

Angiostasis and Angiogenesis Regulated by Angiopoietin1-Tie2 Receptor System

Review of relationship between vascular endothelial growth factor family & receptors and tumor angiogenesis

Supplementary Materials for

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.

Supplemental Information. Angiocrine Factors Deployed by Tumor Vascular. Niche Induce B Cell Lymphoma Invasiveness. and Chemoresistance

Supplemental Material

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for

IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.

Supplemental Table S1. Primers used in qrt-pcr analyses. Supplemental Figure S1, related to Figure 4. Extracellular matrix proteins

Angiogenesis as a therapeutic target

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF

SUPPLEMENTARY INFORMATION

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

(a-r) Whole mount X-gal staining on a developmental time-course of hearts from

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S.

Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature

An interleukin-17-mediated paracrine network promotes tumor resistance to anti-angiogenic therapy

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplemental Data for Toischer et al., Cardiomyocyte proliferation prevents failure in

Supplementary information

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

Supplementary Materials and Methods

Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation

Boucher et al NCOMMS B

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

The Role of Microenvironment in the Control of Tumor Angiogenesis

Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis

Endothelial PDGF-CC regulates angiogenesisdependent thermogenesis in beige fat

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

Supplementary Information

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor

Targeting angiogenesis in cancer

SUPPLEMENTARY INFORMATION

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

SUPPLEMENTARY INFORMATION

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

SUPPLEMENTARY INFORMATION

Inflammatory Cells and Metastasis

Contribution of the intronic mir-338-3p and its Hosting Gene AATK to Compensatory β-cell Mass Expansion

Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes

Gene expression of muscular and neuronal pathways is cooperatively dysregulated in patients

Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

The Influence of Birch Bark Triterpenes on. Keratinocytes and Fibroblasts from Diabetic and

Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in

Microenvironmental influence on angiogenesis and tumor cell survival. Mark W. Dewhirst, DVM, PhD Duke University Medical Center

Supporting Information

VEGFR. 1

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

Natural and Synthetic lipid membrane nanovesiclesto repair and regenerate skin. Sai Kiang Lim, PhD

Supplementary Information

Mechanisms of Resistance to Antiangiogenic. Martin J. Edelman, MD University of Maryland Greenebaum Cancer Center Dresden, 2012

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Discussion

Transcription:

B16F1 B16F1 Supplemental Figure S1 Representative microangiography images of B16F1 and B16F1 tumors grown in the cranial windows. FITC-dextran (2 million MW) was injected systemically to visualize blood vessels. Bar = 1 µm. - S1 -

A (cm/cm 2 ) Density B (µm) Diameter 15 3 1 2 5 1 C (/mm 2 ) 3 2 1 WT inos -/- Vessel segments D (/vessel cross section) 6 4 2 WT inos -/- WT inos -/- EC nuclei WT inos -/- Supplemental Figure S2 Effect of host inos deletion on B16F1 tumor vessels in the cranial window. (A-C) Vessel parameters quantified by off line analyses of the digitized microangiography images. There was no significant difference between wild-type C57BL/6 (n=5) and inos -/- mice (n=5) in vascular density (A), vessel diameter (B) and branching (C). (D) Histological quantification of endothelial cell nuclei per vessel cross-section in B16F1 tumors grown in C57BL/6 (132 vessels in 3 tumors, 5 locations in each) or inos -/- mice (134 vessels in 3 tumors, 5 locations in each). - S2 -

DAF-2T (nmol/l) 4 a v A C B 3 2 1 a v D F E 4-AF (µmol/l) 1 v G 5 a I H Supplemental Figure S3 Effects of the acute (24hrs) application of L-NMMA on the DAF-2 associated fluorescence in the pial microvessels. (A, C, D), microangiography using tetramethylrhodamine-dextran (2 million MW); (B, E), Representative microfluorography captured after the 6-minute loading of DAF-2; (C, F), pseudocolor representation of DAF-2 microfluorographs. The animals were treated with D-NMMA (A-C) or L-NMMA (D-F). Note that DAF-2 associated fluorescence mainly distributed along the arteriole and was abolished with LNMMA treatment. Color bars in the top right represent calibration of the pseudocolor with known concentrations of DAF-2T. (G-I), microangiograph (G), microfluorograph captured at 6 minutes after injection of 4-AF (H), an NOinsensitive control fluorochrome, and its pseudocolor representation (I). Color bars in the bottom right shows calibration with known concentrations of 4-AF. a, arteriole; v, venule, Bar = 1 µm. - S3 -

A X1 4 cells 12 1 8 6 HUVEC X1 4 cells 12 1 8 6 HUVEC 4 2 control 1µM 1µM1mM 1mM 4 2 control 1µM 1µM 1µM 1mM DETANONOate L-NMMA B X1 4 cells 12 1 1T1/2 X1 4 cells 12 1 1T1/2 8 8 6 4 2 control 1µM 1µM1mM 1mM 6 4 2 control 1µM 1µM 1µM 1mM DETANONOate L-NMMA Supplemental Figure S4 Effects of exogenous NO and NO suppression on HUVECs and 1T1/2 cell proliferation. HUVECs or 1T1/2 cells were plated in uncoated 6-well plates at 5x1 4 cells per well in EGM with 2% FBS or BME with 1% FBS, respectively. Twentyfour hours later, the culture medium was changed and the cells were challenged with 1 µm, 1 µm, 1 µm and 1 mm of L-NMMA or with 1 µm, 1 µm, 1mM and 1mM of DETA NONOate in their respective media. Seventy-two hours after the treatment, cells were suspended and number of cells was determined using a hemocytometer. All proliferation assays were conducted in triplicate and each set of experiments was performed at least 5 times. - S4 -

Supplemental Table S1. Vessel morphology of B16 melanomas in paraffin histological specimens. B16F1 B16F1 enos -/- inos -/- D-NMMA L-NMMA Vessel Density 165 ± 17 91± 21 87± 9 14± 6 139± 17 85 ± 16# (/mm 2 ) Vessel perimeter 67 ± 5 93± 8 87± 8 57± 6 63 ± 5 113 ± 11# (µm) # p<.5 as compared with corresponding B16F1 and D-NMMA treated tumors, respectively. Five random locations per tumor were examined in 3 tumors per group, respectively. The numbers of vessels examined (from the left to the right) are 127, 91, 15, 114, 19, 77. - S5 -

Supplemental Table S2. Angiogenic gene array analysis of B16F1 malanoma. gene D-NMMA L-NMMA gene D-NMMA L-NMMA gene D-NMMA L-NMMA Adamts1.881.647 Figf.15.27 Plau.242.192 Adamts8.19.15 Kdr.172.183 Ptgs1.48.18 Angpt1.15.8 Flt1.978.8 Ptgs2.14.2 Angpt2.277.235 Fn1.471.391 Rsn.945.881 Ang.312.253 Cxcl1.39.32 Ccl2.72.4 Cd36.67.88 Hgf.221.245 Serpinb5.17.3 Cdh5.53.435 Hif1a.949.885 Serpine1.473.31 Chga.697.525 Idb1.56.37 Serpinb2.13.23 Col18a1.51.3 Ifna1.41.222 Serpinf1.8.11 Csf3.8.51 Ifnb1.39.59 Sparc.849.755 Ctgf.575.63 Ifng.65.91 Spp1.798.716 Edg1.744.536 Igf1.7.78 Tek.423.418 Efna5.639.576 Il1.5.43 Tgfa.457.255 Efnb2.196.164 Il12a.11.18 Tgfb1.42.346 Egf.268.142 Itga5.375.32 Tgfb2.558.56 Egfr.27.3 Itgav.797.71 Tgfb3.457.555 Eng.71.561 Itgb3.25.295 Tgfbr1.81.659 Ephb4.216.246 Smad1.33.6 Tgfbr2.68.417 Erbb2.37.71 Mdk.7.14 Tgfbr3.18.131 Ets1.661.646 Mmp2.3.43 Thbs1.123.214 F2.11.14 Mmp9.17.29 Thbs2.551.553 Fgf1.265.193 Msr1.131.167 Thbs3.2.21 Fgf16.545.438 Nos3.459.286 Tie1.194.153 Fgf2.19.12 Nrp1.598.341 Timp1.259.169 Fgf4.191.14 Pdgfa.443.35 Timp2.686.578 Fgf6.51.33 Pdgfb.11.9 Tnc.29.19 Fgf7.767.756 Pdgfra.2.36 Vcam1.39.51 Fgfr1.938 1.27 Pdgfrb.35.26 Vegfa.517.479 Fgfr3.126.144 Pecam1.227.129 Vegfb.448.621 Fgfr4.243.127 Pgf.276.146 Vegfc.237.347 Three tumors of each treatment group were examined. Values represent relative gene expression normalized to β actin. - S6 -

Supplemental Table S3. Realtime PCR analysis of endogenous angiogenic and vessel maturation factors. gene PDGF-B Angiopoietin-1 Angiopoietin-2 Sphingosine VEGF-A kinase type1 D-NMMA 1.34 ±.33 1.15 ±.28 1.22 ±.4 1.1 ±.21 1.67 ±.53 L-NMMA 2.8±.26 1.67±.59 1.33±.19 1.74±.32 1.46 ±.28 gene PDGFRβ Tie-2 EDG-1 VEGFR-1 VEGFR-2 D-NMMA.9 ±.5.7 ±.2 1.46 ±.36 1.8 ±.17 1.16 ±.5 L-NMMA 1.19 ±.24.8 ±.1 2.47 ±.34 1.63 ±.28 1.2 ±.2 Three tumors per each group were independently analyzed. Values represent relative gene expression normalized to β actin. There was no statistical significant difference between D- NMMA and L-NMMA treated tumors in any factors. - S7 -

Supplemental Table S4. Realtime PCR primers Gene Fam-labeled primer (5-3 ) Unlabeled primer (5-3 ) PDGF-B GACCCTCAGACTTGGGCTTGGAGG[FAM]C CTGCCTGCTGGCTTAGCTT Angiopoietin-1 CAACCTCGTGCTGGGTCTGG[FAM]TG GCAGGGTGAGGTTAGGCTTC Angiopoietin-2 CACCAGATCACTTCTACCTCGCTGG[FAM]G CCGTGAGTCCTGTAAGGTGAA Sphingosine GAACCACAGCTCCCTGGCATGG[FAM]TC CAGAGTGCTGGTGCTGCTGA kinase type1 VEGF-A CACTCCTAACGATGAAGCCCTGGAG[FAM]G TTGGTCTGCATTCACATCTGC PDGFRβ CAACATCCATTCTCGATCACAGAGATG[FAM]TG TGAGTGATTCGGGCACCTAT Tie-2 GACCATTGTTGACGCATCTTCATGG[FAM]C GCCTTAATGAACCAGCACCAA EDG-1 CACAAAGCGGGAAGGGAGTATGTTTG[FAM]G AGCTGTTGCTCCCGTTGTGT VEGFR-1 CGGAAGAGGTAGTTGGACAGGTTTC[FAM]G CAAGGAGGGCCTCTGATGGT VEGFR-2 CGGACACAGTGGGCAGTCAAGTC[FAM]G GGGCCTTCCATTTCTGTACCAT β-actin CACAGGTCTTGGGTATGGAATCCTG[JOE]G TCTTTACGGATGTCAACGTCA Note that β-actin was JOE-labeled and the genes of interest were FAM-labeled. - S8 -

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback