The Influence of Birch Bark Triterpenes on. Keratinocytes and Fibroblasts from Diabetic and

Size: px
Start display at page:

Download "The Influence of Birch Bark Triterpenes on. Keratinocytes and Fibroblasts from Diabetic and"

Transcription

1 The Influence of Birch Bark Triterpenes on Keratinocytes and Fibroblasts from Diabetic and Nondiabetic Donors 4 5 Tina Wardecki,#, Philipp Werner,#, Maria Thomas, Markus F. Templin, Gudula Schmidt, Johanna M. Brandner, Irmgard Merfort, * Pharmaceutical Biology and Biotechnology, Albert-Ludwigs-University Freiburg, Freiburg, Germany Dr. Margarete Fischer-Bosch Institute of Clinical Pharmacology, Stuttgart, and University of Tübingen, Tübingen, Germany Institute of Natural and Medical Sciences at the University of Tübingen, Reutlingen, Germany Institute for Experimental and Clinical Pharmacology and Toxicology, Albert-Ludwigs- University Freiburg, Freiburg, Germany Department of Dermatology and Venerology, University Hospital Hamburg-Eppendorf, Hamburg, Germany # These authors contributed equally to this work. 18

2 2 19 ASSOCIATED CONTENT 20 Supporting information Fig. S1 Birch bark extract (TE) and betulin influence mrna expression of various genes in primary human keratinocytes (NHK-nd and NHK-d). The mrna expression in primary human keratinocytes derived from nondiabetic young and adult (NHK-nd) and diabetic adult (NHK-d) donors was measured after treatment with TE (1 or 5 µg/ml) or betulin (0.87 µg/ml = 1.96 µm or 4.35 µg/ml = 9.81 µm) for 6 h with the Fluidigm s Biomark high throughput qpcr chip platform. The results are expressed as fold change (= fold) in relation to the solvent control (DMSO 0.1%). Results from independent experiments (2-4) of two different donors per group are given and altogether 5-7 independent experiments were performed. mrna of the adhesion molecules ICAM-1 and VCAM-1 was measured by standard qrt-pcr from three independent experiments with cells of one donor. ± SD was calculated from the average of these experiments, respectively. The figure lists the genes where no gene was influenced statistically significant. Oneway ANOVA followed by Bonferroni s post-test was used for statistical analysis. The colors

3 indicate the extent of change in mrna expression in relation to the control. Blue: fold change < 0.3; light blue: fold change ; light red: fold change 1.3-4; red: fold change > 4. Abbreviations: NT: not tested; bdl: below detection limit Fig. S2 Birch bark extract (TE) and betulin influence mrna expression of various genes in fibroblasts (HDF). The mrna expression in primary human fibroblasts derived from a nondiabetic (HDF-nd) and a diabetic (HDF-d) donor was measured after treatment with TE (1 or 5 µg/ml) or betulin (0.87 µg/ml = 1.96 µm or 4.35 µg/ml = 9.81 µm) for 6 h with the Fluidigm s Biomark high throughput qpcr chip platform. The results are expressed as fold change in relation to the solvent control (DMSO 0.1%). Values represent means of four independent experiments ± SD. For each group (HDF-d, HDF-nd young and adult) cells from one donor were used. The figure lists the genes where no gene was influenced statistically significant. One-way ANOVA followed by Bonferroni s post-test was used for statistical analysis. The colors indicate the extent of change in mrna expression in relation to the control. Blue: fold change < 0.3; light blue: fold change ; light red: fold change 1.3-4; red: fold change > 4.

4 Fig. S3 Differences in baseline mrna expression in keratinocytes (NHK) and fibroblasts (HDF) isolated from nondiabetic (nd) and diabetic (d) as well as young and old donors. The baseline mrna expression of 48 different genes in primary human keratinocytes derived from nondiabetic and diabetic donors (A) as well as young and old donors (B) was compared. Results from independent experiments (2-4) with cells from two different donors per group are given. Differences in baseline expression of human dermal fibroblasts isolated from a nondiabetic and a diabetic (C) as well as a young and an old donor (D) were analyzed. Significant differences are listed. The results are expressed as normalized and averaged 2 -ΔCT values that were put in relation to each other. Statistical analysis was determined using Student s t-test. * p < 0.05; ** p < 0.01; *** p <

5 Fig. S4 Influence of betulin on the production of different mediators important for wound healing in human fibroblasts and keratinocytes. Keratinocytes (A) and fibroblasts (B) from nondiabetic and diabetic origin were treated with betulin (0.87 µg/ml = 1.96 µm) or DMSO (0.1%) for 24 h. Protein levels of the mediators were determined in the supernatant using a bead-based suspension array technology (xmap, Luminex Corp., Austin, TX, USA). Values represent means of three independent experiments + SD. # One value was below the detection limit and was substituted by the value for the detection limit. Data are not significant, but often show a trend.

6 Fig. S5 Shape change of the actin cytoskeleton of fibroblasts. Fluorescence microscopy pictures of the actin cytoskeleton of fibroblasts from nondiabetic donors (HDF-nd) (A) and from diabetic donors (HDF-d) (B) after treatment with triterpenes betulinic acid or oleanolic acid for 2 h. Fibroblasts with additional treatment of p38-mapk inhibitor LN 950 are shown in (C) for HDFnd and in (D) for HDF-d. The inhibitor was added 30 minutes before treatment with the test compounds. Representative pictures are shown.

7 75 7

8 Fig. S6 Shape change of the actin cytoskeleton of keratinocytes. Fluorescence microscopy pictures of the actin cytoskeleton of a young nondiabetic donor (NHK-nd) (A) and an adult nondiabetic donor (NHK-nd) (B) after treatment with the positive control CNF1 (150 ng/ml), TE (5.1 ng/ml), betulin (10 nm) or lupeol (10 nm) for 2 h. For inhibition of p38-mapk, inhibitor LN 950 (100 nm) was used 30 min before adding the test compounds. Representative pictures are shown. 82

9 S1 Protocol. This section contains all experimental details which are not shown in the experimental section of the paper Isolation and cultivation of the primary human keratinocytes and fibroblasts The keratinocytes NHK and NHK were derived from foreskin that was obtained following medical circumcisions. Briefly, the foreskin explant was washed with PBS containing 8% Antibiotic-Antimycotic and 1% Ciprobay 400 mg solution for infusion and the dermis was removed gently. The skin was cut into small pieces and incubated with trypsin/edta (0.05%/0.02%) for 1 h. The pieces were transferred into PBS containing 10% FCS and 1% Ciprobay and the epidermis was scraped with a scalpel to separate the normal human keratinocytes (NHKs). The cell suspension was centrifuged at 4 C and the cells were cultivated in Keratinocyte SFM supplemented with human recombinant EGF (rhegf), bovine pituitary extract (BPE) and penicillin-streptomycin 1%. Information on the isolation of the other NHKs and HDFs is provided in Pollok et al Primary keratinocytes (NHK-nd and NHK-d) and fibroblasts (HDF-nd and HDF-d) were grown in monolayer cultures. The cells were kept in a humidified environment with 5% CO2 at 37 C. NHK were cultivated in Keratinocyte SFM supplemented with BPE, rhegf and penicillinstreptomycin 1%. When NHK were starved medium without recombinant EGF and bovine pituitary extract (BPE) was used. HDF were cultured in DMEM (high glucose, 4.5 g/l) supplemented with 10% FCS and 1% penicillin-streptomycin. The glucose content in the medium of NHK was 5.5 mm, that one of HDF 25 mm. The cells were cultivated as mentioned above and split when they reached a confluency of 80%. Therefore, cells were washed with PBS, brought in

10 suspension with trypsin/edta 0.05%/0.02% and were centrifuged at 1200 rpm and 4 C for 5 min. The cells were resuspended in the corresponding cell culture media and seeded into tissue culture flasks or wells at the desired concentrations. NHK were maximally used up to passage 5 and HDF up to passage 8. For RNA analysis or Luminex assay, the cells were serum starved by using medium without FCS or supplements 30 h prior to cell harvest qrt-pcr RNA was amplified in a total reaction volume of 25 µl consisting of 6 µl of cdna (corresponding to 60 ng of total RNA input), 2x conc. KAPA PROBE FAST Master Mix, 50 nm primer and 100 nm probe for the reference gene and 300 nm primers and 100 nm probe for the gene of interest. The 18S rrna was used as reference. For relative quantification ΔCT values of treated cells were referred to untreated control cells resulting in a ΔΔCT value. The fold change was calculated as 2 - ΔΔCT Staining of the actin cytoskeleton The actin cytoskeleton was analyzed by fluorescence microscopy after staining with rhodamine phalloidin. For this purpose cells per sample were seeded on 10 mm glass coverslips in 24 well plates. For fibroblasts, the coverslips were coated with type I collagen for 2 h before plating. Keratinocytes were starved for 2 d prior to the experiment to reduce basal stimulation of the cells. After treatment with TE, the triterpenes or the positive control CNF1 (cytotoxic necrotizing factor 1 of Escherichia coli) for 2 h, cells were fixed with 400 µl of 3.7% formaldehyde and

11 permeabilized with 0.1% triton-x 100 for 10 min. Subsequently, the cells were washed in PBS, stained for 1 h with 1 µl rhodamine phalloidin (0.13 Units) in 24 µl PBS, and then washed again in PBS. Thereafter coverslips were fixed with 3.5 µl Prolong Gold Antifade reagent on microscope slides. The following day pictures were taken with an Axiovert fluorescence microscope (Zeiss)

12 fibroblasts keratinocytes Table A: Origin of the used human primary keratinocytes and fibroblasts Diabetic Classification Internal Name Age Gender Biopsy site status NHK nondiabetic <15 male no DM foreskin (FR) young (NHKnd) <15 male no DM foreskin NHK (FR) NHK nondiabetic 50 male no DM inguinal (HF) adult (NHK-nd) K80 (HH) 89 unknown no DM unknown diabetic adult (NHK-d) nondiabetic young (HDFnd) nondiabetic adult (HDF-nd) diabetic adult (HDF-d) Abbreviations: K787 (HH) 45 male DM type 2 unknown K705 (HH) unknown unknown DM type 2 unknown K758 (HH) 96 unknown DM type 2 unknown F223 (HH) <15 male no DM foreskin F188 (HH) <15 male no DM foreskin F-NHF (HF) 40 female no DM inguinal F31 (HH) 37 unknown no DM unknown F306 (HH) 42 unknown DM type 2 unknown HH = University Hospital Hamburg-Eppendorf; FR = keratinocytes from foreskins obtained from the Department of Dermatology, Medical Center, University of Freiburg, Prof. Dr. L. Bruckner-Tuderman; HF = a gift from the Department of Dermatology, Medical Center, University of Freiburg, Prof. Dr. L. Bruckner-Tuderman; NHK-nd: keratinocytes derived from nondiabetic donors; NHK-d: keratinocytes derived from diabetic donors; HDF-nd: fibroblasts from nondiabetic donors; HDF-d: fibroblasts from diabetic donors. 140

13 Table B. Genes analyzed on the Fluidigm s Biomark high throughput qpcr chip platform and their respective AB Assay Number Gene Gene name Protein AB Assay Number CCL2 chemokine (C-C motif) ligand 2 MCP-1 Hs _m1 ACTB actin, beta Actin-β Hs _g1 AQP3 aquaporin 3 (Gill blood group) Aquaporin 3 Hs _g1 CCL4 chemokine (C-C motif) ligand 4 MIP-1β Hs _m1 CCL5 chemokine (C-C motif) ligand 5 RANTES/CCL5 Hs _m1 CCR3 chemokine (C-C Motif) receptor 3 CCR3 Hs _s1 CLDN1 claudin 1 Claudin 1 Hs _m1 CLDN4 claudin 4 Claudin 4 Hs _s1 COL1A1 collagen, type I, alpha 1 Collagen 1 Hs _m1 COL5A2 collagen, type V, alpha 2 Collagen 5 Hs _m1 CRP C-reactive protein, pentraxin-related CRP Hs _g1 CSF3 colony stimulating factor 3 (Granulocyte) G-CSF Hs _g1 CXCL10 chemokine (C-X-C motif) receptor 10 IP-10 Hs _g1 DEFB103B defensin, beta 103B Beta-Defensin 3 Hs _g1 ELN elastin Elastin Hs _m1 FBN1 fibrillin 1 Fibrillin 1 Hs _m1 FGF2 fibroblast growth factor 2 (basic) FGF2 Hs _m1 FN1 fibronectin 1 Fibronectin Hs _m1 FOS FBJ murine osteosarcoma viral oncogene homolog c-fos Hs _s1 GAPDH glyceraldehyde-3-phosphate dehydrogenase GAPDH Hs _g1 GDF15 growth differentiation factor 15 GDF15 Hs _m1 GJA1 gap junction protein, alpha 1, 43 kda Connexin 43 Hs _s1 GJB2 gap junction protein, beta 2, 26 kda Connexin 26 Hs _s1 IFNG interferon, gamma IFNγ Hs _m1 IGF1 insulin-like growth factor 1 IGF-1 Hs _m1 IL10 interleukin 10 IL-10 Hs _m1 IL1B interleukin 1, beta IL-1β Hs _m1 IL1R1 interleukin 1 receptor, type I IL1R1 Hs _m1 IL2 interleukin 2 IL-2 Hs _m1 IL6 interleukin 6 IL-6 Hs _m1 IL8 interleukin 8 IL-8 Hs _m1 JUN jun proto-oncogene c-jun Hs _s1 MMP1 matrix metallopeptidase 1 (interstitial collagenase) MMP-1 Hs _m1 MMP2 matrix metallopeptidase 2 MMP-2 Hs _m1 MMP9 matrix metallopeptidase 9 MMP-9 Hs _m1 NFE2L2 nuclear factor, erythroid 2-like 2 Nrf2 Hs _g1 NFKBIA nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha IκBα Hs _g1

14 14 Gene Gene name Protein AB Assay Number 143 NOS2 nitric oxide synthase 2, inducible NOS2 Hs _m1 PDGFB platelet-derived growth factor beta polypeptide PDGFB Hs _m1 PTGS2 prostaglandin-endoperoxide synthase 2 Cox-2 Hs _m1 SOCS3 suppressor of cytokine signaling 3 SOCS-3 Hs _s1 SOD2 superoxide dismutase 2, mitochondrial SOD2 Hs _m1 TGFB1 transforming growth factor, beta TGF-β1 Hs _m1 TIMP1 TIMP metallopeptidase inhibitor 1 TIMP-1 Hs _m1 TIMP2 TIMP metallopeptidase inhibitor 2 TIMP-2 Hs _m1 TNF tumor necrosis factor TNFα Hs _g1 VEGFA vascular endothelial growth factor A VEGF-A Hs _m1 WDR26 WD repeat domain 26 MIP-2 Hs _m1

15 PCR with the LightCycler Gene Species Protein Sequence (5-3 ) Table C. Studied genes and the nucleotide sequence of the used primers and probes for qrt- RNA18S5 human 18S rrna Sense 5 CGGCTACCACATCCAAGG 3 Antisense 5 CGGGTCGGGAGTGGGT 3 Probe 5 -[HEX] TTGCGCGCCTGCTGCCT-[TAM] 3 VCAM-1 human VCAM-1 Sense 5 -GAGAGTGTCAAAGAAGGA-3 Antisense 5 -GCGCCATCTATAGATTTTAG-3 Probe 5 -[6-FAM]-CTGTGTCTCCTGTCTCCGCTT- [TAM]-3 ICAM-1 human ICAM-1 Sense 5 -GAGTGCCCAGGGAATATG-3 Antisense 5 -GAGGGAGTCCTCCAATAC-3 Probe 5 -[6-FAM]-ATGCCTTGTCCTCTTGTCCTGT- [TAM]-3

16 Table D. Proteins analyzed on a Luminex 100 Total System Classification Protein Annotation Protein name adhesion molecules soluble receptors chemokines pro-inflammatory mediators antiinflammatory mediators miscellaneous se-selectin 2 Soluble E-Selectin svcam-1 Soluble vascular adhesion molecule 1 sicam-1 Soluble intercellular adhesion molecule 1 srage 1.2 Soluble receptor for advanced glycation end products IL-6sR Interleukin-6 soluble receptor sgp130 Soluble gp130 stnf-r1 Soluble tumor necrosis factor receptor 1 stnf-r2 1 Soluble tumor necrosis factor receptor 2 GRO-α Chemokine (C-X-C motif) ligand 1 (CXCL1) IL-8 Interleukin-8 MCP-1 Monocyte chemotactic protein 1 MIP-1α 2 Macrophage inflammatory protein 1 alpha MIP-1β 1.2 Macrophage inflammatory protein 1 beta RANTES Regulated on activation, normal T cell expressed and secreted IFNγ 1.2 Interferon gamma IL-1β 1.2 Interleukin-1 beta IL Interleukin-2 IL-12p Interleukin-12p40 subunit IL-17A 1.2 Interleukin-17A MIF Macrophage migration inhibitory factor PLA2G7 1.2 Phospholipase A2 group VII scd40l 1.2 Soluble CD40 ligand TNFα 2 Tumor necrosis factors alpha IL Interleukin-4 IL Interleukin-10 IL-1RA Interleukin-1 receptor antagonist FGF Fibroblast growth factor 23 GM-CSF 2 Granulocyte-macrophage colony-stimulating factor Leptin 1.2 Leptin Osteocalcin 1.2 Osteocalcin Osteopontin 1.2 Osteopontin sfas Soluble Fas The proteins that were below the detection limit are marked with the numbers 1 (keratinocytes) and 2 (fibroblasts)

17 References S1 Protocol (1) Pollok, S.; Pfeiffer, A.-C.; Lobmann, R.; Wright, C. S.; Moll, I.; Martin, P. E. M.; Brandner, J. M. J. Cell. Mol. Med. 2011, 15 (4),

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Supporting Information

Supporting Information Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D ) 1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest

More information

Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it.

Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it. Electrolytes Version: 1 Edited by: Jason Kim (note that the following list should be linked to the appropriate location.) Summary Reagents and Materials Protocol Reagent Preparation Reagent 1 Reagent 2

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

SUPPLEMENTARY FIG. S2. b-galactosidase staining of

SUPPLEMENTARY FIG. S2. b-galactosidase staining of SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived

More information

Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9

Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9 Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S1A9 Joanna Nikitorowicz-Buniak UCL Division of Medicine Systemic sclerosis

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell

In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell Supplementary Methods BrdU incorporation in vivo In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell proliferation in the heart. Mice were subjected to LI-TAC, and 5 days later

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

IL-24 AND ITS ROLE IN WOUND HEALING

IL-24 AND ITS ROLE IN WOUND HEALING IL-24 AND ITS ROLE IN WOUND HEALING Nancy J. Poindexter, Ryan Williams, Garth Powis, Sunil Chada, and Elizabeth A. Grimm & Introgen Therapeutics, Inc., Houston, TX IL-24/MDA 24/MDA-77 is a Tumor Suppressor

More information

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p. a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure

More information

Supplemental Figure Legends

Supplemental Figure Legends Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao

More information

Cytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones

Cytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones Cytokines Luděk Šefc Cytokines Protein regulators of cellular communication Cytokines x hormones Hormones Cytokines Production sites few many Cell targets few many Presence in blood yes rarely Biological

More information

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in

More information

Speciality and Research Controls

Speciality and Research Controls Controls Speciality and Research Product Range Product Antimicrobial Array 1 Plus Control 3 x 1 ml AMC5084 Antimicrobial Control II 3 x 1 ml AMC5035 Antimicrobial Control III 3 x 1 ml AMC5036 Growth Promoter

More information

Physicochemical Properties Can Be Key Determinants of Mesoporous Silica Nanoparticle Potency In Vitro

Physicochemical Properties Can Be Key Determinants of Mesoporous Silica Nanoparticle Potency In Vitro 1 Physicochemical Properties Can Be Key Determinants of Mesoporous Silica Nanoparticle Potency In Vitro Dalibor Breznan 1*, Dharani D. Das 1, Christine MacKinnon-Roy 1, Stéphane Bernatchez 2, Abdelhamid

More information

Cell-Derived Inflammatory Mediators

Cell-Derived Inflammatory Mediators Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,

More information

Topically Applicable Stromal Cell Growth Factors - Encapsulated Cosmeceuticals

Topically Applicable Stromal Cell Growth Factors - Encapsulated Cosmeceuticals Topically Applicable Stromal Cell Growth Factors - Encapsulated Cosmeceuticals Stem cells move to injured area, differentiate into neighboring cells, and replace the damaged cells Cell Eons Stem cells

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast

More information

Transfection of Sf9 cells with recombinant Bacmid DNA

Transfection of Sf9 cells with recombinant Bacmid DNA Transposition Bacmid DNA Mini Culturing baculo cells Transfection of Sf9 cells with recombinant Bacmid DNA Amplification of the virus Titration of baculo stocks Testing the expression Transposition 1.

More information

Ligand-mediated cytoplasmic retention of the Ah receptor inhibits. Gulsum E. Muku, Tejas S. Lahoti, Iain A. Murray, Michael A.

Ligand-mediated cytoplasmic retention of the Ah receptor inhibits. Gulsum E. Muku, Tejas S. Lahoti, Iain A. Murray, Michael A. Ligand-mediated cytoplasmic retention of the Ah receptor inhibits macrophage mediated acute inflammatory responses Gulsum E. Muku, Tejas S. Lahoti, Iain A. Murray, Michael A. Podolsky, Kayla Smith, Troy

More information

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57 Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA.

AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. AUTOANTIBODY PROFILING SYSTEM ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. Detect Quantify Classify Phone: +1-814-262-7331; Fax: +1-814-262-7334, Email: itsi@itsibio.com Website:

More information

FirePlex Multiplex Immunoassay product list

FirePlex Multiplex Immunoassay product list FirePlex Multiplex Immunoassay product list Contents Purchasing the assay Human - pre-designed panels Human list of analytes Human protein standard mixes Mouse - pre-designed panels Mouse list of analytes

More information

APPLICATION SPECIFIC PROTOCOL ANGIOGENESIS... 1 TABLE OF CONTENTS... 1 MONOLAYER FORMATION... 2 OPTION 1: APPLICATION OF ANGIOGENIC STIMULI...

APPLICATION SPECIFIC PROTOCOL ANGIOGENESIS... 1 TABLE OF CONTENTS... 1 MONOLAYER FORMATION... 2 OPTION 1: APPLICATION OF ANGIOGENIC STIMULI... APPLICATION SPECIFIC PROTOCOL ANGIOGENESIS AIM 3D Cell Culture Chips offer a new perspective in studying angiogenesis by allowing the growth of new vascular sprouts in a 3D matrix from a pre-existing endothelial

More information

Elaborating ELAD Mechanism of Action and Linking Cell-Based Models to the Clinic

Elaborating ELAD Mechanism of Action and Linking Cell-Based Models to the Clinic Elaborating ELAD Mechanism of Action and Linking Cell-Based Models to the Clinic September 9, 2017 Patricia W Bedard, Jason Lapetoda, Jagadeesha Dammanahalli, Jessica Van Allen, Susan Lin, Lee Landeen

More information

RayBio Human ENA-78 ELISA Kit

RayBio Human ENA-78 ELISA Kit RayBio Human ENA-78 ELISA Kit Catalog #: ELH-ENA78 User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross,

More information

Supplemental information

Supplemental information Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental

More information

AVAILABLE BIOMARKER ASSAYS

AVAILABLE BIOMARKER ASSAYS AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated

More information

* Kyoto Encyclopedia of Genes and Genomes.

* Kyoto Encyclopedia of Genes and Genomes. Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited

More information

Irf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20%

Irf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20% Irf7 Fold changes 3 1 Irf1 fold changes 3 1 8h h 8h 8h h 8h p-p6 p-p6 t-p6 p-irf3 β-actin p-irf3 t-irf3 β-actin TKO TKO STKO (E) (F) TKO TKO % of p6 nuclear translocation % % 1% 1% % % p6 TKO % of IRF3

More information

RayBio Human Thyroglobulin ELISA Kit

RayBio Human Thyroglobulin ELISA Kit RayBio Human Thyroglobulin ELISA Kit Catalog #: ELH-Thyroglobulin User Manual Last revised July 6, 2017 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite

More information

Annexin V-PE Apoptosis Detection Kit

Annexin V-PE Apoptosis Detection Kit Annexin V-PE Apoptosis Detection Kit Catalog Number KA0716 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...

More information

Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538

Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Background: TIGIT is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells, activated CD4+, CD8+ and regulatory

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

B16F1 B16F10 Supplemental Figure S1

B16F1 B16F10 Supplemental Figure S1 B16F1 B16F1 Supplemental Figure S1 Representative microangiography images of B16F1 and B16F1 tumors grown in the cranial windows. FITC-dextran (2 million MW) was injected systemically to visualize blood

More information

The Role of Microenvironment in the Control of Tumor Angiogenesis

The Role of Microenvironment in the Control of Tumor Angiogenesis The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/381/ra59/dc1 Supplementary Materials for Analysis of single-cell cytokine secretion reveals a role for paracrine signaling in coordinating macrophage responses

More information

Cell plasticity in wound healing: paracrine factors of M1/ M2 polarized macrophages influence the phenotypical state of dermal fibroblasts

Cell plasticity in wound healing: paracrine factors of M1/ M2 polarized macrophages influence the phenotypical state of dermal fibroblasts Ploeger et al. Cell Communication and Signaling 213, 11:29 RESEARCH Open Access Cell plasticity in wound healing: paracrine factors of M1/ M2 polarized macrophages influence the phenotypical state of dermal

More information

Activated mast cells promote differentiation of B cells into effector cells

Activated mast cells promote differentiation of B cells into effector cells Supplementary,information, Activated mast cells promote differentiation of B cells into effector cells Anna-Karin E. Palm 1, Gianni Garcia Faroldi 2, Marcus Lundberg 1, Gunnar Pejler 3, 2 and Sandra Kleinau

More information

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21

More information

Contribution of Interstitial Valve Cells to Aortic Valve Calcification

Contribution of Interstitial Valve Cells to Aortic Valve Calcification UNIVERSITÀ DEGLI STUDI DI PADOVA SEDE AMMINISTRATIVA: UNIVERSITÀ DEGLI STUDI DI PADOVA DIPARTIMENTO DI SCIENZE MEDICO-DIAGNOSTICHE E TERAPIE SPECIALI SCUOLA DI DOTTORATO DI RICERCA IN SCIENZE MEDICHE,

More information

Index. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305

Index. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305 Index 439 Index A Aequorin, 84, 94 Affinity precipitation, 372, 376 381 AP-1, 100 Asthma, 170, 305 B Bioassay, 185, comparison with ELISA, 318 GM-CSF bioassay, 351 IL-2 bioassay, 185 192, 300 IL-3 IL-6

More information

Contribution of microglia to tissue injury and repair in MS

Contribution of microglia to tissue injury and repair in MS Contribution of microglia to tissue injury and repair in MS MS disease course histologic features Courtesy of Samuel Ludwin I ACUTE CHRONIC s ACTIVE CHRONIC Clinical Course Intra CNS Extra CNS Imaging

More information

WHEN THERE S A NEED FOR EPIDERMIS

WHEN THERE S A NEED FOR EPIDERMIS WHEN THERE S A NEED FOR EPIDERMIS PRESS START The automated CELLUTOME Epidermal Harvesting System The CELLUTOME System is an innovative epidermal harvesting device which can be easily integrated into your

More information

Supplementary Material to Manuscript SREP A

Supplementary Material to Manuscript SREP A Supplementary Material to Manuscript SREP-15-29162A Monocyte-induced recovery of inflammation-associated hepatocellular dysfunction in a biochip-based human liver model Authors: Marko Gröger a,f,1, Knut

More information

Supplementary Methods

Supplementary Methods 1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 2 21 22 23 24 25 26 27 28 29 3 31 32 Supplementary Methods Gentamicin protection assay THP-1 monocytes were seeded onto a 12-well plate and differentiated

More information

Supplementary Material

Supplementary Material Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles

More information

The autocrine role of proteoglycan-4 (PRG4) in modulating osteoarthritic synoviocyte proliferation and expression of matrix degrading enzymes

The autocrine role of proteoglycan-4 (PRG4) in modulating osteoarthritic synoviocyte proliferation and expression of matrix degrading enzymes Alquraini et al. Arthritis Research & Therapy (2017) 19:89 DOI 10.1186/s13075-017-1301-5 RESEARCH ARTICLE Open Access The autocrine role of proteoglycan-4 (PRG4) in modulating osteoarthritic synoviocyte

More information

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time

More information

ESM Methods Preparation and characterization of human MAPC Marginal mass syngeneic islet transplantation diabetes model

ESM Methods Preparation and characterization of human MAPC Marginal mass syngeneic islet transplantation diabetes model ESM Methods Preparation and characterization of human MAPC Human MAPC (n=2) used in this study were isolated by ReGenesys BVBA (Athersys Inc. affiliate in Heverlee, Belgium) from bone marrow of a 30-year-old

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Nori Rabbit IL-2 ELISA Kit DataSheet

Nori Rabbit IL-2 ELISA Kit DataSheet Nori Rabbit IL-2 ELISA Kit DataSheet IL-2 is an interleukin, a type of cytokine immune system signaling molecule. IL-2 is a T cell stimulatory cytokine best known for inducing T cell proliferation, the

More information

4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.

4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation. List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph

More information

Human Umbilical Vein Endothelial Cell Manual

Human Umbilical Vein Endothelial Cell Manual Human Umbilical Vein Endothelial Cell Manual INSTRUCTION MANUAL ZBM0079.03 SHIPPING CONDITIONS Human Umbilical Vein Endothelial Cells, cryopreserved Cryopreserved cells are shipped on dry ice and should

More information

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236 Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±

More information

Data Package. Multiplex Oncology I 96 96

Data Package. Multiplex Oncology I 96 96 Data Package Multiplex Oncology I 96 96 Table of contents 1. Introduction 3 1.1 Technology 3 1.2 Data analysis 3 2. Performance characteristics 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection

More information

Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening

Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Introduction: Vimentin (VIM) intermediate filament (IF) proteins are associated with EMT in lung cancer and its metastatic

More information

Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression

Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression Jarad J Wilson, Ph.D. Technical Support & Marketing Specialist Ruo-Pan Huang, MD, Ph.D. Founder and CEO What are Antibody Arrays?

More information

Primary Adult Naïve CD4+ CD45RA+ Cells. Prepared by: David Randolph at University of Alabama, Birmingham

Primary Adult Naïve CD4+ CD45RA+ Cells. Prepared by: David Randolph at University of Alabama, Birmingham Primary Adult Naïve CD4+ CD45RA+ Cells Prepared by: David Randolph (drdrdr@uab.edu) at University of Alabama, Birmingham Goal: To obtain large numbers of highly pure primary CD4+ CD45RO- CD25- cells from

More information

Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of

Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular Chondrocytes by Paracrine Secretion Lei Xu, Yuxi Wu, Zhimiao Xiong, Yan Zhou, Zhaoyang Ye *, Wen-Song Tan * State Key Laboratory of

More information

RayBio Annexin V-FITC Apoptosis Detection Kit

RayBio Annexin V-FITC Apoptosis Detection Kit RayBio Annexin V-FITC Apoptosis Detection Kit User Manual Version 1.0 May 25, 2014 (Cat#: 68FT-AnnV-S) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll Free)1-888-494-8555 or

More information

nachr α 4 β 2 CHO Cell Line

nachr α 4 β 2 CHO Cell Line B SYS GmbH nachr α 4 β 2 CHO Cell Line Cell Culture Conditions B SYS GmbH B SYS GmbH nachr α 4 β 2 CHO Page 2 TABLE OF CONTENTS 1 BACKGROUND...3 1.1 Human Nicotinic Acetylcholine Receptors...3 1.2 B SYS

More information

Transduction of lentivirus to human primary CD4+ T cells

Transduction of lentivirus to human primary CD4+ T cells Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

Follicle Dermal Papilla Cell

Follicle Dermal Papilla Cell Follicle Dermal Papilla Cell Instruction Manual Product Size Catalog Number Human Follicle Dermal Papilla Cells (HFDPC) 500,000 cryopreserved cells 500,000 proliferating cells C-12071 C-12072 Product Description

More information

High Content Imaging : Meaningful pictures for relevant results in dermocosmetology

High Content Imaging : Meaningful pictures for relevant results in dermocosmetology High Content Imaging : Meaningful pictures for relevant results in dermocosmetology We deliver High Content screening services with exhaustive, high quality and robust phenotypic data. Nathalie MAUBON,

More information

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2 Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji

More information

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,

More information

FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH

FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH ALETA A SOURCE OF 1,3-BETA GLUCANS Aleta is highly bioavailable, offering a concentration greater than 5% of 1,3-beta glucans. Aleta provides a consistent response

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

Procaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk

Procaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.

More information

Low Cell Binding Property of LIPIDURE -COAT

Low Cell Binding Property of LIPIDURE -COAT Technical Note_1 ver.1 Low Cell Binding Property of LIPIDURE -COAT 1. LIPIDURE -COAT MULTI DISH A-6MD (Cat. No. 51011617) 2. Cell; NIH 3T3 (Fibroblast, mouse) 1. 10 %CS-DMEM; DMEM (Dulbecco's Modified

More information

HIV AND INFLAMMATION: A NEW THREAT

HIV AND INFLAMMATION: A NEW THREAT HIV AND INFLAMMATION: A NEW THREAT KAP ANNUAL SCIENTIFIC CONFERENC MAY 2013 DR JOSEPH ALUOCH FRCP,EBS Basic Components of the Immune System Immunology: cells and tissues involved in recognizing and attacking

More information

Cancer Biometrics: Results of the 2003 isbtc Workshop. Theresa L. Whiteside, Ph.D., ABMLI University of Pittsburgh Cancer Institute

Cancer Biometrics: Results of the 2003 isbtc Workshop. Theresa L. Whiteside, Ph.D., ABMLI University of Pittsburgh Cancer Institute Cancer Biometrics: Results of the 2003 isbtc Workshop Theresa L. Whiteside, Ph.D., ABMLI University of Pittsburgh Cancer Institute The workshop objective The objective was to consider state-of-theart approaches

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

Which molecules of the initial phase of wound healing may be used as markers for early detection of skin damage?

Which molecules of the initial phase of wound healing may be used as markers for early detection of skin damage? Which molecules of the initial phase of wound healing may be used as markers for early detection of skin damage? L.H. Cornelissen October 2004 BMTE 04.53 Promotor: prof.dr.ir. F.P.T. Baaijens Coach: dr.ir.

More information

Supplementary Figure 1

Supplementary Figure 1 CD31 FN Supplementary Figure 1 a Multivariate Cox regression analysis of predicting factors for disease-free and overall survival in 435 HNSCC patients b FN staining in whole sections of HNSCC c FN expression

More information

EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES

EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES JAMES M. ANDERSON, MD, PhD DISTINGUISHED UNIVERSITY PROFESSOR DEPARTMENTS OF PATHOLOGY, MACROMOLECULAR SCIENCE, AND BIOMEDICAL ENGINEERING CASE WESTERN

More information

Protein Arrays High Throughput Protein Quantification from Total Cell Lysates

Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Dr. Markus Ehrat Mr. Markus Tobler Zeptosens A Division of Bayer (Schweiz) AG Benkenstr. 254 CH-4108 Witterswil Switzerland

More information

CHAPTER INTRODUCTION

CHAPTER INTRODUCTION CHAPTER 6 IDENTIFICATION OF RHEUMATOID ARTHRITIS SIGNIFICANT TARGET PROTEINS AND THEIR PATHWAYS THROUGH THE COMBINATORIAL APPROACH (RA-GIM, RA-DTP AND MICROARRAY DATANALYSIS OF RA) 6.1 INTRODUCTION The

More information