VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart Liver WF BF Brain Kidney Lung Spleen Supplementary Figure a Nrc (GR) allele: wt G G8 exon exon G c.5..5 GR flox Skelal muscle KO b GR (G/G) GR (G/G8) wt Liver Heart 89 bp 76 bp bp d Skelal muscle TA Sol Heart Liver Cre 6B 5 6 7 8 9 5 57 bp 59 bp GR 5 6 7 8 9 kda Sol EDL PT WF BF GR (G/G) 89 bp GR (G/G8) Cre 76 bp 57 bp e f 9 6B 6 7 8 9 5 6 7 8 9 59 bp 75 8 5 7 GR (G/G) GR (G/G8) TA Brain Kidney Lung Spleen 89 bp 76 bp 5 6 5 Cre 57 bp 6B 59 bp Dark Light Total 5 6 7 8 9 5 g 75 5 5 h 75 5 5 i..9.8 j.7 Dark Light Total Dark Light Total Dark Light Total Dark Light Total
Supplementary Figure Whole body mabolic profiles of skelal muscle-specific GR knockout mice. (a) Nrc (GR) allele including exon and of wild type C57BL/6J (wt), Nrc tmgsc (flox) 6, and a consequence of Cre-mediated recombination (KO) are schematically depicted. Open triangles indicate loxp sites. Arrows indicate primers used for genomic PCR. (b) Skelal muscle actin (ACTA)-Cre transgenic mice 7 and GR-floxed (GR) mice were crossbred to give skelal muscle-specific GR knockout () mice, as described in Mhods. Genomic DNA from the indicated tissues of -week-old male wt, GR, and mice were analyzed with PCR to confirm skelal muscle-specific recombination of GR allele. Data from three independent animals of each genotype are shown. Skelal muscles and adipose tissues are abbreviated as (gastrocnemius), TA (tibialis anterior), Sol (soleus), EDL (extensor digitorum longus), PT (plantaris), WF (rroperitoneal fat depot as white fat), and BF (intrascapular fat depot as brown fat). (c) Expression levels of GR mrna in the indicated tissues from -week-old male GR (blue) and (red) mice. Data from quantitative reverse transcription PCR (qrt-pcr) analysis are normalized to 6B mrna levels and are shown as fold induction to expression levels in GR mice. Error bars represent mean ± SEM (n = 8). P <.5 dermined by two-tailed Student s t test for unpaired data. (d) Expression levels of GR protein in the indicated tissues from -week-old male GR and mice. Total tissue extracts were analyzed in immunoblotting, and representative data from independent animals are shown. (e) Basal locomotor activity of -week-old male GR and mice during h in the dark phase [zeitgeber time (ZT) -], during h in the light phase (ZT -), and during h of a whole day (Total, ZT -). Error bars represent mean ± SEM [n = 5 (GR) and n = ()]. (f) Body temperature of -week-old male GR and mice. Error bars represent mean ± SEM [n = 5 (GR) and n = ()]. (g-j) Resting oxygen consumption rates (g), carbon dioxide production rates (h), respiratory exchange ratios (i), and energy expenditures (j) during the time periods described in (e). Error bars represent mean ± SEM [n = 5 (GR) and n = ()]. P <.5 dermined by two-tailed Student s t test for unpaired data.
Percent fibres Percent fibres Relative mrna expression Relative mrna expression Relative mrna expression Supplementary Figure a 6 Liver REDD 5 Liver Fkbp5 b KLF5 8 FoxO FoxOa FoxO MuRF 8 5 DEX DEX - + - + - + - + atrogin- Bnip LC REDD 5 Fkbp5 6 8 5 DEX c d DEX p-mtor mtor p-s6k S6K p-e-bp E-BP actin GAPDH 5 6 7 8 (kda) 5 5 5 5 5 7 5 5 5 5 Fibre cross-sectional area (µm )
Supplementary Figure Restoration of skelal muscle from glucocorticoid-induced atrophy. (a, b) Eleven-week-old male GR and mice were injected i.p. with vehicle or dexamhasone (DEX) at mg/kg body weight daily for 7 days. Expression levels of the mrna in liver (a) and (b) were assessed with qrt-pcr. Data are normalized to 6B mrna levels and are shown as fold induction to expression levels in vehicle-treated GR mice. Error bars represent mean ± SEM (n = 8). P <.5 dermined by two-tailed Student s t test for unpaired data. (c) Expression and phosphorylation levels of the indicated proteins in from male GR and mice treated as described in (a) were assessed in immunoblotting. Data from independent animals of each treatment and genotype are shown. (d) Eleven-week-old male GR and mice were treated with vehicle or DEX as described in (a). Cross-sectional areas (CSA) of myofibres in vehicle-treated GR (top panel, blue), DEX-treated GR (top panel, purple), vehicle-treated (bottom panel, red), and DEX-treated (bottom panel, purple) are quantified ( < n < 5, from independent animals of each treatment and genotype) and their distributions in size are shown as frequency histograms.
Supplementary Figure Supplementary Figure Gross appearance of GR and mice. Representative photographs of 8-week-old male GR and mice.
Percent fibres Percent fibres Percent fibres Percent fibres Supplementary Figure a PT Sol MyHC IIb MyHC IIa MyHC IIa MyHC I TA EDL MyHC IIb MyHC IIa MyHC IIb MyHC IIa b 5 5 MyHC IIb (PT) MyHC IIa (PT) 5 MyHC IIa (Sol) MyHC I (Sol) Fibre cross-sectional area (µm ) Fibre cross-sectional area (µm ) 5 5 MyHC IIb (TA) MyHC IIa (TA) MyHC IIb (EDL) 5 MyHC IIa (EDL) 5 Fibre cross-sectional area (µm ) Fibre cross-sectional area (µm )
Supplementary Figure Fibre type-specific hypertrophy in mice skelal muscle. (a) Representative images of immunostaining for type IIb, IIa, and I myosin heavy chain (red in the panels indicated as MyHC IIb, MyHC IIa, and MyHC I, respectively) and type IV collagen (green) of serial transverse cryosections of indicated muscles from -week-old male GR and mice. Bars represent μm. (b) Myofibre CSA distribution in the indicated muscles from -week-old male GR (blue) and (red) are shown as frequency histograms ( < n <, from independent animals of each genotype).
HFD HAlaD HFD HAlaD Blood glucose (mg dl - ) Blood glucose (% of basal) x x min x % Plasma insulin (ng ml - ) Plasma C-peptide (ng ml - ) Blood glucose (mg dl - ) Supplementary Figure 5 b a IPGTT 8 Time after glucose IP (min) x x min x mg dl - AUC Fasted (h) Fasted (h) c IPITT 6 AUC 8 8 Time after insulin IP (min) d 6 IPGTT x x min x mg dl - 8 6 AUC 8 Time after glucose IP (min) Supplementary Figure 5 Plasma insulin and C-peptide levels and glucose homeostasis in GR and mice. (a) Plasma insulin (left panel) and C-peptide (right panel) levels of -week-old male GR and mice after fasting for the indicated time periods. Error bars represent mean ± SEM (n = 8). P <.5 dermined by two-tailed Student s t test for unpaired data. (b) Intraperitoneal glucose tolerance test (IPGTT) in -week-old male GR (blue) and (red) mice. Time course of blood glucose clearance (left panel) and area under the curve (AUC, right panel) are shown. Error bars represent mean ± SEM (n = ). (c) Intraperitoneal insulin tolerance test (IPITT) in -week-old male GR (blue) and (red) mice. Time course of blood glucose clearance (left panel) and AUC (right panel) are shown. Error bars represent mean ± SEM (n = ). (d) IPGTT in 5-week-old male GR and mice fed as described in the legend for Fig. a. Time course of blood glucose clearance (left panel) and AUC (right panel) of GR (blue) and (red) mice are shown. Solid lines and dotted lines correspond HAlaD- and HFD-fed mice, respectively. Error bars represent mean ± SEM (n = ). P <.5 dermined by twotailed Student s t test for unpaired data.
Supplementary Figure 6 Uncropped immunoblots. (a-h) Representative immunoblots of nuclear extracts (a, b) and cytoplasmic fractions (c-h) from mouse primary hepatocytes prepared and cultured as described in the legend for Fig. 8b. Antibodies for blotting are indicated at the right of each panel. Positions of molecular size markers are indicated at the left of each panel. Dotted boxes indicate positions of cropped data which are presented in Fig. 8c.
Supplementary Table. PCR Primers used in this study Primers for genotyping Name Sequence of primer (5'-') Cre aaatactctgagtccaaaccgggcccc Cre cagtgcgttcgaacgctagagcctgtt G ggcatgcacaattacggccttct G gtgtagcagccagcttacagga G8 ccttctcattccatgtcagcatgt Primers for quantitative reverse transcription PCR (qrt-pcr) Gene Forward primer (5'-') Reverse primer (5'-') 6B actggtctaggacccgagaag ctcccaccttgtctccagtc GR tgacgtgtggaagctgtaaagt catttcttccagcacaaaggt KLF5 acaggcgagaagcccttt catctgagcgggaaaacct FoxO cttcaaggataagggcgaca gacagattgtggcgaattga FoxOa gctaagcaggcctcatctca ttccgtcagtttgagggtct FoxO aaggacaagggtgacagcaa ctgtgcaaggacaggttgtg MuRF cctgcagagtgaccaagga ggcgtagagggtgtcaaact atrogin- agtgaggaccggctactgtg gatcaaacgcttgcgaatct Bnip cctgtcgcagttgggttc gaagtgcagttctacccaggag LC catgagcgagttggtcaaga ccatgctgtgctggttga REDD ccagagaagagggccttga ccatccaggtatgaggagtctt Fkbp5 aaacgaaggagcaacggtaa tcaaatgtccttccaccaca HSL ccatagtcaagaaccccttca atctagcatggggtccagag ATGL tgaccatctgccttccaga tgtaggtggcgcaagaca SREBPc cgggacagcttagcctctac ggtacgggccacaagaagta FASN gcagtcctgagcagctttgt cgaggtctcggatgccta DGAT ggcgctacttccgagactac tggtcagcaggttgtgtgtc PGC-α gaaagggccaaacagagaga gtaaatcacacggcgctctt Ucp ggcctctacgactcagtcca taagccggctgagatcttgt Cidea aaaccatgaccgaagtagcc aggccagttgtgatgactaagac To be continued to the next page
Continued from the previous page Primers for qrt-pcr (continued) Gene Forward primer (5'-') Reverse primer (5'-') FGF cacaccgcagtccagaaag tgacacccaggatttgaatg ALT ccttcaagcagtttcaagca gctccgtgagtttagccttg ALT tatgcgttccctcggattc ggagccattttatgggactg cpta gcagtcgactcacctttcct atttctcaaagtcaaacagttcca cptb cccaaaacagtatcccaatcat taagagaccccgtagccatc cpt ccaaagaagcagcgatgg tagagctcaggcagggtga CACT ttgtacaaagggttcaatgcag ggcaatttcaaagccaagg Fatp aaggttcttgcatcctatgctc tggatcttgaaggtgcctgt TAT ggaggaggtcgcttcctatt gccactcgtcagaatgacatc Pck gatgacattgcctggatgaa cgttttctgggttgatagcc Primers for chromatin immunoprecipitation (ChIP) Name Forward primer (5'-') Reverse primer (5'-') TIS (FGF +/+88) gacagccttagtgtcttctc tgggtcaggttcagactgg Coding (FGF +68/+76) catgcactcccccttggc cccttcacatatgtcaagatg Control (FGF -66/-655) tcagcatgcctccaaagc tcagccttgaggaagagtagaca ATFRE (FGF -6/-98 gcaggacgctgtctggtg gcttagcattcgggccttg ATFRE (FGF -68/-8) ttcagacccctgttggaaag cacacttggcaggaacctgaat PPRE (FGF -998/-9) aaggcccgaatgctaagc agcccagcaggtggaagtct PPRE (FGF -9/-) cggtggaattcaggttcctg agacaggcccgcccacg
Supplementary Table. Antibodies used in this study Antibodies for immunoblotting Antigen Supplier Catalogue number Dilution GR SCB sc- :5 S6K SCB sc- : ATF (CREB) SCB sc- : GAPDH SA G655 :5 actin SA A :5 PPARα Abc ab779 : E-BP CST #95 : p-s6k (T89) CST #95 : p-e-bp (T7/6) CST #855 : p-mtor (S8) CST #556 : mtor CST #97 : p-eifα (S5) CST #98 : eifα CST #5 : p-ampkα (T7) CST #55 : AMPKα CST #5 : Antibodies for ChIP Antigen Supplier Catalogue number Dilution RNA polymerase II Cov MMS-6R 5 μg IgG for.5 x 6 cells ATF (CREB) SCB sc- 5 μg IgG for.5 x 6 cells PPARα Abc ab779 5 μg IgG for.5 x 6 cells Antibodies for indirect immunofluorescent staining Antigen Supplier Catalogue number Clone Dilution collagen type IV Mil AB756P - : type IIb myosin heavy chain OG - BF-F :5 type IIa myosin heavy chain OG - SC-7 : type I myosin heavy chain OG - BA-D5 :6 Abbreviations used in Table : SCB (Santa Cruz Biotechnology, Santa Cruz, CA); SA (Sigma-Aldrich, St. Louis, MO); CST (Cell Signaling Technology, Danvers, MA); Cov (Covance, Princon, NJ); Mil (Millipore, Billerica, MA); and OG (Our group)