Normal Skin. Tissue Samples and Melanoma Cell Lines. BRAF Mut. RAS Mut RAS WT /BRAF WT

Similar documents
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

MERTK receptor tyrosine kinase is a therapeutic target in melanoma

Melanoma-specific MHC-II expression represents a tumour-autonomous phenotype and predicts response to anti-pd-1/pd-l1 therapy

Systematic approaches to. overcoming limitations of MAPK pathway inhibition in melanoma.

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

SUPPLEMENTARY INFORMATION

Relative Rates. SUM159 CB- 839-Resistant *** n.s Intracellular % Labeled by U- 13 C-Asn 0.

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

SUPPLEMENTARY INFORMATION

Supplementary Figures

Supplemental information

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855

Supplementary Figures

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

CAN Resubmission SUPPLEMENTAL INFORMATION

Supplemental Information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Figure 1

Supplementary Information

Pushing the boundaries-targeted therapies

Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

SUPPLEMENTARY INFORMATION

Supplemental Figure S1A Notch1

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

SUPPLEMENTARY FIGURES

P-Rex1 is required for efficient melanoblast migration and. melanoma metastasis

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

SUPPLEMENTARY FIGURES

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Materials for

Nature Medicine: doi: /nm.4078

Supplementary Information

F-actin VWF Vinculin. F-actin. Vinculin VWF

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Plasma exposure levels from individual mice 4 hours post IP administration at the

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

Supplementary Figure 1

Supplementary Information Titles Journal: Nature Medicine

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supplementary Figure 1

Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Supplementary Materials for

Supplementary methods:

Supplementary Data Table of Contents:

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

SUPPLEMENTAL FIGURE LEGENDS

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplemental figures

Supplementary Figure S1 Supplementary Figure S2

Supplementary Figure 1

MERTK: A NOVEL TARGET IN NON-SMALL CELL LUNG CANCER CHRISTOPHER T. CUMMINGS. B.S., University of Nebraska, Lincoln, 2009

Table S1: Analysis of Notch gene rearrangements in triple negative breast cancer subtypes

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplementary Data Cyclophilin B Supports Myc and Mutant p53 Dependent Survival of Glioblastoma Multiforme Cells

SUPPLEMENTARY INFORMATION

Table 1. Clinicopathological features of melanoma samples (shown in Fig. 2) exhibiting higher XYZ mrna levels.

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

Blocking c-met mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

SUPPLEMENTARY INFORMATION

Supporting Information

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

Supplementary Materials for

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Information

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

SUPPLEMENTARY FIGURES

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Transcription:

Supplemental Figure 1. MERTK gene expression in melanoma cell line panel from Cancer Cell Line Encyclopedia. A. Microarray analysis of melanoma cell lines from UNC collection grouped by oncogenic mutation. (ns=not significant) B. Microarray analysis of normal human skin and melanoma cell lines from CCLE collection for MERTK transcript levels. Melanoma cell lines were grouped by oncogenic mutation status. Dotted line represents average MERTK expression in normal skin. C. CCLE collection was analyzed for MERTK expression with respect to oncogenic mutations in RAS and BRAF. A Relative MERTK Gene Expression 15 10 5 0 RAS WT /BRAF WT ns ns RAS Mut BRAF Mut B Relative MERTK Gene Expression (log 2, RMA normalized) 12 8 4 Normal Skin RAS WT /BRAF WT RAS Mut BRAF Mut C Relative MERTK Gene Expression (log 2, RMA normalized) 15 10 5 0 RAS WT /BRAF WT ns ns RAS Mut BRAF Mut 0 Tissue Samples and Melanoma Cell Lines

Supplemental Figure 2. MERTK is heavily glycosylated at Asn residues. Western blot of melanoma cell lysates treated with control buffer or PNGase F. Actin was detected as a loading control. 250kD- 150kD- 100kD- 50kD- 37kD- HMCB SKMEL119 G361 SKMEL5 - + - + - + - + MERTK Actin

Supplemental Figure 3. GAS6 activation of SKMEL119 and SKMEL5. Western blot of phospho- and total STAT6, AKT and ERK. Cell cultures were stimulated with GAS6 and whole cell lysates were evaluated by western blot analysis. Actin was probed as a loading control. GAS6: SKMEL119 SKMEL5 - + - + p-stat6 STAT6 p-akt AKT p-erk ERK Actin

Supplemental Figure 4. SKMEL119 MERTK knockdown cell lines and migration. A. MERTK protein expression in SKMEL119 cell lines stably expressing shrna against MERTK. Whole cell lysates from indicated cell lines were analyzed via western blot for MERTK protein expression. Actin was detected as a loading control. B. Migration of SKMEL119. Live-cell imaging of shcontrol and shmertk4 cells plated on a fibronectin surface was performed for 16 hours and migration distance per unit time was determined. Mean values and standard errors were determined for 22 cells (*p<0.05, Student s two-tailed t-test). A SKMEL119 B SKMEL119 Migration shcontrol shmer4 MERTK Actin Velocity (microns/sec) 40 30 20 10 * 0 shcontrol shmertk4

Supplementary Information Supplemental Table 1. MERTK mrna expression in patient tissues. Tissue Category Sample Description Normal Skin GSM183299 7.81031 Normal Skin GSM183301 7.32349 Normal Skin GSM183302 7.30608 Normal Skin GSM183234 6.47147 Normal Skin GSM183300 6.10653 Primary Melanoma GSM183235 8.89009 Primary Melanoma GSM183258 8.5472 Primary Melanoma GSM183225 7.89253 Primary Melanoma GSM183262 7.89024 Primary Melanoma GSM183261 7.86807 Primary Melanoma GSM183259 7.79514 Primary Melanoma GSM183263 7.36155 Primary Melanoma GSM183266 7.31556 Primary Melanoma GSM183260 7.2708 Primary Melanoma GSM183304 7.16972 Primary Melanoma GSM183264 7.13941 Primary Melanoma GSM183303 6.87686 Primary Melanoma GSM183224 6.48551 Primary Melanoma GSM183265 6.39586 Metastatic Melanoma GSM183281 10.5761 Metastatic Melanoma GSM183255 10.1251 Metastatic Melanoma GSM183276 9.71227 Metastatic Melanoma GSM183292 9.70506 Metastatic Melanoma GSM183282 9.41463 Metastatic Melanoma GSM183274 9.07661 Metastatic Melanoma GSM183295 9.06875 Metastatic Melanoma GSM183297 8.87435 Metastatic Melanoma GSM183285 8.77834 Metastatic Melanoma GSM183290 8.5476 Metastatic Melanoma GSM183275 8.53924 Metastatic Melanoma GSM183291 8.52461 Metastatic Melanoma GSM183230 8.45611 Metastatic Melanoma GSM183229 8.24115 Metastatic Melanoma GSM183233 8.23224 Metastatic Melanoma GSM183253 8.2213 Metastatic Melanoma GSM183254 8.1909 Metastatic Melanoma GSM183289 8.16429 Metastatic Melanoma GSM183284 8.16311 Metastatic Melanoma GSM183232 7.95741 Metastatic Melanoma GSM183296 7.94438 Metastatic Melanoma GSM183231 7.94274 Relative MERTK Gene Expression (log 2, RMA Normalized)

Metastatic Melanoma GSM183257 7.90872 Metastatic Melanoma GSM183278 7.90606 Metastatic Melanoma GSM183252 7.88016 Metastatic Melanoma GSM183256 7.79471 Metastatic Melanoma GSM183277 7.76584 Metastatic Melanoma GSM183294 7.75989 Metastatic Melanoma GSM183298 7.55289 Metastatic Melanoma GSM183286 7.53542 Metastatic Melanoma GSM183228 7.51317 Metastatic Melanoma GSM183273 7.47497 Metastatic Melanoma GSM183293 7.4459 Metastatic Melanoma GSM183287 7.43995 Metastatic Melanoma GSM183283 7.26889 Metastatic Melanoma GSM183279 7.24974 Metastatic Melanoma GSM183227 7.15013 Metastatic Melanoma GSM183280 6.72243 Metastatic Melanoma GSM183288 6.71319 Metastatic Melanoma GSM183226 6.47676

Supplemental Table 2. MERTK mrna expression in melanoma cell lines from the UNC collection. Mutation Status Sample Description Relative MERTK Gene Expression NHM NHM 13 PMA 3.6417 NHM NHM 17 PMA 3.5485 NHM NHM 11 PMA 3.0749 WT HMCB 9.9604 WT WM 1232 7.5040 WT MALME-3 7.0586 WT SKMEL 88/ SKMEL 78 5.6401 WT SKMEL 23 5.6018 WT PMWK 4.1281 WT MEL 505 3.6209 WT MEL 537 3.6013 WT SKMEL 187 2.4419 WT WM 1361a 2.3584 WT SBC 12 2.0572 RAS SKMEL 173 5.1501 RAS VMM 39 5.0795 RAS SKMEL 119 4.8010 RAS SKMEL 103 4.5510 RAS SKMEL 147 2.5529 RAS SKMEL 224 2.1275 RAS SKMEL 186 1.4513 BRAF SKMEL 27 8.3464 BRAF UACC 257 6.6061 BRAF SKMEL 239 5.3333 BRAF SKMEL 28 5.0734 BRAF A2058 4.7617 BRAF SKMEL 181 4.4504 BRAF SKMEL 100 4.4352 BRAF WM 2664 3.4700 BRAF SKMEL 190 3.3711 BRAF SKMEL 15 3.2296 BRAF WM 1158 2.5297 BRAF SKMEL 235 2.3964 BRAF WM 35 2.3310 BRAF A375 2.1714 BRAF RPMI 7951 2.1681 BRAF SKMEL 153 1.8880 BRAF SKMEL 24 1.7421 BRAF SKMEL 130/ SKMEL 178 1.3981

Supplemental Table 3. MERTK gene expression in normal skin and melanoma cell lines from CCLE database. Tissue Category/ Sample Mutation Status Description Normal Skin GSM183299 6.8627 Normal Skin GSM183302 6.1183 Normal Skin GSM183301 6.0522 Normal Skin GSM183234 5.6033 Normal Skin GSM183300 5.0473 WT HMCB/CHL1 9.7346 WT COLO792 9.0746 WT MEWO 7.4973 WT HS895T 4.9343 WT HS839T 4.8006 WT HS600T 4.7164 WT HS940T 4.6128 WT HS834T 4.3250 WT HS688AT 4.2566 WT IPC298 4.1898 WT HS934T 4.1301 RAS SKMEL30 7.2719 RAS HS944T 7.0218 RAS HS936T 6.7228 RAS CJM 6.4951 RAS SKMEL2 5.7292 RAS MELJUSO 5.0421 RAS HS852T 4.4099 BRAF SKMEL5 11.1598 BRAF G361 10.4933 BRAF K029AX 9.8488 BRAF MALME3M 9.4500 BRAF SKMEL3 9.2917 BRAF UACC257 8.3709 BRAF SH4 8.0392 BRAF COLO829/ 7.9954 COLO849 BRAF SKMEL28 7.7812 BRAF IGR37 7.6579 BRAF WM88 7.2727 BRAF SKMEL1 7.1471 BRAF COLO679 6.7632 BRAF COLO741 6.1969 BRAF A101D 6.0241 BRAF UACC62 5.8960 BRAF MELHO 5.8174 BRAF COLO818/ 5.4273 Relative MERTK Gene Expression (log 2, RMA Normalized)

COLO800 BRAF HT144 5.3742 BRAF C32 5.0307 BRAF A2058 4.6711 BRAF RPMI7951 4.5466 BRAF LOXIMVI 4.4915 BRAF WM793 4.4556 BRAF MDAMB435S 4.4318 BRAF WM2664 4.4376 BRAF WM115 4.4256 BRAF WM1799 4.3444 BRAF WM983B 4.3398 BRAF COLO783 4.2661 BRAF A375 4.1476 BRAF SKMEL24 4.1531 BRAF HS695T 4.1825 BRAF IGR39 3.9197 Supplemental Table 4. Antibodies utilized for western blot. Antibody Company Product Number MERTK Epitomics/UNC 1633-1 / N14 Actin Santa Cruz SC-1616 TYRO3 Cell Signaling 5585 AXL R&D Systems AF154 GAPDH Cell Signaling 2118 p-stat6 Cell Signaling 9364 STAT6 Cell Signaling 9362 p-akt Cell Signaling 9271 AKT Cell Signaling 9272 p-erk Cell Signaling 9106 ERK Cell Signaling 9102 PARP Cell Signaling 9542

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback