SUPPLEMENTARY FIGURES AND TABLES

Similar documents
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Nature Neuroscience: doi: /nn Supplementary Figure 1

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Supplementary Information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen

Supplementary Figure 1

Supplementary Figures

Cinacalcet inhibits neuroblastoma tumor growth and upregulates cancer-testis antigens

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Materials

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Plasma exposure levels from individual mice 4 hours post IP administration at the

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

SUPPLEMENTARY INFORMATION

Nature Medicine: doi: /nm.4078

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supporting Information Table of Contents

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

SUPPLEMENTARY INFORMATION

Prolonged mitotic arrest induces a caspase-dependent DNA damage

Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

Inhibition of fatty acid oxidation as a therapy for MYC-overexpressing triplenegative

Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Supplemental information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

SUPPLEMENTARY INFORMATION

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Materials for

Supplementary Materials for

Supplemental Material

Supplementary Figures

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Supplementary Table 1. List of primers used in this study

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary Figure 1

Supplementary figures

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated

Supplementary Information and Figure legends

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Expanded View Figures

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

Supplementary Materials for

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Supplementary Information

Supplementary material. Supplementary Figure legends

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Supplemental Figures:

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Supplementary Materials for

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY FIGURES

Supplementary Materials for

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Figure S1. Figure S2. Figure S3.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections

Supplementary Materials for

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

SUPPLEMENTARY MATERIAL

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.

Transcription:

SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non amplified neuroblastoma (MNA-NB) that generated a patient-derived xenograft. Western blot was conducted to analyze CaSR expression. Kidney was used as positive control. B. Fluorescence microphotography showing SH-SY5Y cells following stable transfection with pcmv-gfp or pcmv-casr-gfp. C. Total RNA was isolated from LA-N-1 cells, and SK-N-LP, SK-N-JD and SH-SY5Y cell lines following stable transfection with pcmv-gfp or pcmv-casr-gfp. Analysis of CaSR mrna expression was conducted by RT-qPCR. Expression levels were calculated as a fold change relative to mrna expression detected in LA-N-1 cells and are the mean of two independent qpcr runs.

Supplementary Figure S2: Cinacalcet induces ER stress in CaSR-positive, MYCN-amplified neuroblastoma cell lines. A. SK-N-LP cells stably transfected with pcmv-casr-gfp were exposed to 6 μm cinacalcet following serum deprivation in 3 mm CaCl 2 for indicated periods of time and lysed for Western blot analyses. Densitometry was carried out to quantify protein expression relative to α-tubulin levels (right). B. SK-N-LP cells stably transfected with pcmv-gfp or pcmv-casr-gfp were exposed to 1 μm cinacalcet for indicated periods of time as described in panel A, and lysed for Western blot analysis. Graph (right) shows mean values of three independent experiments. ATF4 increase at 24 hours was statistically significant (P < 0.01, two-tailed Student s t-test). C. SH-SY5Y cells stably transfected with pcmv-gfp or pcmv-casr-gfp were exposed to cinacalcet in serum deprivation media or 1 μm staurosporine for 24 hours in the presence of 0.5 or 3 mm CaCl 2. Cells were lysed to perform immunoblots. D. CaSR-positive and -negative SH-SY5Y cells were exposed to cinacalcet after serum deprivation as described in C, in the presence or absence of 100 nm U73122 and then lysed to conduct Western blots. Data showed in panels A, C and D are representative of at least two independent experiments.

Supplementary Figure S3: Neuroblastoma cell viability following exposure to cinacalcet. A. Six neuroblastoma cell lines, HEK-293 cells and human fibroblasts were exposed cinacalcet or another calcimimetic, NPS R-568, in 96-well plates for 72 hours. Six replicate wells were seeded for each cell line and condition. Cell viability was measured with CellTiter 96 Aqueous Cell proliferation Assay. IC 50 concentrations were determined with GraphPad Prism software. B. LA-N-1 cells were seeded in 96-well plates and exposed to cinacalcet (doses ranging from 3 to 12 μm) for 5 days. Cells were stained daily with crystal violet and proliferation rates were calculated as a fold increase of absorbance measurement relative to day 1. C. The effect of cinacalcet on proliferation rates, measured as in panel B, was compared in CaSR-positive cells (LA-N-1 and SK-N-JD CaSR-positive cells) and CaSR-negative (SK-N-JD and SK-N-AS) cells. The mean of two experiments is shown. D. LA-N-1 cells were exposed to cinacalcet in the presence or absence of 20 μm Z-VAD-FMK for 48 hours. Cell viability was measured with MTS assays. E. CaSR-negative SK-N-JD cells were grown and analyzed in the conditions described in panel D. Data presented in the five panels are representative of at least two independent experiments.

Supplementary Figure S4: Gene expression analyses in cinacalcet-treated neuroblastoma xenografts. A. Total RNA was isolated from LA-N-1 xenografts of the first survival experiment. Gene expression analyses were performed by RT-qPCR. Statistical significance was calculated using two-tailed Mann-Whitney U test to compare all cinacalcet- (n=12) and vehicle-treated (n=11) xenografts. Unpaired Student t-test was used to compare the three xenografts exposed to the longest period of cinacalcet treatment (C9-C11) to all controls (n=12). B. CaSR mrna was analyzed by RT-qPCR in vehicle- and cinacalcet-treated LA-N-1 xenografts. C. Western blot was conducted to analyze CaSR protein expression in MYCN-amplified xenografts and PDX.

Supplementary Figure S5: Genome-wide expression analyses of murine genes in cinacalcet-treated LA-N-1 xenografts. A. Total RNA was isolated from LA-N-1 xenografts that received either cinacalcet or vehicle in the first survival experiment. Heat map depicts murine gene expression patterns in these samples. B. Network generated with Ingenuity Pathways Analysis to represent modulated pathways in murine cells upon cinacalcet treatment.

Supplementary Table S1: Primers sequences and assays-on-demand used for RT-qPCR. See Supplementary File 1 Supplementary Table S2: First sheet: Genome-wide human gene expression analysis in LA-N-1 xenografts exposed to vehicle (n=8) or cinacalcet (n=7). Second sheet: Genome-wide human gene expression analysis in LA-N-1 xenografts exposed to vehicle (n=8) or prolonged treatment with cinacalcet (n=3, C9-C11). Third sheet: Genome-wide murine gene expression analysis in LA-N-1 xenografts exposed to vehicle (n=8) or cinacalcet (n=7). See Supplementary File 2 Supplementary Table S3: First sheet: Gene Ontology (GO) analysis to identify biological processes in modulated genes upon prolonged exposure to cinacalcet in LA-N-1 xenografts. Second sheet: Ingenuity Pathways Analysis to identify molecular pathways promoted in LA-N-1 xenografts upon prolonged exposure to cinacalcet. Third sheet: GO analysis to identify biological processes in murine genes modulated in LA-N-1 xenografts following cinacalcet treatment. Fourth sheet: Ingenuity Pathways Analysis to identify molecular pathways in murine gene expression changes promoted by cinacalcet in LA-N-1 xenografts. See Supplementary File 3