The corrected Figure S1J is shown below. The text changes are as follows, with additions in bold and deletions in bracketed italics:

Similar documents
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

H3K4me3 Breadth Is Linked to Cell Identity and Transcriptional Consistency

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.

Nature Structural & Molecular Biology: doi: /nsmb.2419

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

Supplementary Figures

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Table S1. Total and mapped reads produced for each ChIP-seq sample

Chromatin marks identify critical cell-types for fine-mapping complex trait variants

Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data

MIR retrotransposon sequences provide insulators to the human genome

Mechanisms of alternative splicing regulation

Peak-calling for ChIP-seq and ATAC-seq

Nature Genetics: doi: /ng Supplementary Figure 1

Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1

Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.

Inference of Isoforms from Short Sequence Reads

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.

Chip Seq Peak Calling in Galaxy

The Epigenome Tools 2: ChIP-Seq and Data Analysis

Computational Modeling of mirna Biogenesis

Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1

Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing

High Throughput Sequence (HTS) data analysis. Lei Zhou

Package NarrowPeaks. August 3, Version Date Type Package

Results. Abstract. Introduc4on. Conclusions. Methods. Funding

Session 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016

mirna-guided regulation at the molecular level

Heintzman, ND, Stuart, RK, Hon, G, Fu, Y, Ching, CW, Hawkins, RD, Barrera, LO, Van Calcar, S, Qu, C, Ching, KA, Wang, W, Weng, Z, Green, RD,

Histone Modifications Are Associated with Transcript Isoform Diversity in Normal and Cancer Cells

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

Computational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory

Figure S1, Beyer et al.

STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells

REVIEWERS' COMMENTS: Reviewer #1 (Remarks to the Author):

Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder Labs August 30, 2012

MODULE 3: TRANSCRIPTION PART II

Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016

ChIP-seq analysis. J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant, M. Thomas-Chollier, O.Sand

Genome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Inferring Biological Meaning from Cap Analysis Gene Expression Data

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca

EXTENDED DATA FORMATTING GUIDE

Supplementary Information

Reconstruction of enhancer-target networks in 935 samples of human primary cells, tissues and cell lines

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well

The Alternative Choice of Constitutive Exons throughout Evolution

Yingying Wei George Wu Hongkai Ji

Cross species analysis of genomics data. Computational Prediction of mirnas and their targets

Supplemental Materials

Expanded View Figures

Integrated analysis of sequencing data

TITLE: The Role Of Alternative Splicing In Breast Cancer Progression

Supplementary Figures

H3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Cluster Dendrogram. dist(cor(na.omit(tss.exprs.chip[, c(1:10, 24, 27, 30, 48:50, dist(cor(na.omit(tss.exprs.chip[, c(1:99, 103, 104, 109, 110,

Intragenic Enhancers Act as Alternative Promoters

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression

Supplement to SCnorm: robust normalization of single-cell RNA-seq data

Lecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

REACTIN: Regulatory activity inference of transcription factors underlying human diseases with application to breast cancer

Supplementary Figure 1 IL-27 IL

SUPPLEMENTARY FIGURE 1: f-i

Recruitment of HBO1 Histone Acetylase and Blocks

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supporting Information

Constitutive AP-1 Activity and EBV Infection Induce PD-L1 in Hodgkin. Lymphomas and Post-transplant Lymphoproliferative Disorders:

Additional file: Cell cycle, oncogenic and tumor suppressor pathways regulate numerous long and macro non-protein coding RNAs

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells

SUPPLEMENTARY INFORMATION

Alternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6

SUPPLEMENTARY INFORMATION

The Emergence of Alternative 39 and 59 Splice Site Exons from Constitutive Exons

SUPPLEMENTARY INFORMATION

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays

Supplementary Information. Supplementary Figures

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Sudin Bhattacharya Institute for Integrative Toxicology

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.

Obstacles and challenges in the analysis of microrna sequencing data

NEUROBLASTOMA DATA -- TWO GROUPS -- QUANTITATIVE MEASURES 38 15:37 Saturday, January 25, 2003

Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation

SCIENCE CHINA Life Sciences

Large-Scale Discovery of Enhancers from Human Heart Tissue

STATISTICS AND RESEARCH DESIGN

The common colorectal cancer predisposition SNP rs at chromosome 8q24 confers potential to enhanced Wnt signaling

Title: A robustness study of parametric and non-parametric tests in Model-Based Multifactor Dimensionality Reduction for epistasis detection

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Nature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms.

NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION. Ana M. Martinez

Supplementary information for: Human micrornas co-silence in well-separated groups and have different essentialities

Transcription:

Correction H3K4me3 readth Is Linked to Cell Identity and Transcriptional Consistency érénice A. enayoun, Elizabeth A. Pollina, Duygu Ucar, Salah Mahmoudi, Kalpana Karra, Edith D. Wong, Keerthana Devarajan, Aaron C. Daugherty, Anshul. Kundaje, Elena Mancini, enjamin C. Hitz, Rakhi Gupta, Thomas A. Rando, Julie C. aker, Michael P. Snyder, J. Michael Cherry, and Anne runet* *Correspondence: anne.brunet@stanford.edu http://dx.doi.org/1.116/j.cell.215.1.51 (Cell 158, 673 688, July 31, 214) Our paper reported that broad H3K4me3 domains in a given cell type are associated with genes that are important for the identity/function of that cell type and that they are associated with increased transcriptional consistency, but not increased expression. It has come to our attention that we made a programming error in the code used to generate Figure S1J. When the code is corrected, the top 5% broadest H3K4me3 domains display a statistically significant increased expression compared to the rest of the distribution (see corrected Figure S1J below). In addition, if one uses the rank-based Spearman correlation instead of the Pearson correlation we had used, H3K4me3 breadth exhibits a positive correlation with gene expression. Thus, the correct conclusion is that broad H3K4me3 domains are, on average, more expressed than non-broad H3K4me3 domains. This error does not affect our conclusions that H3K4me3 breadth is associated with cell identity and transcriptional consistency. However, we acknowledge that the increased transcriptional consistency of genes marked by broad H3K4me3 domains could be due to their increased average expression, as normalized transcriptional variability and average expression have been observed to be anti-correlated. The corrected Figure S1J is shown below. The text changes are as follows, with additions in bold and deletions in bracketed italics: Summary: Indeed, genes marked by the broadest H3K4me3 domains exhibit enhanced transcriptional consistency and [rather than] increased transcriptional levels. Page 674, second paragraph of Results: H3K4me3 breadth quantiles did not linearly correlate with mrna levels (Figures 1D and 1E, Pearson correlation). However, H3K4me3 breadth showed positive rank correlation with mrna levels (R.19-.31, Spearman correlation). In addition, the top 5% broadest H3K4me3 domains were more highly expressed on average compared to the rest of the distribution (Figure S1J) [even when comparing the most extreme example to the rest of the distribution (Figure S1J)]. Thus, broad H3K4me3 domains are present in many cell types across taxa but cannot be explained as simple readouts of promoter complexity [or high expression levels]. Figure 1 title: readth Is an Evolutionarily Conserved Feature [that Is Not Predictive of Expression Levels] After we identified this programming error, we had the entire manuscript and lines of code independently scrutinized. This process identified the following inadvertent errors that do not affect our conclusions but that we would like to correct. In Figures 1E and S6A, there was an incorrect attribution of datasets (C2C12 myotubes for myoblasts and H1 hesc population for single cells). The corrected Figures 1E and S6A are shown below. The conclusions are not changed. In Figures 7D, 7E, 7G, and S7L, the statistical analyses were done using two different tests (one-sided one-sample and one-sided two-sample Wilcoxon tests), but only one set of p values was reported in the original panels, and the corresponding statistical tests were not appropriately described. Results from both tests are shown in updated Figures 7D, 7E, 7G, and S7L. Upper p values (7D, 7G), black lines (7E, S7L): one-sided two-sample Wilcoxon tests for increased variability between genes with maintained versus changed H3K4me3 breath. Lower p values (7D, 7G), gray lines (7E, S7L): one-sided one-sample Wilcoxon tests for increased variability between genes with changed H3K4me3 breadth versus the expectation of no change in variability. The overall conclusions are not changed. Cell 163, 1281 1286, November 19, 215 ª215 Elsevier Inc. 1281

We sincerely regret these errors and apologize for any inconvenience they may have caused. We would also like to thank Wei Li and Kaifu Chen from the aylor College of Medicine for alerting us to the discrepancy between the Pearson and Spearman correlation results and for helping us to identify the error in Figure S1J. A Distribution of H3K4me3 ChIP-seq peaks in Distribution of H3K4me3 ChIP-seq peaks in C2C12 myotubes Number of ChIP-seq peaks (Density of distribution) 15 1 5 chr13 83 1 kb chr11 63,755, 63,76, 63,765, 86 chr9 11,25, 11,255, 2 OTU1 1,635, 1,64, 1,645, ZIC2 KLF4 5 1 15 2 H3K4me3 breadth (kb) C H3K4me3 signal around transcription start sites Number of ChIP-seq peaks (Density of distribution) 12 9 6 3 chr17 34,255, 1 5 1 15 2 H3K4me3 breadth (kb) Metazoans Metaphytes Fungi Mammals Human Mouse D. melanogaster C. elegans A. thaliana S. cerevisiae HeLa-S3 C2C12 myotubes S2 cells Embryos Leaves Cells chr7 1 1 kb chr7 134,515, 134,525, 1 Zfp747 74,51, 74,52, Mef2a 34,265, rd2 H3K4me3 domain breadth -5kb +5kb -5kb +5kb -5kb +5kb -5kb +5kb -5kb +5kb -5kb +5kb -5kb +5kb -5kb +5kb D H3K4me3 breadth and mrna levels () mrna levels (FPKM) 1 9 1 6 1 3-95% broad H3K4me3 domains Cell population R ~.128 2 4 6 8 1 1 2 1-1 1-4 Single cells 1-7 R ~.533 2 4 6 8 1 E H3K4me3 breadth and mrna levels (C2C12 myoblasts) mrna levels (FPKM) 1 12 1 9 1 6 1 3 1-95% broad H3K4me3 domains Cell population Single cells R ~.97 2 4 6 8 1 1 2 1-1 1-4 1-7 R ~.391 2 4 6 8 1 Figure 1. H3K4me3 readth Is an Evolutionarily Conserved Feature 1282 Cell 163, 1281 1286, November 19, 215 ª215 Elsevier Inc.

A C D E F G H Figure 7. Experimental Perturbation of H3K4me3 readth Results in Changes to Transcriptional Consistency Cell 163, 1281 1286, November 19, 215 ª215 Elsevier Inc. 1283

chr16 1M 5M M 5M M M M 5M M M 1M 5M M M A Skewness of breadth distribution H. sapiens (99) Skewed distribution.4 Symmetric distribution M. musculus (74) E MACS2 HOMER QuEST CCAT Liver 673 182 69 67 555 54 719 one marrow Myotubes HOMER.947 QuEST.844.851 C Read density and breadth () 95th percentile Read density per bp of MACS peak (tag per bp)..5 1. 1.5 2. 2 4 6 8 1 H3K4me3 breadth quantile Spearman rank correlation of H3K4me3 breadth CCAT.839.836.715 SICER.882.873.799.863 chr17 chr15 chr18 5M M chr19 5M M M 5M D Read density per bp of MACS peak (tag per bp) chr2 M 5M M Read density and breadth (C2C12 myotubes) 95th percentile M 5M chr21 chr22..2.4.6.8 1. M chrx 5M 2 4 6 8 1 H3K4me3 breadth quantile F Genomic localization in 1M 15M chry 5M chr1 1M 15M 2M M 5M chr2 Top 5% broadest H3K4me3 domains 1M 15M 2M M 5M 1M chr3 15M M 5M 1M 15M 5M 1M 15M chr4 chr5 1.5 1..5. all pairs correlated with p < 2.2E-38 chr14 1M 5M M 1M 15M M 5M 1M chr6 chr13 5M 1M 5M M 15M chr12 M 1M 5M M 1M 5M 1M 5M M 1M 5M chr8 chr11 chr7 G H3K4me3 breadth and gene length H -95% broad H3K4me3 domains I Associated gene length (kb) H3K4me3 breadth and TSS usage from PolII-ChIP Number of PolII peaks 4 3 2 1-95% broad H3K4me3 domains 8 6 4 2 3 6 1 3 6 A549 1 3 6 GM12878 1 3 6 HeLa-S3 1 3 6 HepG2 1 C2C12 myotubes 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 3 6 K562 1 3 6 1 S2 cells 3 6 1 Number of TSSs J H3K4me3 breadth and TSS usage from RNA-seq 5 ends -95% broad H3K4me3 domains 15 1 5 H3K4me3 breadth and mrna levels Median normalized mrna levels (A.U.) 3 6 1 3 6 H9 hescs 1 3 6 A549 1 3 6 GM12878 1-95% broad H3K4me3 domains 4 3 2 1 H9 hescs A549 GM12878 3 6 HeLa-S3 1 chr1 3 6 chr9 HepG2 1 3 6 K562 1 C. el Embryos 3 6 1 S2 cells 3 6 1 1.1E-65 6.1E-43 1.6E-43 4.1E-1 1.6E-66 1.5E-7 4.2E-76 8.5E-48 1.7E-37 6.4E-1 6.4E-7 1.2E-12 HeLa-S3 HepG2 K562 C2C12 C. el Embryos S2 cells NPCs Figure S1. road H3K4me3 Stretches Are Present in Different Cell Types and Organisms but Are Independent of Signal Intensity, Promoter Architecture, Gene Length, and Genomic Location, Related to Figure 1 1284 Cell 163, 1281 1286, November 19, 215 ª215 Elsevier Inc.

A Scaled log1(p value) for low transcriptional variability H3K4me3 breadth and transcriptional variability (single cells) 1 8 6 4 2 LNCaP MCF 7 HCT 116 C2C12 myoblasts MEFs 3 6 9 3 6 9 3 6 9 3 6 9 3 6 9 3 6 9 3 6 9 H3K4me3 domain breadth quantile (%) Intensity quantile (%) Transcriptional variability (cell populations, continued from Fig. 6C) -95% broad H3K4me3 domains C Transcriptional variability (cell populations) Scaled and normalized expression variance between replicates(a.u.) 3 2 1 1.3E-97 HUVECs 2.E-29 1.5E-159 1.7E-117 6.7E-122 4.2E-27 1.44E 51 MEFs C2C12 Myoblasts C2C12 Myotubes CH12 Kc167 A. thaliana leaves Scaled and normalized expression variance between replicates(a.u.) 1.5 1..5. 2.6E 9 8.9E 23-95% broad H3K4me3 domains after exclusion of bivalent/poised genes Top 5% broadest H3K4me3 domains after exclusion of bivalent/poised genes D Transcriptional variability (cell populations) E H3K4me3 breadth and transcriptional consistency (cell populations, nascent RNA) Nornalized mean scaled variance of genes in sample set (A.U.) 1.5 1..5. Signal-matched H3K4me3 promoters (N=1, samples) 1.1E 49 9.E 126 Scaled log1(p value) for low transcriptional variability 1 8 6 4 2 IMR9 3 6 9 3 6 9 C.elegans embryos 3 6 9 3 6 9 3 6 9 H3K4me3 domain breadth quantile (%) Intensity quantile (%) Figure S6. H3K4me3 readth Is Associated with Increased Transcriptional Consistency, Related to Figure 6 Cell 163, 1281 1286, November 19, 215 ª215 Elsevier Inc. 1285

A C D E F G H I J K L Figure S7. Effect of H3K4me3 Regulators on H3K4me3 readth and Transcriptional Consistency, Related to Figure 7 1286 Cell 163, 1281 1286, November 19, 215 ª215 Elsevier Inc.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback