Expanded View Figures

Similar documents
Expanded View Figures

Expanded View Figures

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

SUPPLEMENTARY INFORMATION

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Supplementary Figure 1

supplementary information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

AIF inhibits tumor metastasis by protecting PTEN from oxidation

Supplementary Figures

Supplementary Information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

Supplementary Table 1. List of primers used in this study

SUPPLEMENTARY INFORMATION

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression

Supplemental Information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Materials for

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Figure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURES AND TABLES

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplemental Table S1

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin

Supplementary Figure S1 Supplementary Figure S2

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Nature Immunology: doi: /ni.3866

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel

Supplementary Information and Figure legends

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Supplemental Table 1. Primer sequences for transcript analysis

Supplementary Materials for

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

SUPPLEMENTARY FIGURES AND TABLE

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

Supplemental Figure S1. RANK expression on human lung cancer cells.

SUPPLEMENTARY INFORMATION

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supporting Information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

SUPPLEMENTARY INFORMATION

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Tbk1-TKO! DN cells (%)! 15! 10!

SUPPLEMENTARY INFORMATION

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Expanded View Figures

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplemental Figures:

Supplementary Figures

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1

Supplementary Materials for

Transcription:

Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and Ish2 mrn with primers I9 and R4 (left), and Ish3 mrn with primers SH31 and HR1 (right) in SW620 cells. Western blots with an antibody specifically against residues 151 168 of I in the indicated cells. mpty arrowheads point to unknown bands. lag-tagged I isoforms were cotransfected with H-tagged PTN into 293T cells, followed by co-ip with M2 beads. Western blots were performed for the indicated proteins. rrows point to the indicated lag-tagged I isoforms. igure V2. I regulates PTN oxidation. Western blots for recombinant PTN prepared under non-reducing or reducing condition. ox indicates oxidized protein. The recombinant PTN protein (50 ng) was preincubated with or without 2 mm H 2 O 2 for 10 min, followed by incubation with recombinant I (50 ng) in the presence of 200 lm NH at 4 for 1 h. The mixtures were prepared under non-reducing or reducing condition and blotted for the indicated proteins. ox indicates oxidized protein and re indicates the reduced band of PTN. The recombinant PTN protein (50 ng) was incubated with recombinant I or its deleted mutant INH (50 ng) in the presence of 200 lm NHat4 for 1 h. The mixtures were prepared under non-reducing or reducing condition and blotted for the indicated proteins. ox indicates oxidized protein and re indicates the reduced band of PTN. Western blots for the indicated proteins of shn- or shi-infected SW620 cells., ell lysates from shn- or shi-infected HT29 () or U145 () cells were prepared under reducing or non-reducing condition and analyzed by Western blots for the indicated proteins. Phosphorylated kt and GSK-3b in U145 cells were quantified and normalized to total kt and GSK-3b, respectively. ox indicates oxidized protein and re indicates reduced PTN. G ell lysates from P3 (left) and LNaP (right) cells with or without I knockdown were analyzed by Western blots for the indicated proteins. Phosphorylated kt and GSK-3b were quantified and normalized to total kt and GSK-3b, respectively. H, I shn- and shi#1-infected SW620 cells were treated with 50 lm H 2 O 2 for the indicated times (H) or with a gradient of H 2 O 2 (I) and subjected to Western blots for the indicated proteins under non-reducing condition. ox indicates oxidized protein and re indicates reduced PTN. J luorescence intensity of staining of shn- or shi-infected SW620 cells was analyzed by flow cytometry (left), and quantified data were shown (right). ata represent means and s.d of three independent experiments. Two-sided unpaired t-test. K SW620 cells were treated with or without 100 lm H 2 O 2 for 30 min and subjected ro immunofluorescence staining of I with re-staining of PI. Scale bar representing 20 lm. L lag-ptn-expressing SW620 cells treated with or without 100 lm H 2 O 2 were subjected to co-ip with anti-lag antibody and analyzed by Western blots for the indicated proteins. M SW620 cells were treated with 100 lm H 2 O 2 for the indicated times in the absence or presence of N (10 mm) pretreatment. Lysates were prepared under reducing or non-reducing condition and analyzed by Western blots for the indicated proteins. ox indicates oxidized protein and re indicates reduced PTN. N V-, lag-tagged PTN-WT-, and PTN-71S-expressing cells were subjected to co-ip with anti-lag antibody and analyzed by Western blots for the indicated proteins. O V-, lag-tagged PTN-WT-, and PTN-71S-transfected P3 cells were treated with 100 lm H 2 O 2 for 30 min. Lysates were prepared under reducing or nonreducing condition and analyzed by Western blots for the indicated proteins. ox indicates oxidized protein and re indicates reduced PTN. * indicates a nonspecific band. ª 2015 The uthors MO reports V1

MO reports Role of I in MT of cancers Shao-Ming Shen et al G H J I K L M N O igure V2. V2 MO reports ª 2015 The uthors

Shao-Ming Shen et al Role of I in MT of cancers MO reports igure V3. I regulates WNT/b-catenin signaling target genes. The folds of relative mrn levels of the indicated genes against shn-infected cells were quantified by quantitative real-time PR in shi#1-infected HT29 cells. Western blots for xin2 and b-actin of shn- or shi-infected SW620 cells. V, I, or Ish3 was transfected into shn- or shi-infected SW620 cells. The folds of relative mrn levels of the indicated genes against V-transfected shn cells were quantified by quantitative real-time PR. Quantitative real-time PR for mrn levels of the indicated genes in shn- or shi-infected SW620 cells with or without b-catenin knockdown. ata information: In (,, ), data represent means and s.d of three independent experiments. Twosided unpaired t-test. ª 2015 The uthors MO reports V3

MO reports Role of I in MT of cancers Shao-Ming Shen et al igure V4. I silence induces MT in cancer cells and correlation between I and -cadherin in colon cancer tissues., The morphology (left, scale bar, 100 lm) and Western blots for the indicated proteins (right) of HT29 cells () and U145 cells (). Representative IH images of two cases of colon cancer samples stained with I or -cadherin. Right panels show the enlarged picture of the boxed area. Pearson correlation between the IRS scores of I and -cadherin. Two-sided unpaired t-test. ox plots of -cadherin expression in colon cancer tissues from 74 subjects with low and high I expression. Horizontal lines represent the median; the bottom and top of the boxes represent the 25 th and 75 th percentiles, respectively; and the vertical bars represent the range of data. ny outliers are marked with a circle. ata was analyzed using Mann Whitney U-test. Western blots for the indicated proteins of shn- or shi-infected SW620 cells. V4 MO reports ª 2015 The uthors

Shao-Ming Shen et al Role of I in MT of cancers MO reports G H I J K L igure V5. ata in xenografts and cancer patients. Representative image of tumors developed in a mouse that received subcutaneous injection of shn- and shi#1-infected SW620 cells. Tumor growth curves after subcutaneous injection of shn- or shi#1-infected SW620 cells. ata represent means and s.d of five mice in each group. Western blots for the indicated proteins in subcutaneous growth derived from shn- or shi#1-infected SW620 cells. Representative images of colon tumors derived from the subcutaneous engraftments of shn- or shi#1-infected SW620 cells. olon tumors derived from the subcutaneous engraftments were sectioned and stained with hematoxylin and eosin (H&). Scale bar represents 100 lm., G Ten general metastasis-related genes as described in the text were evaluated in I knockdown () or overexpressing (G) SW620 cells. ata represent means and s.d of three independent experiments. Two-sided unpaired t-test. H Representative images show the formation of tumors by splenic injection of shn-, shi#1-, and shi#2-infected HT29 cells in the mouse. I Representative IH images of two cases of colon cancer samples. Scale bar, 100 lm. J The numbers of cases with I low and I high expression in our cohort. K, L Kaplan Meier estimates of overall survival of subjects with high and low I expressions in TG reast Invasive arcinoma (K) and TG Lung Squamous ell arcinoma (L). ª 2015 The uthors MO reports V5