Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical replicates. *p<0.05 compared to control kidneys. (B) Kidneys from Wt1Cre;LSL-PLAG1 and wild-type littermate at P1, with glomeruli marked with black circles. (C) Number of glomeruli per kidney at P1, counted by sectioning through entire kidney. (D) Kidneys from Foxd1Cre;LSL-PLAG1 and wild-type littermates at four weeks of age (scale bar = 500 um).
Supplemental Figure S2. PLAG1 is overexpressed in Wilms tumor cells in the absence of DICER1-dependent micrornas (A) Strategy for knocking out DICER1 in WiT49 using CRISPR/Cas9. A guide RNA targeting the second coding exon of DICER1 (protospacer-adjacent motif highlighted in blue) was transiently transfected into WiT49 to create three independent subclones with biallelic frameshift mutations. (B) Immunoblot showing absence of DICER1 protein in subclones. (C) Quantitative PCR for mirnas in DICER1-knockout WiT49 subclones. Values represented as mean ± SD from three technical replicates. **p<0.01 (two-tailed t-test versus parental cells). (D) PLAG1 and IGF2 expression in DICER1-knockout WiT49 subclones. Values represented as mean ± SD from four technical replicates. **p<0.01 (two-tailed t-test versus parental cells). (E) Quantitative PCR for PLAG1 in DICER1-knockout WiT49 subclones transfected with mirna mimics. Values represented as mean ± SD from four technical replicates. *p<0.05, **p<0.01, ***p<0.001 (two-tailed t-test versus control mimic).
Supplemental Figure S3. mtorc1 signaling activity in the setting of PLAG1 overexpression (A) Survival of WiT49 cells, with and without PLAG1 overexpression, treated with varying concentrations of NVP-AEW451. Values represent mean ± SD from four technical replicates at each dose. (B-C) Immunostaining of Wt1Cre;LSL-PLAG1 kidneys at P4, for PLAG1 (B) and phospho-s6 (C) (scale bar = 100 um). (D-E) Immunostaining of control kidneys at P4, for PLAG1 (D) and phospho-s6 (E) (scale bar = 100 um). (F) GSEA of HALLMARK_MTORC1_SIGNALING gene set in RNA-seq from P8 kidneys. (G) Levels of exogenous human PLAG1, endogenous mouse Plag1, and Igf2 in RNAseq from P8 kidneys.
Supplemental Figure S4. Wilms tumors with mirna processing mutations are less commonly aneuploid. Copy number changes in relapsed favorable histology Wilms tumors from the TARGET dataset, segregated by presence of mutations in the mirna processing pathway. Gain is shown in red, while loss is shown in blue. Imprinting status at chromosome 11p15 shown along right side (retention of imprinting in black; LOI in orange; LOH in yellow).
Supplemental Table 1. Oligonucleotides used for cloning, PCR, and qpcr analysis. Oligo 3utrmiR34bs_F1_XbaI 3utrmiR34bs_R1_XbaI 3utrmiR15bs1_F1_XbaI 3utrmiR15bs1_R1_XbaI 3utrmiR15bs2_F1_XbaI 3utrmiR15bs2_R1_XbaI 3utr_miR34bs_NotI_s 3utr_miR34bs_NotI_as 3utr_miR15bs1_NotI_s 3utr_miR15bs1_NotI_a s 3utr_miR15bs2_NotI_s 3utr_miR15bs2_NotI_a s hplag1_orf_r2 hplag1_orf_f2_attb1 PLAG1q_F1 PLAG1q_R1 higf2_qf1 higf2_qr1 migf2_qf1 migf2_qr1 higf2_p3_chipf higf2_p3_chipr hintergene_chipf hintergene_chipr Sequence tcattctagagtaccaccctcccacgtttc tcattctagatccgaaactggactcttaattcat tcattctagacaaccagcattggtgaaggc tcattctagaccttgtggacaaaagctggg tcattctagaaatctgcattccaggccgaa tcattctagatgtcctagacccagctattagac ttcctatatggaaaaaaaaaagtcttaaaatgtgacaatgcggccgcaatcagga caaaatacccaggtaaacttaactgaacacaaatg catttgtgttcagttaagtttacctgggtattttgtcctgattgcggccgcattgtcacatt ttaagacttttttttttccatataggaa tagcaccatgaagagttgtagcccaagttacatgcggccgctgatccaatataata ttgaaggagtgtttctgaga tctcagaaacactccttcaatattatattggatcagcggccgcatgtaacttgggcta caactcttcatggtgcta cactgtaggccacaagaagctgcagtactattatttaatgcggccgcaattaatatt ttaaatctggtatatggacaataaatagtctgct agcagactatttattgtccatataccagatttaaaatattaattgcggccgcattaaat aatagtactgcagcttcttgtggcctacagtg GGTCATCTAGGGCACAGCTAC GGGGACAAGTTTGTACAAAAAAGCAGGCTAGAAGGCCT GGTTTAGGCTG GCGTCCAGCCCGAAATATGA CATTTTGGCCAATCGCGGG TACCGCCATCTCCCTTCTCA TCCCTCTGACTGCTCTGTGA CACATTCGGCCTCTGCGAC ATCCCCATTGGTACCTGGAAG ATGCCCGTTCTAGAGAATTCAGG CCCAGCTCACGAGCACA CCTGGCCTCTCACACTCA AGAACCCTTGCTCTCCAC
migf2_p2_chipf migf2_p2_chipr mintergene_chipf mintergene_chipr CTTTTCGCTGCAGTCCCGAG AACTTCGAAGGACCGAGGAC ATTTTGTGCTGCATAACCTCCT TAGCAACATCCTAAGCTGGACA