Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Similar documents
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1

E10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g)

SUPPLEMENTAL FIGURE LEGENDS

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

SUPPLEMENTARY INFORMATION

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W

Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow

SUPPLEMENTARY INFORMATION

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1:

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

SUPPLEMENTARY INFORMATION

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Supplementary Figures

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

T H E J O U R N A L O F C E L L B I O L O G Y

Expanded View Figures

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

Supplementary information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Hearts were fixed in 4% paraformaldehyde (ph 7.4) overnight, embedded in paraffin, and

SUPPLEMENTARY INFORMATION

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

SUPPLEMENTARY INFORMATION

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

SUPPLEMENTARY INFORMATION

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Control. csarnt -/- Cre, f/f

Supplementary Material

Supplementary Materials for

SUPPLEMENTARY INFORMATION

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

SUPPLEMENTARY FIGURES AND TABLE

A Long-Term and Slow-Releasing Hydrogen Sulfide Donor Protects against Myocardial. Ischemia/Reperfusion Injury

Supplementary Figure 1

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supporting Information. Calculation of the relative contributions of myocyte proliferation, stem cell. Supporting Information Fig 1 (page 9)

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Materials

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Nature Immunology: doi: /ni eee Supplementary Figure 1

mir-874 regulates myocardial necrosis by targeting caspase-8

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

SUPPLEMENTARY RESULTS

Supplementary Figure 1. TNFα reduces BMPR-II protein and mrna expression via NF-кB/RELA. (a and b) Representative immunoblots of BMPR-II in human

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

SUPPLEMENTARY INFORMATION

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Supplementary. limb. bars

fig. S1 Gene silencing of LC3B by sirna enhances IL-1β secretion. Peritoneal

Qualifying Examination (Part I)

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Serum cytokine levels in control and tumor-bearing male and female mice at day 15.

Supplementary Materials for

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Information

GW(g)/BW(g) GW(g)/BW(g) Con Dex Con Dex. GW(g)/BW(g) Relative mrna levels. Atrogin-1 Murf-1. Atrogin-1 Murf-1. Soleus

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:

Supplementary Material

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Erythropoietin preserves the endothelial differentiation potential of cardiac progenitor cells and attenuates heart failure during anti-cancer therapy


T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Figure 1.

Transcription:

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with anti-drp1 antibody (green). 1

Supplementary Figure 2. Verification of cardiac-specific Pink1 transgenic mice. (a) Schematic map showing the transgenic construct of Pink1. (b) qrt-pcr analyzes the expression of mature Pink1 in different tissues isolated from Pink1 transgenic mice (Tg) and wild-type mice (WT). (c) Detection of Pink1 levels in Pink1 transgenic mice. The expression of Pink1 was analyzed by qrt-pcr from wild type and different lines of mir-421 transgenic mice. (d) Mitochondrial ATP levels in the hearts of control and Pink1 transgenic mice. Wild type mice and Pink1 transgenic mice were subjected to I/R injury. Hearts were harvested and ATP levels measured as described in Methods. Mitochondrial ATP levels were significantly increased in the hearts of Pink1 transgenic mice compared with controls in response to I/R treatment. Data are shown as mean ± s.e.m. of six independent experiments. Analysis was performed with one-way ANOVA followed by Tukey-Kramer post hoc analysis. *p<0.05. (e) Mitochondrial fusion is increased in cardiomyocytes from the Pink1 transgenic mouse. Mitochondrial fusion was determined by electron microscopy in hearts from wild type mice and Pink1 transgenic mice. Data are shown as mean ± s.e.m. of six independent experiments. *p<0.05 vs WT in Student s t-test. 2

Supplementary Figure 3. Wild-type Pink1 but not kinase dead mutant Pink1 protects against H 2 O 2 -induced mitochondrial fragmentation and apoptosis. (a) Cardiomyocytes were treated with H 2 O 2. Parkin levels in mitochondria were analyzed by immunoblot. n=3. (b) Mice were subjected to Sham or I/R, Parkin levels in mitochondria were analyzed by immunoblot. n=5. (c and d) Cardiomyocytes were infected with adenovirus harboring Pink1, kinase dead Pink1 mutant (Pink1-KD; K219A/D362A/D384A) or -gal, and then exposed to H 2 O 2. The cells were stained with mitotracker-red and the cells with fragmented mitochondria were counted (c). TUNEL was employed to analyze apoptotic cells. TUNEL-positive cells were counted and calculated (d). Data are shown as mean ± s.e.m. of four independent experiments. Analysis was performed with one-way ANOVA followed by Tukey-Kramer post hoc analysis. *p<0.05. 3

Supplementary Figure 4. The protective effects of Pink1 on mitochondrial fragmentation and apoptosis depend on phosphorylating TRAP1. (a) Cardiomyocytes were treated with H 2 O 2 (upper panel) or mice were subjected to Sham or I/R (lower panel). In vivo phosphorylation of endogenous Miro was determined by immunoprecipitation with anti-miro antibody followed by immunoblotting using anti-phosphoserine and anti-miro antibodies. n=3. (b) Cardiomyocytes and mice were treated as described in (a). In vivo phosphorylation of endogenous Mfn2 was determined by immunoprecipitation with anti-mfn2 antibody followed by immunoblotting using anti-phosphoserine and anti-mfn2 antibodies. n=3. (c) Cardiomyocytes and mice were treated as described in (a). In vivo phosphorylation of endogenous TRAP1 was determined by immunoprecipitation with anti-trap1 antibody followed by immunoblotting using anti-phosphoserine and anti-trap1 antibodies. n=4. (d) Pink1 knockdown reduces TRAP1 phosphorylation. Cardiomyocytes were infected with adenoviral Pink1-siRNA or its scramble form (Pink1-sc). In vivo phosphorylation of endogenous TRAP1 was 4

determined by immunoprecipitation with anti-trap1 antibody followed by immunoblotting using anti-phosphoserine and anti-trap1 antibodies. n=3. (e) Cardiomyocytes were infected with adenovirus harboring Pink1, kinase dead Pink1 mutant (Pink1-KD; K219A/D362A/D384A) or -gal, and then exposed to H 2 O 2. In vivo phosphorylation of endogenous TRAP1 was determined by immunoprecipitation with anti-trap1 antibody followed by immunoblotting using anti-phosphoserine and anti-trap1 antibodies. n=4. (f) Cardiomyocytes were infected with adenoviral TRAP1-siRNA or its scramble form (TRAP1-sc). The levels of TRAP1 and actin in the cell lysates were analyzed by immunoblotting with anti-trap1 and anti-actin antibodies. n=3. (g and h) TRAP1 depletion abolishes the effects of Pink1 on mitochondrial fragmentation and apoptosis in response to H 2 O 2. Cardiomyocytes were infected with adenovirus harboring Pink1 and TRAP1-siRNA or TRAP1-sc, and then exposed to H 2 O 2. The cells were stained with mitotracker-red and the cells with fragmented mitochondria were counted (g). TUNEL was employed to analyze apoptotic cells. TUNEL-positive cells were counted and calculated (h). Data are shown as mean ± s.e.m. of four independent experiments. Analysis was performed with one-way ANOVA followed by Tukey-Kramer post hoc analysis. *p<0.05. 5

Supplementary Figure 5. The expression pattern of mir-421. (a) MiRNAs expression levels upon treatment with H 2 O 2. Cardiomyocytes were untreated (control) or treated with H 2 O 2 for 24 hours. MiRNAs were analyzed by qrt-pcr. Data are shown as mean ± s.e.m. of four independent experiments. *p<0.05 vs control in Student s t-test. (b) The copy numbers of mir-421 in hearts from heart failure mouse were determined by qrt-pcr using standard curve method. Data are shown as mean ± s.e.m. of three independent experiments. (c) The copy numbers of mir-421 in hearts from heart failure human were determined by qrt-pcr using standard curve method. Data are shown as mean ± s.e.m. of three independent experiments. (d) The expression levels of mir-421 and mir-1 were analyzed by qrt-pcr. Data are shown as mean ± s.e.m. of three independent experiments. *p<0.05 vs mir-1 in Student s t-test. (e) Putative mir-421 binding site in the 3 UTR region of Pink1. 6

supplementary Figure 6. The effects of mir-421 on Drp1 expression and translation. (a) MiR-421 has no effect on the expression of Drp1. Cardiomyocytes were infected with adenoviral mir-421 or b-gal. The levels of Drp1 were analyzed by immunoblot. n=3. (b) MiR-421 has no effect on Drp1 translation. HEK293 cells were infected with adenoviral mir-421 or β-gal, then transfected with the luciferase constructs of the wild type Drp1-3 UTR. The luciferase activity was analyzed. 7

Supplementary Figure 7. Pink1 target protector attenuates the effects of mir-421 on mitochondrial fragmentation and apoptosis. (a) Knockdown of mir-421 attenuates mir-421 levels upon I/R. Adult male C57BL/6 mice (8 weeks old) were delivered in three consecutive days, intravenous injections of mir-421 antagomir (anta-421) or antagomir control (anta-nc) at doses of 30 mg/kg body weight. 3 days after injection the mice were subjected to I/R. Mir-421 levels were analyzed by qrt-pcr. Data are shown as mean ± s.e.m. of six independent experiments. Analysis was performed with one-way ANOVA followed by Tukey-Kramer post hoc analysis. *p<0.05 vs I/R alone. (b) Knockdown of mir-421 ameliorates cardiac function after I/R. Mice were treated as described in (a). Transthoracic echocardiographic analysis was performed. LVIDd, diastolic left ventricular internal diameters; FS, fractional shortening of left ventricular diameter. Data are shown as mean ± s.e.m. of six independent experiments. Analysis was performed with one-way ANOVA followed by Tukey-Kramer post hoc analysis. *p<0.05 vs I/R alone. (c and d) Pink1 target protector attenuates mir-421-induced mitochondrial fragmentation and apoptosis. Cardiomyocytes were infected with adenoviral mir-421 or b-gal, then transfected with the target protector (Pink1-TP mir-421 ) or the control (Pink1-TP control ). The cells with fragmented mitochondria were counted (c), TUNEL-positive cells were counted and calculated (d). Data are shown as mean ± s.e.m. of three independent experiments. Analysis was performed with one-way ANOVA followed by Tukey-Kramer post hoc analysis. *p<0.05. 8

Supplementary Figure 8. MiR-421/Pink1 bitransgenic mice exhibit reduced mitochondrial fragmentation, apoptosis and myocardial infarction. (a-c) WT, mir-421 transgenic mice and mir-421/pink1 bitransgenic mice were exposed to I/R. Mitochondrial fragmentation (a), apoptosis (b) and infarct sizes (c) were analyzed. Data are shown as mean ± s.e.m. of seven independent experiments. Analysis was performed with one-way ANOVA followed by Tukey-Kramer post hoc analysis. *p<0.05. 9

Supplementary Figure 9. E2F1 knockout mice present markedly preserved cardiac function after I/R. E2F1 knockout mice (E2F1 KO) or wild type mice (WT) were subjected to sham-operation or 45 min of ischemia followed by 1 week of reperfusion (I/R). Transthoracic echocardiographic analysis was performed. LVIDd, diastolic left ventricular internal diameters; LVIDs, systolic left ventricular internal diameters; FS, fractional shortening of left ventricular diameter. Data are shown as mean ± s.e.m. of seven independent experiments. Analysis was performed with one-way ANOVA followed by Tukey-Kramer post hoc analysis. *p<0.05 vs I/R +WT. 10

Supplementary Figure 10. Knockdown of Pink1 attenuates the effect of E2F1 knockdown on Pink1 expression, mitochondrial fragmentation and apoptosis upon H 2 O 2. Cardiomyocytes were infected with adenoviral E2F1-siRNA or E2F1-sc, Pink1-siRNA or Pink1-sc, and then exposed to H 2 O 2. (a) Pink1 expression was analyzed by immunoblot. n=4. (b) Mitochondrial fragmentation (upper panel) and apoptosis (low panel) were analyzed. Data are shown as mean ± s.e.m. of four independent experiments. Analysis was performed with one-way ANOVA followed by Tukey-Kramer post hoc analysis. *p<0.05. 11

Supplementary Figure 11. Uncropped images of blots presented in the main paper. Molecular weight markers are indicated in kda. 12

Supplementary Figure 12. Uncropped images of blots presented in the main paper. Molecular weight markers are indicated in kda. 13