Molecular typing of Treponema pallidum: five-year surveillance in Shanghai, China

Transcription

1 JCM Accepts, published online ahead of print on 12 September 2012 J. Clin. Microbiol. doi: /jcm Copyright 2012, American Society for Microbiology. All Rights Reserved. Molecular typing of Treponema pallidum: five-year surveillance in Shanghai, China Ting Dai 1 Kang Li 2, Haikong Lu 2, Xin Gu 2, Qianqiu Wang 1, Pingyu Zhou 2 1. Institute of Dermatology, Chinese Academy of Medical Sciences and Peking Union Medical College, Nanjing , China 2. Department of STD Institute, Shanghai Skin Disease Hospital, Shanghai , China Corresponding author: Pingyu Zhou 2 zpyls@yahoo.com Co-corresponding author: Qianqiu Wang 1 wangqq@ncstdlc.org Current address for Ting Dai: Department of Dermatology, Shanghai Xuhui Central Hospital, Shanghai , China Running title: Molecular Typing of T. pallidum in Shanghai Word count of abstract: 261 Total word count of the text: 2394 Conflicts of interest: All authors, none to declare

2 Abstract Previously a small study showed 14f was the predominant subtype in Shanghai, China. The result was quite different from genotype distribution in other areas of China. This study aims to identify the strain types of Treponema pallidum in samples collected over a five year period in Shanghai. From 2007 to 2011, genital swabs were collected from patients with syphilis from the Shanghai Skin Disease Hospital. Positive specimens were typed with the enhanced typing method by adding a tp0548 gene to the existing arp and tpr genotype system. In total, 304 of the 372 enrolled patients yielded fully typeable DNA. Ten arp types (4, 6, 8, 9, 11, 12, 13, 14, 15 and 19), 3 tpr types (a, d, o), and 5 tp0548 types (a, c, f, g and i) were identified. In total 12 subtypes were identified with a combination of the arp and tpr genes. Subtype 14d was found in 270 samples (88.8%). With combination of the tp0548 gene, the 12 CDC subtypes identified were divided into 14 strain types. The predominant type was 14d/f (88.8%), followed by 15d/f (3.6%), 13d/f (1.3%) and 19d/c (1.3%). Two of the 44 14d/f and both of the two 19d/c infected patients who underwent a lumbar puncture were diagnosed with neurosyphilis. This study showed that the predominant type in Shanghai was 14d/f. While this is in keeping with data from other areas in China it is different from an earlier report of 14f being the most common genotype in Shanghai. Further studies are needed to better understand the association between strain types and neurosyphilis. Key word: Treponema pallidum Molecular typing Shanghai Neurosyphilis

3 Introduction China has witnessed a resurgence of syphilis in recent years. Reported syphilis cases increased more than 50-fold within 12 years from 1993 to 2005 (2). The national incidence rates in 2011 and 2010 were and cases per 100,000 population respectively, with 429,677 and 358,534 cases reported, causing 92 and 69 deaths respectively (from China national surveillance data) (3). Shanghai is the largest city and economic center of China where the migrating population (non-resident) constitutes over one-third of the total population. In 2010, Shanghai had an incidence rate of cases per 100,000 population for all stages of syphilis, with the total reported cases in Shanghai comparable to those for the entire European Union. The ability to differentiate between genotypes of Treponema pallidum (T. Pallidum) could allow monitoring of changes in the prevalence and geographical distribution of strains over time. In 1998, Pillay et al. published a molecular subtyping scheme of T. pallidum based on characterization of acidic repeat protein gene (arp) and restriction fragment length pattern (RFLP) analysis of tpr genes subfamily II (tpr E, G and J) (CDC subtype) (14). In 2010, Marra et al. developed an enhanced strain typing method, adding tp0548 gene sequence types to the existing CDC genotype system (9). A previous small study showed 14f was the predominant subtype in Shanghai (10). The result was quite different from the limited data about genotype distribution in other areas of China (13, 20, 21, 22), where 14d is the predominant type. This study aims to identify strain types of T. pallidum in a larger number of samples collected over a five year period in Shanghai. Associations between strain types and neurosyphilis were also explored. Methods Study population Between Aug 2007 and Dec 2011, eligible patients attending the Shanghai Skin Disease Hospital Sexually Transmitted Disease (STD) Clinic were asked to participate in this study. An initial diagnostic evaluation was performed, which included dark-field microscopy or Treponema pallidum particle agglutination (TPPA) and the

4 rapid plasma reagin (RPR) tests. Patients who had moist lesions (chancres, condyloma lata, or mucous patches) and confirmed as early syphilis were eligible for enrollment. Information collected included the patient s demographic data, clinical characteristics and laboratory findings. Syphilis was staged according to clinical characteristics, dark-field microscopy and sero-testing. The diagnosis of neurosyphilis was defined as: 1) serum RPR and TPPA positive; and 2) cerebrospinal fluid (CSF) TPPA and CSF venereal disease research laboratory (VDRL) test positive; in the absence of substantial contamination with blood; with or without 3) elevated CSF protein or white blood cells (WBC) count in the absence of other known causes of the abnormalities; with or without 4) clinical symptoms or signs consistent with neurosyphilis without other known causes for these clinical abnormalities (19). HIV testing was also performed for those patients who agreed. This study was approved by the Ethics Committee of the Shanghai Skin Disease Hospital. Informed consent was obtained from all participants. DNA extraction and molecular typing of T. pallidum Specimens were obtained by rubbing the base of the lesion with a sterile swab. Extraction of DNA was performed using the QIAamp DNA mini kit (Qiagen) according to the manufacturer s instructions and carried out in a biosafety cabinet in a separated room to minimize potential contamination with exogenous T. pallidum DNA. To detect the presence of T. pallidum, we used a diagnostic polymerase chain reaction (PCR) assay that amplifies tpp47 gene. Strain typing was performed based on a previously described method (14). In brief, PCR of the arp gene was performed using 0.4 μm of primers ARP-1 and ARP-2. The tpr genes (E, G, and J) were amplified by using 0.6 μm of primers IP-6 and IP-7 (Table 1). Thermocycling parameters were one cycle at 94 C for 4 mins, 40 cycles at 94 C for one minute, 60 C for one minute and 72 C for one minute and a final extension step of 72 C for seven minutes. The arp amplicons were electrophoresed on a 2% agarose gel, together with a 100-bp DNA ladder (Invitrogen) at 70 V for six hours. The number of the 60-base pair tandem repeats (from three to 22) was established by comparing the size of the amplified product with that of the product amplified from the Nichols strain,

5 which contains 14 repeats. The results were analyzed by Image Lab software. The tpr amplicons (including tpr gene E, G, and J) were digested with fast restriction endonuclease, MseI (Invitrogen). The digested product was electrophoresed on 2% agarose gel to determine the digestion pattern (a through p). In case tpr gene was negative, a nested PCR was used as described in Pillay s article (14). By combining arp and tpr gene, T.pallidum can be typed according to CDC subtypes. For example, the reference Nichols strain could be typed as 14a. PCR of the tp0548 gene was amplified by using 0.6 μm of primers sense and antisense (Table 1). The amplification conditions were one cycle of 95 C for two minutes, followed by 40 cycles of 95 C for one minute, 62 C for one minute 15 seconds, and 72 C for one minute. The final extension was one cycle at 72 C for 10 minutes. Sequence type of tp0548 was compared to the reference sequences and identified by letter (a through i). We express the strain type as CDC subtype/tp0548 sequence type as in Marra s article (9). For example, the reference Nichols strain could be further typed as 14a/f. Using this method, we subsequently determined strain types of all the samples. Statistical Analysis Data were recorded using Microsoft Excel (Edition 2003, Microsoft Corporation, Redmond, WA, USA) and statistical analysis was performed using Statistical Package for the Social Sciences (SPSS15.01, SPSS Inc., Chicago, IL, USA). Results In total, 372 patients were enrolled during the five year study period. By tpp47 gene screening, 316 (86%) of the 372 specimens were positive, indicating the presence of T. pallidum DNA; among them, 304 had fully typeable T. pallidum DNA. Twelve of the 372 specimens were positive but could not be fully typed; among these 12, two were found to be negative for both tpr and arp gene PCR analysis, while eight were typeable by the tpr gene only. The median age of these typeable patients was 39.6 years. A total of 65.5% of participants were men and 69.0% resided locally to the investigating city. 62.5%

6 (190/304) of the patients had primary syphilis, 26.0% (79/304) secondary syphilis, and 11.5% (35/304) had chancres together with lesions suggestive of secondary syphilis (skin rashes). 117 patients provided sexual orientation information and 5.1% (6/117) were homosexual/bisexual. 247 patients accepted the offer of an HIV test of whom 3.6% (9/247) were HIV positive. RPR was performed in all participants but data of 8 patients is not available since it was performed in other hospitals. 33.1% (98/296) of participants had RPR titers equal to or less than 1:8 (RPR negtive in 38 of the 98 patients), 33.4% (99/296) ranged from 1:16 to 1:64 and 33.4% (99/296) had RPR titers greater than 1:64. A total of 10 arp types (4, 6, 8, 9, 11, 12, 13, 14, 15 and 19) were identified in these specimens with type 14 being the most common type detected (90.1%, 274/304) (Figure 1). Three different tpr RFLP patterns (a, d and o) were found, the majority of which belonged to the type d (98.0%, 297/304) (Figure 1). By combining the arp and tpr gene types we observed 12 CDC subtypes, with subtype 14d most frequently detected (88.8%, 270/304). For tp0548 gene, five sequence types (a, c, f, g and i) were identified with type f accounting for 97.0% (295/304) of the samples (figure 2). By enhancing the CDC subtyping method with sequence analysis of the tp0548 gene, we were able to separate the 12 CDC subtypes into 14 different strain types (Figure 3). The majority (88.8%, 270/304) of the fully typeable specimens belonged to strain type 14d/f. The second most common strain type was 15d/f, present in 11 (11/304, 3.3%) specimens, followed by 13d/f and 19d/c, both found in four (4/304, 1.3%) specimens. The other subtypes included 14a/f (3/304, 1.0%); 4d/f, 6d/f, and 9o/c (2/302, 0.6% respectively); 8d/g, 11d/f, 11o/a, 12d/f, 14a/i, 19d/f (one of each). Over the five year study period, 14d/f remained the predominant circulating type in Shanghai (11/11 samples in 2007, 35/40 in 2008, 127/144 in 2009, 46/51 in 2010, 51/58 in 2011 ), with some other strain types appearing and disappearing. (Figure 3). Of the 304 patients who had typeable samples, 52 patients agreed to undergo lumbar puncture and six subtypes were found: 14d/f strain (44 samples); 4d/f, 15d/f, and 19d/c strains (two of each); 11o/c and 14a/f strains (one of each).

7 Among these 52 patients, four were diagnosed with neurosyphilis, of which two had 14d/f strain, and two had 19d/c strain. All four neurosyphilis patients were HIV negative. No neurosyphilis was found in patients with other four subtypes. The association between 14d/f and neurosyphilis is not statistically significant (P>0.05). DISCUSSION China has experienced a resurgence in syphilis in recent twenty years. (2). Epidemiological studies of many infectious diseases, including STDs such as HIV, Human Papilloma Virus, gonorrhoea, and chlamydia, have been enhanced by molecular typing of their respective causative agents (6, 8, 18). Molecular biology methods are becoming increasingly accessible to many diagnostic laboratories and have the potential to enhance existing STD surveillance and control efforts in China. To our knowledge, this is the largest T. pallidum typing study untill now, with more than 300 positive samples over the five year study period. Fourteen types were identified from these samples using the enhanced nomenclature of combining the number of the arp gene tandem repeats, the tpr gene RFLP types and the tp0548 gene sequence type. A previous small study indicated the CDC subtype 14f is the predominant genotype in Shanghai (10). However, in several small studies from Guangdong and Hunan provinces in China, as well as a recent large national study, CDC subtype 14d is the most common subtype (13, 15, 20-22). In our study, five-year data also showed that 14d is the predominant subtype, and we did not identify subtype 14f from a single sample. This is in keeping with a recent large study across different geographic areas in China which did not identify 14f in any samples. Furthermore, Shanghai is the biggest city and economic center located in eastern China. With a convenient transportation network, Shanghai has close relationships with different areas rather than being a lonely island. In Shanghai, the migrating population constitutes over one-third of the total population and therefore, it seems reasonable that subtype 14d is predominant both in Shanghai and adjacent areas. We used positive and negative controls in the study. Additionally, the results have been repeated and confirmed at the Institute Pasteur of Shanghai. Thus, we believe 14d is the predominant

8 subtype in Shanghai. Outside China, CDC subtype 14d has also been the most common molecular type found in Scotland, Canada, South Africa and Colombia, while 14f was predominant in studies performed in Arizona, North and South Carolina in the United States (1, 4, 5, 7, 11, 16, 17). A total of 10 arp types (4, 6, 8, 9, 11, 12, 13, 14, 15 and 19), three different tpr RFLP patterns (a, d and o) and five tp0548 sequence types (a, c, f, g and i ) were identified in this study. Of note, arp type 4, 11, 19, tpr type o and tp0548 sequence type a, g, i had never been previously reported in China. It seems that the diversity of T. pallidum subtypes might be higher with greater syphilis prevalence as seen in South Africa where there appears to be a high level of strain diversity (15). It s interesting that the proportion of the predominant type 14d is much higher in Shanghai (88.8%) than in other areas, where the proportion of the predominant type varied from 30% to 76%. Even with enhanced typing method, most of the tp0548 types (295/304, 88.8%) were f and all the subtype 14d samples had a tp0548 type f. Over the five year period, different strain types have appeared and disappeared, with 14d/f being the predominant circulating type (Figure 3). The much smaller numbers of the non-14d/f subtypes may indicate smaller and more localized transmission networks in a relatively small geographic area, or a relatively short period of the syphilis resurgence in Shanghai. Another explanation is strain type 14d/f might be more virulent than other types or generating a weaker host immune response resulting in a longer duration of infection. There could also be differences in sensitivity of the strains to antibiotics (23, 24). Although current syphilis treatment guidelines do not recommend a lumbar puncture in asymptomatic, HIV-negative patients with early syphilis, it is useful to obtain CSF to examine associations between disease progression and strain types. Marra s recent study indicated strain type 14d/f might be associated with a higher risk of neurosyphilis (9). Some T. pallidum types may be more neuro-invasive, or they may be better able to escape host immune responses in the central nervous system (CNS) compared to other strain types. However, the association between 14d/f and neurosyphilis is not significant in Shanghai. In our study, the 14d/f accounts for nearly 90% of the cases in Shanghai.

9 Two of the 44 (4.3%) patients infected with strain type 14d/f were initially diagnosed as secondary syphilis and confirmed as neurosyphilis after CSF examination. Another study from Africa showed 14a was predominant in neurosyphilis patients while 14d was most prevalent in epidemiologic studies (12), which indicated type 14a might be associated with a higher risk of neurosyphilis. Again, all four of the 14a strains in our study (three of 14a/f and one of 14a/i) were not isolated from neurosyphilis cases. Strain type 19d/c was not reported in Marra s study (9). In our study, a total of four patients were infected with strain type 19d/c. Two of these, initially diagnosed as secondary syphilis, were confirmed as neurosyphilis after CSF examination. Both of them were HIV negative and without other immunosuppressive disease. Because of the current syphilis treatment guidelines and the difficulty to isolate T. pallidum in neurosyphilis patients, very limited information about the strain types was obtained. Thus it might be too early to draw a conclusion about the higher-risk strain type associated with neurosyphilis. Further studies on a larger sample of patients with neurosyphilis may help to demonstrate the preferential strain type of neurosyphilis. ACKNOWLEDGMENTS We appreciate Prof. Sheila A. Lukehart (University of Washington School of Medicine) and Dr. Haibo Wang (Institute Pasteur of Shanghai) for their technical support. We thank Prof. Christina Marra (University of Washington School of Medicine) for providing Nichols strain. We also thank John Saunders (St Bartholomew's Hospital, London, UK) for help with reviewing the paper. This study was supported by The National Natural Science Foundation of China (NSFC: ), Basic Research Project of Shanghai Science and Technology Commission (STC: 11JC ) and Shanghai Natural Science Foundation (STC: 09ZR ).

10 Reference Castro R, Prieto E, Aguas MJ, Manata MJ, Botas J, Pereira FM Molecular 278 subtyping of Treponema pallidum subsp. pallidum in Lisbon, Portugal. J Clin 279 Microbiol 47: Chen ZQ, Zhang GC, Gong XD, Lin C, Gao X, Liang GJ, Yue XL, Chen XS, Cohen MS Syphilis in China: results of a national surveillance program. Lancet 369: Chinese Center for Disease Prevention and Control; Center for STI and AIDS Prevention and Control report on syphilis and gonorrhea epidemic analysis in China. Bull STI Prev Control 26: Cole MJ, Chisholm SA, Palmer HM, Wallace LA, Ison CA Molecular 287 epidemiology of syphilis in Scotland. Sex Transm Infect 85: Florindo C, Reigado V, Gomes JP, Azevedo J, Santo I, Borrego MJ Molecular typing of Treponema pallidum clinical strains from Lisbon, Portugal. J Clin Microbiol 46: Fredlund H, Falk L, Jurstrand M, Unemo M Molecular genetic methods for diagnosis and characterisation of Chlamydia trachomatis and Neisseria gonorrhoeae: impact on epidemiological surveillance and interventions. APMIS 112: Katz KA, Pillay A, Ahrens K, Kohn RP, Hermanstyne K, Bernstein KT, Ballard RC, Klausner JD Molecular epidemiology of syphilis San Francisco, Sex Transm Dis 37: Luft LM, Gill MJ, Church DL HIV-1 viral diversity and its implications for viral 298 load testing: review of current platforms. Int J Infect Dis 15:e Marra CM, Sahi SK, Tantalo LC, Godornes C, Reid T, Behets F, Rompalo A, Klausner 300 JD, Yin YP, Mulcahy F, Golden MR, Centurion-Lara A, Lukehart SA Enhanced molecular typing of Treponema pallidum: Geographical distribution of strain types and association with neurosyphilis. J Infect Dis 202: Martin IE, Gu W, Yang Y, Tsang RS Macrolide resistance and molecular types 304 of Treponema pallidum causing primary syphilisin Shanghai, China. Clin Infect Dis

11 305 49: Martin IE, Tsang RS, Sutherland K, Anderson B, Read R, Roy C, Yanow S, Fonseca K, White W, Kandola K, Kouadjo E, Singh AE Molecular typing of Treponema pallidum strains in western Canada: Predominance of 14d subtypes. Sex Transm Dis : Molepo J, Pillay A, Weber B, Morse SA, Hoosen AA Molecular typing of Treponema pallidum strains from patients with neurosyphilis in Pretoria, South Africa. Sex Transm Infect 83: Peng RR, Yin YP, Wei WH, Wang HC, Zhu BY, Liu QZ, Zheng HP, Zhang JP, Huang SJ, Chen XS Molecular Typing of Treponema pallidum Causing Early Syphilis in China: A Cross-Sectional Study. Sex Transm Dis 39: Pillay, A., H. Liu, C. Y. Chen, B. Holloway, A. W. Sturm, B. Steiner, and S. A. Morse Molecular subtyping of Treponema pallidum subspecies pallidum. Sex Transm. Dis 25: Pillay A, Liu H, Ebrahim S, Chen CY, Lai W, Fehler G, Ballard RC, Steiner B, Sturm AW, Morse SA Molecular typing of Treponema pallidum in South Africa: Cross-sectional studies. J Clin Microbiol 40: Pope V, Fox K, Liu H, Marfin AA, Leone P, Seña AC, Chapin J, Fears MB, Markowitz L Molecular subtyping of Treponema pallidum from North and South Carolina. J Clin Microbiol 43: Sutton MY, Liu H, Steiner B, Pillay A, Mickey T, Finelli L, Morse S, Markowitz LE, St Louis ME Molecular subtyping of Treponema pallidum in an Arizona County with increasing syphilis morbidity: Use of specimens from ulcers and blood. J Infect Dis 183: Trottier H, Burchell AN Epidemiology of mucosal human papillomavirus 330 infection and associated diseases. Public Health Genomics 12: Workowski KA, Berman S; CDC Sexually transmitted diseases treatment 332 guidelines, MMWR Recomm Rep 59: Zhan LS, Zeng TB, Yan JL, Tang SY, Wu SY, Wu YM Preliminary study on 334 molecular subtyping of Treponema pallidum in South Hunan area. Pract Prevent Med

12 335 12: Zeng TB, Wu YM, Huang SJ, Wu ZZ Preliminary study on molecular subtyping of Treponema pallidum in Hengyang and Jiangmen regions. Chin J Dermatol 37: Zheng HP, Ou ZY, Hu YS, Huang JM, Li ML, Wu XZ, Zeng WY, Pan HQ Detection and genotyping of Treponema pallidum by a nested PCR. Chin J Dermatol 38: Zhou P, Li K, Lu H, Qian Y, Gu X, Gong W, Tucker JD, Cohen MS Azithromycin treatment failure among primary and secondary syphilis patients in Shanghai. Sex Transm Dis 37: Zhou P, Qian Y, Xu J, Gu Z, Liao K Occurrence of congenital syphilis after maternal treatment with azithromycin during pregnancy. Sex Transm Dis 34:

13 Table 1. Primers used in T. pallidum strain typing tpp47 sense 5' CGTGTGGTATCAACTAGTG 3' tpp47 antisense 5' TCAACCGTGTACTC GTGC 3' ARP-1 5' CAAGTCAGGACGGACTGTCC3' ARP-2 5' GGTATCACCTGGGGATGC 3' A-1 5' ACTGGCTCTGCCACACTTGA3' B-2 5' CTACCAGGAGAGGGTGAAGCT3' IP-6 5' CAGGTTTTGCCGTTAAGC3' IP-7 5' AATCAAGGGAGAATACCGTC3' tp0548 sense 5' GGTCCCTATGATATCGTGTTCG3' tp0548 antisense 5' GTCATGGATCTGCGAGTGG3' Downloaded from on December 13, 2018 by guest

14

15

16