Supplemental Table 1. Eighty-nine single nucleotide polymorphisms of 49 immune response genes analyzed in the study
|
|
- Charles Gilbert Davis
- 5 years ago
- Views:
Transcription
1 Supplemental Table 1. Eighty-nine single nucleotide polymorphisms of 49 immune response genes analyzed in the study Gene Symbol Gene ID Gene Full Name SNP ID (alphabetical order) CARD15/NOD nucleotide-binding oligomerization domain rs containing 2 CCL chemokine (C-C motif) ligand 5 rs , rs CD CD40 molecule, TNF receptor superfamily rs member 5 CD40LG 959 CD40 ligand rs CD70/TNFSF7 970 CD70 molecule rs CXCL chemokine (C-X-C motif) ligand 8 rs CXCL chemokine (C-X-C motif) ligand 14 rs CXCR chemokine (C-X-C motif) receptor 4 rs CXCR5 643 chemokine (C-X-C motif) receptor 5 rs , rs , rs FAS 355 Fas cell surface death receptor rs FCGR2A 2212 Fc fragment of IgG, low affinity IIa, receptor rs (CD32) FCN ficolin (collagen/fibrinogen domain containing rs lectin) 2 IFNG 3458 interferon, gamma rs IFNGR interferon gamma receptor 1 rs IFNGR interferon gamma receptor 2 (interferon gamma transducer 1) rs
2 IFNL interferon, lambda 3 rs , rs IFNL interferon, lambda 4 (gene/pseudogene) rs IL1B 3553 interleukin 1, beta rs , rs , rs , rs IL1RN 3557 interleukin 1 receptor antagonist rs , rs IL interleukin 4 rs , rs , rs , rs , rs , rs IL4R 3566 interleukin 4 receptor rs , rs IL interleukin 5 rs IL7R 3575 interleukin 7 receptor rs IL interleukin 10 rs , rs , rs , rs IL10RB 3588 interleukin 10 receptor, beta rs , rs IL12A 3592 interleukin 12A rs , rs , rs , rs IL12B 3593 interleukin 12B rs , rs IL12RB interleukin 12 receptor, beta 1 rs , rs IL interleukin 13 rs , rs IL interleukin 15 rs , rs , rs , rs IL15RA 3601 interleukin 15 receptor, alpha rs IL interleukin 16 rs , rs IL interleukin 18 rs , rs IL interleukin 20 rs , rs , rs IRF interferon regulatory factor 4 rs , rs ITGB integrin, beta 2 (complement component 3 rs
3 receptor 3 and 4 subunit) JAK Janus kinase 3 rs MLH mutl homolog 1 rs NCF neutrophil cytosolic factor 4, 40kDa rs , rs , rs NLRC NLR family, CARD domain containing 5 rs TGFB transforming growth factor, beta 1 rs TGFBR transforming growth factor, beta receptor II (70/80kDa) rs TLR toll-like receptor 2 rs , rs , rs TLR toll-like receptor 3 rs TLR toll-like receptor 4 rs TLR toll-like receptor 9 rs TNFRSF13C tumor necrosis factor receptor superfamily, member 13C TNFSF tumor necrosis factor (ligand) superfamily, member 10 TNFSF13B tumor necrosis factor (ligand) superfamily, Call rate < 90% (n = 5) HWE P value <0.05 (n = 7) Monomorphic (n=3) member 13b rs rs rs , rs , rs , rs , rs References
4 1. Rosenstiel P, Hellmig S, Hampe J et al. Influence of polymorphisms in the NOD1/CARD4 and NOD2/CARD15 genes on the clinical outcome of Helicobacter pylori infection. Cell Microbiol 2006;8: Cheong JY, Cho SW, Choi JY et al. RANTES, MCP-1, CCR2, CCR5, CXCR1 and CXCR4 gene polymorphisms are not associated with the outcome of hepatitis B virus infection: results from a large scale single ethnic population. J Korean Med Sci 2007;22: Al-Qahtani A, Alarifi S, Al-Okail M et al. RANTES gene polymorphisms (-403G>A and -28C>G) associated with hepatitis B virus infection in a Saudi population. Genet Mol Res 2012;11: Skibola CF, Nieters A, Bracci PM et al. A functional TNFRSF5 gene variant is associated with risk of lymphoma. Blood 2008;111: Wang SS, Purdue MP, Cerhan JR et al. Common gene variants in the tumor necrosis factor (TNF) and TNF receptor superfamilies and NF-kB transcription factors and non-hodgkin lymphoma risk. PLoS One 2009;4:e Qin X, Deng Y, Liao XC et al. The IL-8 gene polymorphisms and the risk of the hepatitis B virus/infected patients. DNA Cell Biol 2012;31: Gu X, Wang H, Wang A et al. An intronic polymorphism rs in the CXCL14 gene influences HBV-related HCC progression in Chinese population. Mol Biol Rep 2012;39: Song H, Tong D, Cha Z, Bai J. C-X-C chemokine receptor type 5 gene polymorphisms are associated with non-hodgkin lymphoma. Mol Biol Rep 2012;39: Hosgood HD, III, Purdue MP, Wang SS et al. A pooled analysis of three studies evaluating genetic variation in innate immunity genes and non-hodgkin lymphoma risk. Br J Haematol 2011;152:
5 10. Hoang TV, Toan NL, Song lh et al. Ficolin-2 levels and FCN2 haplotypes influence hepatitis B infection outcome in Vietnamese patients. PLoS One 2011;6:e Babel N, Vergopoulos A, Trappe RU et al. Evidence for genetic susceptibility towards development of posttransplant lymphoproliferative disorder in solid organ recipients. Transplantation 2007;84: Lan Q, Zheng T, Rothman N et al. Cytokine polymorphisms in the Th1/Th2 pathway and susceptibility to non-hodgkin lymphoma. Blood 2006;107: de NA, Takkenberg RB, Benayed R et al. Genetic variation in IL28B and treatment outcome in HBeAg-positive and -negative chronic hepatitis B patients treated with Peg interferon alfa-2a and adefovir. Scand J Gastroenterol 2012;47: Sonneveld MJ, Wong VW, Woltman AM et al. Polymorphisms near IL28B and serologic response to peginterferon in HBeAg-positive patients with chronic hepatitis B. Gastroenterology 2012;142: Migita K, Maeda Y, Abiru S et al. Polymorphisms of interleukin-1beta in Japanese patients with hepatitis B virus infection. J Hepatol 2007;46: Matsuo K, Hamajima N, Suzuki R et al. No substantial difference in genotype frequencies of interleukin and myeloperoxidase polymorphisms between malignant lymphoma patients and non-cancer controls. Haematologica 2001;86: Chen J, Liang Z, Lu F et al. Toll-like receptors and cytokines/cytokine receptors polymorphisms associate with non-response to hepatitis B vaccine. Vaccine 2011;29: Monroy CM, Cortes AC, Lopez MS et al. Hodgkin disease risk: role of genetic polymorphisms and gene-gene interactions in inflammation pathway genes. Mol Carcinog 2011;50:36-46.
6 19. Wang Y, Xu P, Zhu D et al. Association of polymorphisms of cytokine and TLR-2 genes with long-term immunity to hepatitis B in children vaccinated early in life. Vaccine 2012;30: Lan Q, Wang SS, Menashe I et al. Genetic variation in Th1/Th2 pathway genes and risk of non-hodgkin lymphoma: a pooled analysis of three population-based case-control studies. Br J Haematol 2011;153: Wang SS, Carreon JD, Hanchard B, Chanock S, Hisada M. Common genetic variants and risk for non-hodgkin lymphoma and adult T-cell lymphoma/leukemia in Jamaica. Int J Cancer 2009;125: Yucesoy B, Johnson VJ, Fluharty K et al. Influence of cytokine gene variations on immunization to childhood vaccines. Vaccine 2009;27: Truelove AL, Oleksyk TK, Shrestha S et al. Evaluation of IL10, IL19 and IL20 gene polymorphisms and chronic hepatitis B infection outcome. Int J Immunogenet 2008;35: da Silva GN, Bacchi MM, Rainho CA, de Oliveira DE. Epstein-Barr virus infection and single nucleotide polymorphisms in the promoter region of interleukin 10 gene in patients with Hodgkin lymphoma. Arch Pathol Lab Med 2007;131: Frodsham AJ, Zhang L, Dumpis U et al. Class II cytokine receptor gene cluster is a major locus for hepatitis B persistence. Proc Natl Acad Sci U S A 2006;103: Xiao H, Zhang K. Genetic polymorphisms of tumor necrosis factor-alpha and lymphotoxin-alpha in Chinese patients with non-hodgkin lymphoma. Ann Hematol 2011;90: Liu L, Xu Y, Liu Z et al. IL12 polymorphisms, HBV infection and risk of hepatocellular carcinoma in a high-risk Chinese population. Int J Cancer 2011;128:
7 28. Wu JF, Wu TC, Chen CH et al. Serum levels of interleukin-10 and interleukin-12 predict early, spontaneous hepatitis B virus e antigen seroconversion. Gastroenterology 2010;138: Lin D, Liu C, Xue M et al. The role of interleukin-15 polymorphisms in adult acute lymphoblastic leukemia. PLoS One 2010;5:e Wang SS, Cerhan JR, Hartge P et al. Common genetic variants in proinflammatory and other immunoregulatory genes and risk for non-hodgkin lymphoma. Cancer Res 2006;66: Li S, Deng Y, Chen ZP et al. Genetic polymorphism of interleukin-16 influences susceptibility to HBV-related hepatocellular carcinoma in a Chinese population. Infect Genet Evol 2011;11: Skibola CF, Bracci PM, Halperin E et al. Genetic variants at 6p21.33 are associated with susceptibility to follicular lymphoma. Nat Genet 2009;41: Wang SS, Menashe I, Cerhan JR et al. Variations in chromosomes 9 and 6p21.3 with risk of non-hodgkin lymphoma. Cancer Epidemiol Biomarkers Prev 2011;20: Chen CC, Yang SY, Liu CJ et al. Association of cytokine and DNA repair gene polymorphisms with hepatitis B-related hepatocellular carcinoma. Int J Epidemiol 2005;34: Olsson LM, Lindqvist AK, Kallberg H et al. A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity. Arthritis Res Ther 2007;9:R Rossi D, Rasi S, Franceschetti S et al. Analysis of the host pharmacogenetic background for prediction of outcome and toxicity in diffuse large B-cell lymphoma treated with R-CHOP21. Leukemia 2009;23:
8 37. Roberts RL, Hollis-Moffatt JE, Gearry RB, Kennedy MA, Barclay ML, Merriman TR. Confirmation of association of IRGM and NCF4 with ileal Crohn's disease in a population-based cohort. Genes Immun 2008;9: Dai L, Gast A, Horska A et al. A case-control study of childhood acute lymphoblastic leukaemia and polymorphisms in the TGF-beta and receptor genes. Pediatr Blood Cancer 2009;52: Miedema KG, Tissing WJ, Te Poele EM et al. Polymorphisms in the TLR6 gene associated with the inverse association between childhood acute lymphoblastic leukemia and atopic disease. Leukemia 2012;26: Kim dy, Choi JW, Chang HY et al. Toll-like receptor polymorphisms are not associated with liver cirrhosis in hepatitis B virus infected Korean patients. Hepatogastroenterology 2010;57: Al-Qahtani A, Al-Ahdal M, Abdo A et al. Toll-like receptor 3 polymorphism and its association with hepatitis B virus infection in Saudi Arabian patients. J Med Virol 2012;84: Jia N, Xie Q, Lin L et al. Common variants of the TLR9 gene influence the clinical course of HBV infection. Mol Med Rep 2009;2: Liang XS, Caporaso N, McMaster ML et al. Common genetic variants in candidate genes and risk of familial lymphoid malignancies. Br J Haematol 2009;146: Novak AJ, Slager SL, Fredericksen ZS et al. Genetic variation in B-cell-activating factor is associated with an increased risk of developing B-cell non-hodgkin lymphoma. Cancer Res 2009;69:
9 Supplemental Table 2. Allele and genotype frequencies, and Hardy-Weinberg equilibrium of 89 single nucleotide polymorphisms analyzed Gene Gene ID SNP_ID Primer ID No. of typed samples (%) Genotype frequencies Allele frequencies HWE (p) - control CARD15/NOD rs C 103 C 206 Monomorphic 100% 100% CCL rs CC 47 CT 45 TT 12 C 139 T % 43% 12% 67% 33% rs CC 73 CG 26 GG 2 C 172 G % 26% 2% 85% 15% CD rs CC 27 CT 55 TT 21 C 109 T % 53% 21% 53% 47% CD40LG 959 rs GG 94 GA 4 AA 6 G 192 A 16 < % 4% 6% 92% 8% CD70/TNFSF7 970 rs TT 98 TC 6 T 202 C % 6% 97% 3% CXCL rs4073* TT 42 TA 49 T 133 A E-04 46% 54% 73% 27% CXCL rs GG 45 GC 47 CC 11 G 137 C % 46% 11% 67% 33% CXCR rs * CC 69 CT 11 TT 13 C 149 T 37 < % 12% 14% 80% 20% CXCR5 643 rs CC 80 CT 23 TT 1 C 183 T % 23% 1% 88% 12% rs GG 80 GA 24 G 184 A % 23% 88% 12% rs GG 71 GA 29 AA 4 G 171 A % 28% 4% 82% 18% FAS 355 rs TT 94 TC 9 T 197 C % 9% 96% 4% FCGR2A 2212 rs AA 52 AG 37 GG 14 A 141 G % 36% 14% 68% 32% FCN rs AA 87 AG 11 A 185 G % 11% 94% 6% IFNG 3458 rs TT 77 TA 22 AA 3 T 176 A % 22% 3% 86% 14% IFNGR rs TT 64 TC 34 CC 6 T 162 C % 33% 6% 78% 22% IFNGR rs TT 72 TC 30 CC 1 T 174 C % 29% 1% 84% 16% IFNL rs TT 95 TG 7 GG 2 T 197 G
10 91% 7% 2% 95% 5% rs AA 93 AG 9 GG 2 A 195 G % 9% 2% 94% 6% IFNL4 (IL28B) rs (65061) CC 80 CT 11 TT 4 C 171 T % 12% 4% 90% 10% IL1B 3553 rs GG 33 GA 48 AA 17 G 114 A % 49% 17% 58% 42% rs TT 33 TC 54 CC 16 T 120 C % 52% 16% 58% 42% rs AA 40 AG 47 GG 17 A 127 G % 45% 16% 61% 39% rs * AA 19 AG 31 GG 18 A 69 G % 46% 26% 51% 49% IL1RN 3557 rs AA 94 AT 9 A 197 T % 9% 96% 4% rs GG 42 GA 48 AA 14 G 132 A % 46% 13% 63% 37% IL rs TT 58 TC 41 CC 5 T 157 C % 39% 5% 75% 25% rs AA 77 AC 24 CC 3 A 178 C % 23% 3% 86% 14% rs TT 86 TG 18 T 190 G % 17% 91% 9% rs (65077) GG 83 GC 21 G 187 C % 20% 90% 10% rs CC 60 CA 39 AA 5 C 159 A % 38% 5% 76% 24% rs CC 62 CG 33 GG 4 C 157 G % 33% 4% 79% 21% IL4R 3566 rs AA 67 AG 35 GG 2 A 169 G % 34% 2% 81% 19% rs GG 37 GA 51 AA 15 G 125 A % 50% 15% 61% 39% IL rs (65093) TT 47 TC 42 CC 13 T 136 C % 41% 13% 67% 33% IL7R 3575 rs CC 28 CT 51 TT 25 C 107 T % 49% 24% 51% 49% IL rs TT 49 TG 45 GG 10 T 143 C % 43% 10% 69% 31% rs TT 49 TC 45 CC 10 T 143 C % 4% 10% 69% 31%
11 rs GG 92 GA 12 G 196 A % 12% 94% 6% rs AA 92 AG 12 A 196 G % 12% 94% 6% IL10RB 3588 rs AA 56 AG 37 GG 10 A 149 G % 36% 10% 72% 28% rs GG 36 GA 53 AA 15 G 125 A % 51% 14% 60% 40% IL12A 3592 rs AA 58 AG 33 GG 13 A 149 G % 32% 12% 72% 28% rs GG 80 GA 23 AA 1 G 183 A % 22% 1% 88% 12% rs GG 53 GA 38 AA 13 G 144 A % 37% 12% 69% 31% rs TT 79 TG 22 GG 3 T 180 G % 21% 3% 87% 13% IL12B 3593 rs GG 35 GC 48 CC 21 G 118 C % 46% 20% 57% 43% rs AA 36 AC 48 CC 20 A 120 C % 46% 19% 58% 42% IL12RB rs TT 46 TC 46 CC 12 T 138 C % 44% 12% 66% 34% rs * CC 42 CG 14 C 98 G % 25% 88% 12% IL rs GG 47 GA 46 AA 11 G 140 A % 44% 11% 67% 33% rs CC 67 CT 26 TT 1 C 160 T % 28% 1% 85% 15% IL rs AA 40 AC 45 CC 19 A 125 C % 43% 18% 60% 40% rs CC 40 CA 45 AA 19 C 125 A % 43% 18% 60% 40% rs TT 37 TC 48 CC 19 T 122 C % 46% 18% 59% 41% rs AA 39 AG 44 GG 21 A 122 G % 42% 20% 59% 41% IL15RA 3601 rs AA 27 AC 59 CC 18 A 113 C % 57% 17% 54% 46% IL rs GG 67 GA 34 AA 3 G 168 A % 33% 3% 81% 19% rs TT 74 TG 29 GG 1 T 177 G
12 71% 28% 1% 85% 155 IL rs187238* NA NA NA NA NA NA NA NA NA NA NA rs TT 74 TC 25 CC 3 T 173 C % 25% 3% 85% 15% IL rs CC 77 CT 22 TT 2 C 176 T % 22% 2% 87% 13% rs CC 63 CT 38 TT 3 C 164 T % 37% 3% 79% 21% rs GG 41 GC 47 CC 16 G 129 C % 45% 15% 62% 38% IRF rs AA 53 AG 41 GG 10 A 147 G % 39% 10% 71% 29% rs GG 85 GC 19 G 189 C % 18% 91% 9% ITGB rs TT 31 TC 50 CC 23 T 112 C % 48% 22% 54% 46% JAK rs CC 33 CT 48 TT 23 C 114 T % 46% 22% 55% 455% MLH rs AA 30 AG 57 GG 16 A 117 G % 55% 16% 57% 43% NCF rs CC 34 CT 57 TT 13 C 125 T % 55% 12% 60% 40% rs AA 50 AG 48 GG 6 A 148 G % 46% 6% 71% 29% rs TT 82 TC 21 CC 1 T 185 C % 20% 1% 89% 11% NLRC rs GG 103 G 206 Monomorphic 100% 100% TGFB rs TT 31 TC 54 CC 19 T 116 C % 52% 18% 56% 44% TGFBR rs CC 52 CT 40 TT 8 C 144 T % 40% 9% 72% 28% TLR rs TT 55 TC 41 CC 8 T 151 C % 40% 8% 73% 27% rs GG 104 G 208 Monomorphic 100% 100% rs GG 24 GT 55 TT 23 G 103 T % 54% 23% 50% 50% TLR rs (65065) CC 54 CA 45 AA 5 C 153 A % 43% 5% 74% 26%
13 TLR rs TT 73 TC 30 CC 16 T 176 C % 29% 1% 85% 15% TLR rs TT 44 TC 43 CC 14 T 131 C % 43% 14% 65% 35% TNFRSF13C rs GG 95 GA 8 G 198 A % 8% 96% 4% TNFSF rs CC 90 CA 11 C 191 A % 11% 95% 5% TNFSF13B rs GG 64 GA 36 AA 2 G 164 A % 35% 2% 80% 20% rs TT 103 GG 1 T 206 G % 1% 99% 1% rs CC 40 CT 45 TT 19 C 125 T % 43% 18% 60% 40% rs AA 33 AC 49 CC 22 A 115 C % 47% 21% 55% 45% rs TT 32 TA 48 AA 23 T 112 A % 47% 22% 54% 46% *Call rate < 90% (n = 5) HWE < 0.05 (n = 7) Monomorphic (n = 3) HWE, Hardy-Weinberg equilibrium
14 Supplemental Table 3. The association of 74 single nucleotide polymorphisms with the development of HBsAg reverse seroconversion Gene SNP_ID Model Genotype HBV-RS, no HBV-RS, yes OR (95% CI) P value AIC BIC CCL5 rs Recessive C/C-C/T 78 (86.7%) 14 (100%) T/T 12 (13.3%) 0 (0%) 0.00 (0.00-NA) rs Dominant C/C 64 (72.7%) 9 (69.2%) G/C-G/G 24 (27.3%) 4 (30.8%) 1.19 ( ) CD40 rs Dominant C/C 26 (29.2%) 1 (7.1%) C/T-T/T 63 (70.8%) 13 (92.9%) 5.37 ( Recessive C/C-C/T 71 (79.8%) 11 (78.6%) T/T 18 (20.2%) 3 (21.4%) 1.08 ( ) CD70/TNFSF7 rs T/T 85 (94.4%) 13 (92.9%) C/T 5 (5.6%) 1 (7.1%) 1.31 ( ) CXCL14 rs Dominant G/G 37 (41.6%) 8 (57.1%) C/G-C/C 52 (58.4%) 6 (42.9%) 0.53 ( ) CXCR5 rs Recessive C/C-C/T 89 (98.9%) 14 (100%) T/T 1 (1.1%) 0 (0%) 0.00 (0.00-NA) rs G/G 67 (74.4%) 13 (92.9%) A/G 23 (25.6%) 1 (7.1%) 0.22 ( ) rs Dominant G/G 60 (66.7%) 11 (78.6%) A/G-A/A 30 (33.3%) 3 (21.4%) 0.55 ( ) FAS rs T/T 81 (91%) 13 (92.9%) C/T 8 (9%) 1 (7.1%) 0.78 ( ) FCN2 rs A/A 76 (90.5%) 11 (78.6%) A/G 8 (9.5%) 3 (21.4%) 2.59 ( ) IFNG rs Dominant T/T 69 (78.4%) 8 (57.1%) A/T-A/A 19 (21.6%) 6 (42.9%) 2.72 ( ) IFNGR1 rs Recessive T/T-C/T 86 (95.6%) 12 (85.7%) C/C 4 (4.4%) 2 (14.3%) 3.58 ( ) IFNGR2 rs Dominant T/T 63 (70.8%) 9 (64.3%) C/T-C/C 26 (29.2%) 5 (35.7%) 1.35 ( ) IL1B rs16944 Dominant G/G 30 (34.9%) 3 (25%) A/G-A/A 56 (65.1%) 9 (75%) 1.61 ( ) rs Dominant T/T 30 (33.7%) 3 (21.4%)
15 C/T-C/C 59 (66.3%) 11 (78.6%) 1.86 ( ) rs Recessive A/A-A/G 76 (84.4%) 11 (78.6%) G/G 14 (15.6%) 3 (21.4%) 1.48 ( ) IL1RN rs A/A 82 (92.1%) 12 (85.7%) A/T 7 (7.9%) 2 (14.3%) 1.95 ( ) rs Dominant G/G 34 (37.8%) 8 (57.1%) A/G-A/A 56 (62.2%) 6 (42.9%) 0.46 ( ) IL4 rs Recessive T/T-C/T 86 (95.6%) 13 (92.9%) C/C 4 (4.4%) 1 (7.1%) 1.65 ( rs Dominant A/A 69 (76.7%) 8 (57.1%) A/C-C/C 21 (23.3%) 6 (42.9%) 2.46 ( ) rs T/T 72 (80%) 14 (100%) T/G 18 (20%) 0 (0%) 0.00 (0.00-NA) rs G/G 69 (76.7%) 14 (100%) C/G 21 (23.3%) 0 (0%) 0.00 (0.00-NA) rs Recessive C/C-A/C 86 (95.6%) 13 (92.9%) A/A 4 (4.4%) 1 (7.1%) 1.65 ( ) rs Recessive C/C-C/G 82 (96.5%) 13 (92.9%) G/G 3 (3.5%) 1 (7.1%) 2.10 ( ) IL4R rs Dominant A/A 60 (66.7%) 7 (50%) A/G-G/G 30 (33.3%) 7 (50%) 2.00 ( ) rs Dominant G/G 33 (37.1%) 4 (28.6%) A/G-A/A 56 (62.9%) 10 (71.4%) 1.47 ( ) IL5 rs Dominant T/T 43 (48.3%) 4 (30.8%) C/T-C/C 46 (51.7%) 9 (69.2%) 2.10 ( ) IL7R rs Recessive C/C-C/T 67 (74.4%) 12 (85.7%) T/T 23 (25.6%) 2 (14.3%) 0.49 ( ) IL10 rs Dominant T/T 45 (50%) 4 (28.6%) T/G-G/G 45 (50%) 10 (71.4%) 2.50 ( ) rs Dominant T/T 45 (50%) 4 (28.6%) C/T-C/C 45 (50%) 10 (71.4%) 2.50 ( ) rs G/G 80 (88.9%) 12 (85.7%) A/G 10 (11.1%) 2 (14.3%) 1.33 ( ) rs A/A 80 (88.9%) 12 (85.7%)
16 A/G 10 (11.1%) 2 (14.3%) 1.33 ( ) IL10RB rs Dominant A/A 47 (52.8%) 9 (64.3%) A/G-G/G 42 (47.2%) 5 (35.7%) 0.62 ( ) rs Recessive G/G-A/G 79 (87.8%) 10 (71.4%) A/A 11 (12.2%) 4 (28.6%) 2.87 ( ) IL12A rs Dominant G/G 69 (76.7%) 11 (78.6%) A/G-A/A 21 (23.3%) 3 (21.4%) 0.90 ( ) rs Dominant G/G 44 (48.9%) 9 (64.3%) A/G-A/A 46 (51.1%) 5 (35.7%) 0.53 ( ) rs Recessive T/T-T/G 88 (97.8%) 13 (92.9%) G/G 2 (2.2%) 1 (7.1%) 3.38 ( ) IL12B rs Dominant G/G 28 (31.1%) 7 (50%) C/G-C/C 62 (68.9%) 7 (50%) 0.45 ( ) rs Dominant A/A 29 (32.2%) 7 (50%) A/C-C/C 61 (67.8%) 7 (50%) 0.48 ( ) IL12RB1 rs Dominant T/T 39 (43.3%) 7 (85.7%) C/T-C/C 51 (56.7%) 7 (14.3%) 0.76 ( ) IL13 rs Dominant G/G 40 (44.4%) 7 (50%) A/G-A/A 50 (55.6%) 7 (50%) 0.80 ( ) Recessive G/G-A/G 83 (92.2%) 10 (71.4%) A/A 7 (7.8%) 4 (28.6%) 4.74 ( ) rs Dominant C/C 59 (73.8%) 8 (57.1%) C/T-T/T 21 (26.2%) 6 (42.9%) 2.11 ( ) IL15 rs Dominant A/A 36 (40%) 4 (28.6%) A/C-C/C 54 (60%) 10 (71.4%) 1.67 ( ) rs Dominant C/C 36 (40%) 4 (28.6%) A/C-A/A 54 (60%) 10 (71.4%) 1.67 ( ) rs Dominant T/T 34 (37.8%) 3 (21.4%) C/T-C/C 56 (62.2%) 11 (78.6%) 2.23 ( ) rs Recessive A/A-A/G 73 (81.1%) 10 (71.4%) G/G 17 (18.9%) 4 (28.6%) 1.72 ( ) IL15RA rs Dominant A/A 24 (26.7%) 3 (21.4%) A/C-C/C 66 (73.3%) 11 (78.6%) 1.33 ( ) IL16 rs Dominant G/G 60 (66.7%) 7 (50%)
17 A/G-A/A 30 (33.3%) 7 (50%) 2.00 ( ) rs Dominant T/T 65 (72.2%) 9 (64.3%) T/G-G/G 25 (27.8%) 5 (35.7%) 1.44 ( ) IL18 rs CodominanT/T 67 (76.1%) 7 (50%) C/T 18 (20.4%) 7 (50%) 3.72 ( ) C/C 3 (3.4%) 0 (0%) 0.00 (0.00-NA) Dominant T/T 67 (76.1%) 7 (50%) C/T-C/C 21 (23.9%) 7 (50%) 3.19 ( ) Recessive T/T-C/T 85 (96.6%) 14 (100%) C/C 3 (3.4%) 0 (0%) 0.00 (0.00-NA) IL20 rs Recessive C/C-C/T 85 (97.7%) 14 (78.6%) T/T 2 (2.3%) 0 (21.4%) 0.00 (0.00-NA) rs CodominanC/C 58 (64.4%) 5 (35.7%) C/T 29 (32.2%) 9 (64.3%) 3.60 ( ) T/T 3 (3.3%) 0 (0%) 0.00 (0.00-NA) Dominant C/C 58 (64.4%) 5 (35.7%) C/T-T/T 32 (35.6%) 9 (64.3%) 3.26 ( ) Recessive C/C-C/T 87 (96.7%) 14 (100%) T/T 3 (3.3%) 0 (0%) 0.00 (0.00-NA) rs Dominant G/G 34 (37.8%) 7 (50%) C/G-C/C 56 (62.2%) 7 (50%) 0.61 ( ) IRF4 rs Recessive A/A-A/G 80 (88.9%) 14 (100%) G/G 10 (11.2%) 0 (0%) 0.00 (0.00-NA) rs G/G 74 (82.2%) 11 (78.6%) C/G 16 (17.8%) 3 (21.4%) 1.26 ( ) ITGB2 rs Dominant T/T 28 (31.1%) 3 (21.4%) C/T-C/C 62 (68.9%) 62 (68.9%) 1.66 ( ) JAK3 rs3008 Recessive C/C-C/T 72 (80%) 9 (64.3%) T/T 18 (20%) 5 (35.7%) 2.22 ( ) MLH1 rs Recessive A/A-A/G 76 (85.4%) 11 (78.6%) G/G 13 (14.6%) 3 (21.4%) 1.59 ( ) NCF4 rs Recessive C/C-C/T 80 (88.9%) 11 (78.6%) T/T 10 (11.1%) 3 (21.4%) 2.18 ( ) rs Dominant A/A 46 (51.1%) 4 (28.6%)
18 A/G-G/G 44 (48.9%) 10 (71.4%) 2.61 ( ) rs Dominant T/T 72 (79.8%) 10 (71.4%) C/T-C/C 18 (20.2%) 4 (28.6%) 1.60 ( ) TGFB1 rs Dominant T/T 24 (26.7%) 7 (50%) C/T-C/C 66 (73.3%) 7 (50%) 0.36 ( ) Recessive T/T-C/T 72 (80%) 13 (92.9%) C/C 18 (20%) 1 (7.1%) 0.31 ( ) TGFBR2 rs Dominant C/C 46 (52.9%) 6 (41.7%) C/T-T/T 41 (47.1%) 7 (58.3%) 1.31 ( ) TLR2 rs Recessive T/T-C/T 82 (91.1%) 14 (100%) C/C 8 (9%) 0 (0%) 0.00 (0.00-NA) rs Recessive G/G-T/G 67 (76.1%) 12 (85.7%) T/T 21 (23.9%) 2 (14.3%) 0.53 ( ) TLR3 rs Recessive C/C-A/C 85 (94.4%) 14 (100%) A/A 5 (5.6%) 0 (0%) 0.00 (0.00-NA) TLR4 rs Dominant T/T 62 (68.9%) 11 (78.6%) C/T-C/C 28 (31.1%) 3 (21.4%) 0.60 ( ) TLR9 rs Dominant T/T 39 (44.8%) 5 (35.7%) C/T-C/C 48 (55.2%) 9 (64.3%) 1.46 ( ) TNFRSF13C rs G/G 84 (94.4%) 11 (78.6%) A/G 5 (5.6%) 3 (21.4%) 4.58 ( ) TNFSF10 rs C/C 77 (88.5%) 13 (92.9%) A/C 10 (11.5%) 1 (7.1%) 0.59 ( ) TNFSF13B rs Recessive G/G-A/G 87 (98.9%) 13 (92.9%) A/A 1 (1.5%) 1 (7.1%) 6.69 ( ) rs Recessive C/C-C/T 73 (81.1%) 12 (85.7%) T/T 17 (18.9%) 2 (14.3%) 0.72 ( ) rs CodominanA/A 32 (35.6%) 1 (7.1%) (42.2%) 11 (78.6%) 9.26 ( ) 20 (22.2%) 2 (14.3%) 3.20 ( ) Dominant A/A 32 (35.6%) 1 (7.1%) A/C-C/C 32 (35.6%) 13 (92.9%) 7.17 ( ) Recessive A/C-A/C 70 (77.8%) 12 (85.7%) C/C 20 (22.2%) 2 (14.3%) 0.58 ( )
19 rs CodominanT/T 31 (34.8%) 1 (7.1%) A/T 37 (41.6%) 11 (78.6%) 9.22 ( ) A/A 21 (23.6%) 2 (14.3%) 2.95 ( ) Dominant T/T 31 (34.8%) 1 (7.1%) A/T-A/A 58 (65.2%) 13 (92.9%) 6.95 ( ) Recessive T/T-A/T 68 (76.4%) 12 (85.7%) A/A 21 (23.6%) 2 (14.3%) 0.54 ( )
20 Supplemental Table 4. Linkage disequilibrium analysis of nine candidate single nucleotide polymorphisms D statistic CCL5 IL13 IL18 IL20 CD40 TNFSF13B IL4 TNFSF13B IL4 rs rs rs rs rs rs rs rs rs CCL5 rs IL13 rs IL18 rs IL20 rs CD40 rs TNFSF13B rs IL4 rs TNFSF13B rs IL4 rs D' statistic CCL5 IL13 IL18 IL20 CD40 TNFSF13B IL4 TNFSF13B IL4 rs rs rs rs rs rs rs rs rs CCL5 rs IL13 rs IL18 rs IL20 rs CD40 rs TNFSF13B rs IL4 rs TNFSF13B rs IL4 rs r statistic CCL5 IL13 IL18 IL20 CD40 TNFSF13B IL4 TNFSF13B IL4 rs rs rs rs rs rs rs rs rs CCL5 rs IL13 rs IL18 rs IL20 rs CD40 rs TNFSF13B rs IL4 rs TNFSF13B rs IL4 rs
21 P-values CCL5 IL13 IL18 IL20 CD40 TNFSF13B IL4 TNFSF13B IL4 rs rs rs rs rs rs rs rs rs CCL5 rs IL13 rs IL18 rs IL20 rs CD40 rs TNFSF13B rs IL4 rs TNFSF13B rs IL4 rs
22 Supplemental Table 5. Genotype distribution within haplotypes of IL4 rs ~rs and TNFSF13B rs ~rs IL4 rs n (%) P G/G C/G < rs n (%) T/T 83 (79.8) 3 (2.9) T/G 0 (0) 18 (17.3) TNFSF13B rs n (%) P T/T A/T-A/A < rs n (%) A/A 32 (31.1) 1 (1) A/C-C/C 0 (0) 70 (68) 1 Fisher's Exact Test n, number of patients; %, percent of total patients analyzed
IL10 rs polymorphism is associated with liver cirrhosis and chronic hepatitis B
IL10 rs1800896 polymorphism is associated with liver cirrhosis and chronic hepatitis B L.N. Cao 1, S.L. Cheng 2 and W. Liu 3 1 Kidney Disease Department of Internal Medicine, Xianyang Central Hospital,
More informationHLA-A*26 and Susceptibility of Iranian Patients with Non-Hodgkin Lymphoma
HLA-A*26 and Susceptibility of Iranian Patients with Non-Hodgkin Lymphoma Arezou Sayad 1, Mohammad Taghi Akbari 2**, Mahshid Mehdizadeh 3,4, Mohammad Taheri 1, Abbas Hajifathali 3* 1 Department of Medical
More informationInfluence of interleukin-18 gene polymorphisms on acute pancreatitis susceptibility in a Chinese population
Influence of interleukin-18 gene polymorphisms on acute pancreatitis susceptibility in a Chinese population H.B. Gui 1, X.G. Du 2, Z.H. Fu 3 and X.M. Chen 1 1 Department of Emergency, The First Affiliated
More informationLack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population
Lack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population J. Zhu 1 *, F. He 2 *, D.D. Zhang 2 *, J.Y. Yang 2, J. Cheng 1, R. Wu 1, B. Gong 2, X.Q. Liu
More informationSupplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2
Supplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2 rs4402960, (B) MTNR1B rs10830963, (C) TCF7L2 rs7903146, (D) IRS1 rs1801278, (E) PPARG rs1801282, (F)
More informationLack of association between IL-6-174G>C polymorphism and lung cancer: a metaanalysis
Lack of association between IL-6-174G>C polymorphism and lung cancer: a metaanalysis Y. Liu, X.L. Song, G.L. Zhang, A.M. Peng, P.F. Fu, P. Li, M. Tan, X. Li, M. Li and C.H. Wang Department of Respiratory
More informationLack of association between ERCC5 gene polymorphisms and gastric cancer risk in a Chinese population
Lack of association between ERCC5 gene polymorphisms and gastric cancer risk in a Chinese population J.J. Lu, H.Q. Zhang, P. Mai, X. Ma, X. Chen, Y.X. Yang and L.P. Zhang Gansu Provincial Hospital, Donggang
More informationInfluence of interleukin-17 gene polymorphisms on the development of pulmonary tuberculosis
Influence of interleukin-17 gene polymorphisms on the development of pulmonary tuberculosis G.-C. Shi and L.-G. Zhang Department of Tuberculosis, The First Affiliated Hospital of Xinxiang Medical University,
More informationRelationship between vitamin D (1,25-dihydroxyvitamin D3) receptor gene polymorphisms and primary biliary cirrhosis risk: a meta-analysis
Relationship between vitamin D (1,25-dihydroxyvitamin D3) receptor gene polymorphisms and primary biliary cirrhosis risk: a meta-analysis F. Fang, J. Wang, J. Pan, G.H. Su, L.X. Xu and G. Li Institute
More informationTo compare the relative amount of of selected gene expression between sham and
Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter
More informationAssociation between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population
Association between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population R. Zhao and M.F. Ying Department of Pharmacy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University,
More informationInvestigation on ERCC5 genetic polymorphisms and the development of gastric cancer in a Chinese population
Investigation on ERCC5 genetic polymorphisms and the development of gastric cancer in a Chinese population L.Q. Yang 1, Y. Zhang 2 and H.F. Sun 3 1 Department of Gastroenterology, The Second Affiliated
More informationSupplementary information
Supplementary information Hepatitis B virus genotype, mutations, human leukocyte antigen polymorphisms and their interactions in hepatocellular carcinoma: a multi-centre case-control study Juan Wen, Ci
More informationDetection and significance of PD-1.3 SNP (rs ) and IL28B SNP (rs ) in patients with current or past hepatitis B virus (HBV) infection
Detection and significance of PD-1.3 SNP (rs11568821) and IL28B SNP (rs12979860) in patients with current or past hepatitis B virus (HBV) infection Asterios Saitis 1, Nikolaos K. Gatselis 1, Kalliopi Azariadi
More informationInvestigating the role of polymorphisms in mir-146a, -149, and -196a2 in the development of gastric cancer
Investigating the role of polymorphisms in mir-146a, -149, and -196a2 in the development of gastric cancer Department of Gastrointestinal Surgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong
More informationGenetics of Pediatric Inflammatory Bowel Disease
Genetics of Pediatric Inflammatory Bowel Disease Judith Kelsen MD Assistant Professor of Pediatrics Division of Gastroenterology, Hepatology, and Nutrition IBD Education Day 2/9/2014 Objectives Brief overview
More informationAssociation between IL-17A and IL-17F gene polymorphisms and risk of gastric cancer in a Chinese population
Association between IL-17A and IL-17F gene polymorphisms and risk of gastric cancer in a Chinese population W.M. Zhao 1, P. Shayimu 1, L. Liu 1, F. Fang 1 and X.L. Huang 2 1 Department of Gastrointestinal
More informationANALYSIS OF IL17 AND IL17RA POLYMORPHISMS IN SPANISH PSORIASIS PATIENTS: ASSOCIATION WITH RISK FOR DISEASE.
ANALYSIS OF IL17 AND IL17RA POLYMORPHISMS IN SPANISH PSORIASIS PATIENTS: ASSOCIATION WITH RISK FOR DISEASE. Batalla A, Coto E*, González-Lara L, González- Fernández D, Maldonado-Seral C, García-García
More informationAssociation of interferon-alpha gene polymorphisms with chronic hepatitis B virus infection
doi: 10.1111/iji.12055 Association of interferon-alpha gene polymorphisms with chronic hepatitis B virus infection I. Kimkong*,, P. Tangkijvanich & N. Hirankarn Summary In this study, the association between
More informationReview Article Association between HLA-DQ Gene Polymorphisms and HBV-Related Hepatocellular Carcinoma
Hindawi Gastroenterology Research and Practice Volume 2017, Article ID 7150386, 11 pages https://doiorg/101155/2017/7150386 Review Article Association between HLA-DQ Gene Polymorphisms and HBV-Related
More informationAssociation between interleukin-17a polymorphism and coronary artery disease susceptibility in the Chinese Han population
Association between interleukin-17a polymorphism and coronary artery disease susceptibility in the Chinese Han population G.B. Su, X.L. Guo, X.C. Liu, Q.T. Cui and C.Y. Zhou Department of Cardiothoracic
More informationA meta-analysis of the association between IL28B polymorphisms and infection susceptibility of hepatitis B virus in Asian population
Chen et al. BMC Gastroenterology (2015) 15:58 DOI 10.1186/s12876-015-0286-2 RESEARCH ARTICLE Open Access A meta-analysis of the association between IL28B polymorphisms and infection susceptibility of hepatitis
More informationIL-17 rs genetic variation contributes to the development of gastric cancer in a Chinese population
IL-17 rs2275913 genetic variation contributes to the development of gastric cancer in a Chinese population B.L. Xu, Y.T. Li, S.X. Dong, J. Qi, H.M. Feng, L. Zi and D.Y. Yang Department of General Surgery,
More informationAssociation between MTHFR 677C/T and 1298A/C gene polymorphisms and breast cancer risk
Association between MTHFR 677C/T and 1298A/C gene polymorphisms and breast cancer risk X.F. Zhang 1, T. Liu 2, Y. Li 1 and S. Li 2 1 Department of Breast, Liao Ning Cancer Hospital and Institute, Shenyang,
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAssociation of Polymorphisms intrail and Chronic Hepatitis B in Chinese Han Populations from Shandong Province
374 Available online at www.annclinlabsci.org Annals of Clinical & Laboratory Science, vol. 46, no. 4, 2016 Association of Polymorphisms intrail and Chronic Hepatitis B in Chinese Han Populations from
More informationPooled analysis of association between a genetic variant in the 3'-untranslated region of Toll-like receptor 4 and cancer risk
Pooled analysis of association between a genetic variant in the 3'-untranslated region of Toll-like receptor 4 and cancer risk X. Wang*, Z. Xu* and C.H. Miao Department of Anesthesiology, Shanghai Cancer
More informationGenetic variation in TNF and IL10 and risk of non-hodgkin lymphoma: a report from the InterLymph Consortium
Genetic variation in TNF and IL10 and risk of non-hodgkin lymphoma: a report from the InterLymph Consortium Nathaniel Rothman, Christine F Skibola, Sophia S Wang, Gareth Morgan, Qing Lan, Martyn T Smith,
More informationAssociation study between polymorphism of interleukin 12B 1188A/C and hepatitis B virus infection in a Chinese Han population
Experimental immunology DOI: 10.5114/ceji.2013.39763 Association study between polymorphism of interleukin 12B 1188A/C and hepatitis B virus infection in a Chinese Han population Zusen Wang 1, Congcong
More informationAssociation between the -77T>C polymorphism in the DNA repair gene XRCC1 and lung cancer risk
Association between the -77T>C polymorphism in the DNA repair gene XRCC1 and lung cancer risk B.B. Sun, J.Z. Wu, Y.G. Li and L.J. Ma Department of Respiratory Medicine, People s Hospital Affiliated to
More informationSupplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC
Supplementary Table 1. The distribution of IFNL rs12979860 and rs8099917 and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC rs12979860 (n=3129) CC 1127 1145.8 CT 1533 1495.3 TT
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationAssociation between the interleukin-1β gene -511C/T polymorphism and ischemic stroke: an updated meta-analysis
Association between the interleukin-1β gene -511C/T polymorphism and ischemic stroke: an updated meta-analysis W. Yan, Z.Y. Chen, J.Q. Chen and H.M. Chen Department of Neurology, Ningbo No. 2 Hospital,
More informationAssociation between polymorphisms in the promoter region of pri-mir-34b/c and risk of hepatocellular carcinoma
Association between polymorphisms in the promoter region of pri-mir-34b/c and risk of hepatocellular carcinoma L.L. Chen 1,2, Y. Shen 3, J.B. Zhang 4, S. Wang 5, T. Jiang 6, M.Q. Zheng 6, Z.J. Zheng 7
More informationThe association between TCM syndromes and SCAP polymorphisms in subjects with non-alcoholic fatty liver disease
The association between TCM syndromes and SCAP polymorphisms in subjects with non-alcoholic fatty liver disease Shanshan Sun, Tao Wu, Miao Wang, Wei Li, Lin Wang, Songhua He, Huafeng Wei, Haiyan Song,
More informationRole of IL-10 polymorphisms in susceptibility to hepatitis B virus-related hepatocellular carcinoma
Role of IL-10 polymorphisms in susceptibility to hepatitis B virus-related hepatocellular carcinoma M.W. Peng 1, S.Q. Lu 2, J. Liu 1 and C.Y. Dong 1 1 Laboratory of Molecular Virus & Cancer, State Key
More informationImportance of Attention. The Attention System 7/16/2013
Importance of Attention Preliminary Evidence of an Association Between an IL6 Promoter Polymorphism and Self-Reported Attentional Function in Oncology Patients and Their Family Caregivers John Merriman,
More informationNature Genetics: doi: /ng Supplementary Figure 1. Study design.
Supplementary Figure 1 Study design. Leukopenia was classified as early when it occurred within the first 8 weeks of thiopurine therapy and as late when it occurred more than 8 weeks after the start of
More informationAssociation between ERCC1 and XPF polymorphisms and risk of colorectal cancer
Association between ERCC1 and XPF polymorphisms and risk of colorectal cancer H. Yang, G. Li and W.F. Li Departments of Radiation Oncology and Chemotherapy, The First Affiliated Hospital of Wenzhou Medical
More informationOriginal Article Common sequence variants in chemokine-related genes and risk of breast cancer in post-menopausal women
Int J Mol Epidemiol Genet 2013;4(4):218-227 www.ijmeg.org /ISSN:1948-1756/IJMEG1310001 Original Article Common sequence variants in chemokine-related genes and risk of breast cancer in post-menopausal
More informationTNF-α antibodies in immune-mediated inflammatory disorders
1 TNF-α antibodies in immune-mediated inflammatory disorders Potential side effects: allergic reactions, opportunistic infections joint lesions and psoriasiform and eczematiform skin lesions Seemingly
More informationThe Effect of Antiviral Therapy on Liver Fibrosis in CHC. Jidong Jia Beijing Friendship Hospital, Capital Medical University
The Effect of Antiviral Therapy on Liver Fibrosis in CHC Jidong Jia Beijing Friendship Hospital, Capital Medical University 2016-5-29 1 Disclosure Consultation for Abbvie, BMS, Gilead, MSD, Novartis and
More informationCYP1A2 polymorphism in Chinese patients with acute liver injury induced by Polygonum multiflorum
CYP1A2 polymorphism in Chinese patients with acute liver injury induced by Polygonum multiflorum K.F. Ma, X.G. Zhang and H.Y. Jia The First Affiliated Hospital, Zhejiang University, Hangzhou, China Corresponding
More informationRESEARCH ARTICLE. Tumor Necrosis Factor-α 238 G/A Polymorphism and Risk of Hepatocellular Carcinoma: Evidence from a Meta-analysis
RESEARCH ARTICLE Tumor Necrosis Factor-α 238 G/A Polymorphism and Risk of Hepatocellular Carcinoma: Evidence from a Meta-analysis Ke Cheng 1, Yu-Jun Zhao 1, Lian Liu 1, Jing-Jing Wan 2 * Abstract Background:
More informationNew Interferons and Immunomodulators
New Interferons and Immunomodulators T. Jake Liang, M.D. Bethesda, MD, USA Interferons What are they? Who cares? The Interferon family Type 1: 3 subtypes, all cell types, IFNAR1 and 2 IFN-α, 14 species
More informationRole of IL-8 rs4073 and rs polymorphisms in the development of primary gouty arthritis in a Chinese population
Role of IL-8 rs4073 and rs2227306 polymorphisms in the development of primary gouty arthritis in a Chinese population Y.X. Cui, H. Zhao and H.Q. Guo Department of Rheumatism, Yan an University Affiliated
More informationRetrospective Genetic Analysis of Efficacy and Adverse Events in a Rheumatoid Arthritis Population Treated with Methotrexate and Anti-TNF-α
Retrospective Genetic Analysis of Efficacy and Adverse Events in a Rheumatoid Arthritis Population Treated with Methotrexate and Anti-TNF-α Foti A 1, Lichter D 1, Shadick NA 2, Maher NE 2, Ginsburg GS
More informationTNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
More informationqpcr-array Analysis Service
qpcr-array Analysis Service Customer Name Institute Telephone Address E-mail PO Number Service Code Report Date Service Laboratory Department Phalanx Biotech Group, Inc 6 Floor, No.6, Technology Road 5,
More informationTransduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
More informationLaboratory of Chronic Kidney Disease Prevention and Treatment (Peking University), Ministry of Education; Beijing, , People's Republic of China
Concise Communication DOI 10.1002/art.39268 Variants in CCR6 are associated with susceptibility to lupus nephritis in Chinese Authors: Xu-jie Zhou 1, MD & PhD;Rong Mu 2, MD & PhD;Chun Li 2, MD;Swapan K
More informationAssociation of the IL6 polymorphism rs with cancer risk: a meta-analysis
Association of the IL6 polymorphism rs1800796 with cancer risk: a meta-analysis Y. Du 1,2 *, L. Gao 1,2 *, K. Zhang 1 and J. Wang 1 1 Key Laboratory of Mental Health, Institute of Psychology, Chinese Academy
More informationViral hepatitis and Hepatocellular Carcinoma
Viral hepatitis and Hepatocellular Carcinoma Hashem B. El-Serag, MD, MPH Dan L. Duncan Professor of Medicine Chief, Gastroenterology and Hepatology Houston VA & Baylor College of Medicine Houston, TX Outline
More informationPolymorphisms of CYP27B1 are associated with IFN efficacy in HBeAg-positive patients
Received: 18 June 2017 Accepted: 3 November 2017 DOI: 10.1002/jcla.22367 RESEARCH ARTICLE Polymorphisms of CYP27B1 are associated with IFN efficacy in HBeAg-positive patients Yingying Wu 1,2 Yongbin Zeng
More informationAdvances in gene encoding proteins of human herpesvirus 6
2009 9 4 3 Journal of Microbes and Infection, September 2009, Vol. 4, No. 3 165 6 1, 2 1., 241000; 2., 210029 : 6 ( HHV-6) DNA, HHV-6 80 100, ( IE) DNA DNA HHV-6 : 6 ; ; Advances in gene encoding proteins
More informationDNA repair gene XRCC3 T241M polymorphism and susceptibility to hepatocellular carcinoma in a Chinese population: a meta-analysis
DNA repair gene XRCC3 T241M polymorphism and susceptibility to hepatocellular carcinoma in a Chinese population: a meta-analysis R.B. Ji, Y.S. Qian, A.R. Hu and Y.R. Hu Liver Disease Research Center, Ningbo
More informationmir-146a and mir-196a2 polymorphisms in ovarian cancer risk
mir-146a and mir-196a2 polymorphisms in ovarian cancer risk X.C. Sun, A.C. Zhang, L.L. Tong, K. Wang, X. Wang, Z.Q. Sun and H.Y. Zhang Department of Obstetrics and Gynecology, China-Japan Union Hospital
More informationAssociation between the pre-mir-196a2 rs polymorphism and gastric cancer susceptibility in a Chinese population
Association between the pre-mir-196a2 rs11614913 polymorphism and gastric cancer susceptibility in a Chinese population M. Li, R.J. Li, H. Bai, P. Xiao, G.J. Liu, Y.W. Guo and J.Z. Mei Department of Medical
More informationChapter 11 CYTOKINES
Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune
More informationHepatitis B Update. Jorge L. Herrera, M.D. University of South Alabama Mobile, AL. Gastroenterology
Hepatitis B Update Jorge L. Herrera, M.D. University of South Alabama Mobile, AL Deciding Who to Treat Is hepatitis B a viral disease or a liver disease? Importance of HBV-DNA Levels in the Natural History
More informationInvestigation of Programmed Cell Death-1 (PD-1) Gene Variations at Positions PD1.3 and PD1.5 in Iranian Patients with Non-small Cell Lung Cancer
Original Article Middle East Journal of Cancer; January 2018; 9(1): 13-17 Investigation of Programmed Cell Death-1 (PD-1) Gene Variations at Positions PD1.3 and PD1.5 in Iranian Patients with Non-small
More informationFigure 1. Stepwise approach of treating patients with rheumatoid arthritis.
Establish diagnosis early Document baseline disease activity and damage Estimate prognosis Initiate therapy Begin patient education Start DMARD therapy within 3 months Consider NSAID Consider local or
More informationSingle nucleotide polymorphisms in CXCR1 gene and its association with hepatitis B infected patients in Saudi Arabia
220 Almajhdi F, et al., 2013; 12 (2): 220-227 ORIGINAL ARTICLE March-April, Vol. 12 No.2, 2013: 220-227 Single nucleotide polymorphisms in CXCR1 gene and its association with hepatitis B infected patients
More informationSingle nucleotide polymorphisms in ZNRD1-AS1 increase cancer risk in an Asian population
/, 2017, Vol. 8, (No. 6), pp: 10064-10070 Single nucleotide polymorphisms in ZNRD1-AS1 increase cancer risk in an Asian population Ping-Yu Wang 1,2, Jing-Hua Li 2, Yue-Mei Liu 1, Qing Lv 1, Ning Xie 3,
More informationOriginal Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population
Int J Clin Exp Med 2014;7(12):5832-5836 www.ijcem.com /ISSN:1940-5901/IJCEM0002117 Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk
More informationReview Article MicroRNA single-nucleotide polymorphisms and susceptibility to gastric cancer
Am J Digest Dis 2016;3(1):11-15 www.ajdd.us /ISSN:2329-6992/AJDD0023804 Review Article MicroRNA single-nucleotide polymorphisms and susceptibility to gastric cancer Xinhang Jiang, Xintong Chen, Linhua
More informationNatural History of HBV Infection
Natural History of HBV Infection Joseph JY Sung MD PhD Institute of Digestive Disease Department of Medicine & Therapeutics Prince of Wales Hospital The Chinese University of Hong Kong HBV Infection 2
More informationGenetic variants on 17q21 are associated with asthma in a Han Chinese population
Genetic variants on 17q21 are associated with asthma in a Han Chinese population F.-X. Li 1 *, J.-Y. Tan 2 *, X.-X. Yang 1, Y.-S. Wu 1, D. Wu 3 and M. Li 1 1 School of Biotechnology, Southern Medical University,
More informationNatural History of Chronic Hepatitis B
Natural History of Chronic Hepatitis B Anna SF Lok, MD Alice Lohrman Andrews Professor in Hepatology Director of Clinical Hepatology Assistant Dean for Clinical Research University of Michigan Ann Arbor,
More informationAssociation between matrix metalloproteinase-9 rs polymorphism and development of coronary artery disease in a Chinese population
Association between matrix metalloproteinase-9 rs3918242 polymorphism and development of coronary artery disease in a Chinese population L.M. Qin 1, G.M. Qin 2, X.H. Shi 1, A.L. Wang 1 and H. Zuo 1 1 The
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationAssociation between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer
Association between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer M.G. He, K. Zheng, D. Tan and Z.X. Wang Department of Hepatobiliary Surgery, Nuclear Industry 215 Hospital
More informationCytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
More informationInvestigation of ERCC1 and ERCC2 gene polymorphisms and response to chemotherapy and overall survival in osteosarcoma
Investigation of ERCC1 and ERCC2 gene polymorphisms and response to chemotherapy and overall survival in osteosarcoma Q. Zhang 1, L.Y. Lv 1, B.J. Li 1, J. Zhang 1 and F. Wei 2 1 Department of Orthopaedics,
More informationGenetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma
Genetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma M.J. Wang, Y. Zhu, X.J. Guo and Z.Z. Tian Department of Orthopaedics, Xinxiang Central Hospital, Xinxiang,
More informationAssociation between the CYP1A1 polymorphisms and hepatocellular carcinoma: a meta-analysis
Association between the CYP1A1 polymorphisms and hepatocellular carcinoma: a meta-analysis B.W. Yu 1 *, L.Q. Zhang 1 *, X.L. Teng 1, Y. Zhang 1, L.B. Zou 2 and H.Y. Ying 3 l Department of Clinical Laboratory,
More informationNew evidence of TERT rs polymorphism and cancer risk: an updated meta-analysis
JBUON 2016; 21(2): 491-497 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE New evidence of TERT rs2736098 polymorphism and risk: an updated meta-analysis
More informationAssociation between Toll-like receptor 9 gene polymorphisms and risk of bacterial meningitis in a Chinese population
Association between Toll-like receptor 9 gene polymorphisms and risk of bacterial meningitis in a Chinese population X.H. Wang, H.P. Shi and F.J. Li Tuberculosis Hospital of Shanxi Province, Xi an, China
More informationPeking University People's Hospital, Peking University Institute of Hematology
Qian Jiang, M.D. Peking University People's Hospital, Peking University Institute of Hematology No. 11 Xizhimen South Street, Beijing, 100044, China. Phone number: 86-10-66583802 Mobile: 86-13611115100
More informationCytokines (II) Dr. Aws Alshamsan Department of Pharmaceu5cs Office: AA87 Tel:
Cytokines (II) Dr. Aws Alshamsan Department of Pharmaceu5cs Office: AA87 Tel: 4677363 aalshamsan@ksu.edu.sa Learning Objectives By the end of this lecture you will be able to: 1 Understand the physiological
More informationAssociation between interleukin gene polymorphisms and risk of recurrent oral ulceration
Association between interleukin gene polymorphisms and risk of recurrent oral ulceration C. Jing and J.-Q. Zhang Department of Stomatology, The First Affiliated Hospital of PLA General Hospital, Beijing,
More information* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
More informationA case-control study indicates that the TRIB1 gene is associated with pancreatic cancer
A case-control study indicates that the TRIB1 gene is associated with pancreatic cancer X.X. Lu 1,2 *, J.J. Hu 3 *, Y. Fang 1,2, Z.T. Wang 4, J.J. Xie 1, Q. Zhan 1, X.X. Deng 1, H. Chen 1, J.B. Jin 1,
More informationInnate immunity. Abul K. Abbas University of California San Francisco. FOCiS
1 Innate immunity Abul K. Abbas University of California San Francisco FOCiS 2 Lecture outline Components of innate immunity Recognition of microbes and dead cells Toll Like Receptors NOD Like Receptors/Inflammasome
More informationA preliminary report on the influence of baseline cellular immunity to the therapeutic responses of peg-interferon
146 2009 9 4 3 Journal of Microbes and Infection, September 2009, Vol. 4, No. 3 e 2a 1, 2, 1, 1, 1, 1, 1, 1 1., 200025; 2., 200032 : ( CHB) ( IFN), IFN IFN, e ( HBeAg) CHB 19, 14, IFN- 2a 180 g, 1, 48,
More informationToll-like Receptors (TLRs): Biology, Pathology and Therapeutics
Toll-like Receptors (TLRs): Biology, Pathology and Therapeutics Dr Sarah Sasson SydPATH Registrar 23 rd June 2014 TLRs: Introduction Discovered in 1990s Recognise conserved structures in pathogens Rely
More informationPositive Association Between IL-16 rs T/G Polymorphism and Cancer Risk: a Meta-analysis
RESEARCH ARTICLE Positive Association Between IL-16 rs11556218 T/G Polymorphism and Cancer Risk: a Meta-analysis Cui-Ju Mo, Qi-Liu Peng, Yu He, Jian Wang, Li Xie, Tai-Jie Li, Shan Li, Xue Qin* Abstract
More informationThe Genetic Epidemiology of Rheumatoid Arthritis. Lindsey A. Criswell AURA meeting, 2016
The Genetic Epidemiology of Rheumatoid Arthritis Lindsey A. Criswell AURA meeting, 2016 Overview Recent successes in gene identification genome wide association studies (GWAS) clues to etiologic pathways
More informationLetter: Genetic Variation in the Inflammasome and Atopic Dermatitis Susceptibility
Letter: Genetic Variation in the Inflammasome and Atopic Dermatitis Susceptibility Cecilia Bivik, Deepti Verma, Marten C. Winge, Agne Lieden, Maria Bradley, Inger Rosdahl and Peter Söderkvist Linköping
More information1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created.
938 939 940 941 942 Figure S1 Schematic of the in silico TCRminer and MiXCR validation. 1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created. Then, 100,000 simulated 80 bp
More informationThe role of cytokines in hepatocellular carcinoma
The role of cytokines in hepatocellular carcinoma Anuradha Budhu and Xin Wei Wang 1 Liver Carcinogenesis Section, Laboratory of Human Carcinogenesis, Center for Cancer Research, National Cancer Institute,
More information1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples. Major Principles:
Carcinogenesis 1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples Carcinogenesis Major Principles: 1. Nonlethal genetic damage is central to
More informationAssociation of IL1R polymorphism with HLA-B27 positive in Iranian patients with ankylosing spondylitis
Eur. Cytokine Netw. Vol. 22 n 4, December 2011, 175-80 175 RESEARCH ARTICLE Association of IL1R polymorphism with HLA-B27 positive in Iranian patients with ankylosing spondylitis M. Mahmoudi 1,2, A.A.
More informationImmunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells
Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard
More informationRole of interleukin-6 gene polymorphisms in the risk of coronary artery disease
Role of interleukin-6 gene polymorphisms in the risk of coronary artery disease K. Wang 1, P.S. Dong 1, H.F. Zhang 1, Z.J. Li 1, X.M. Yang 1 and H. Liu 2 1 Department of Cardiovascular Medicine, The First
More informationAllergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by
More informationMyoglobin A79G polymorphism association with exercise-induced skeletal muscle damage
Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage T. Cui and M.S. Jiang College of Physical Education, Shandong University of Finance and Economics, Ji nan, Shandong,
More informationAutoimmune Diseases. Betsy Kirchner CNP The Cleveland Clinic
Autoimmune Diseases Betsy Kirchner CNP The Cleveland Clinic Disclosures (financial) No relevant disclosures Learning Objectives Explain the pathophysiology of autoimmune disease Discuss safe administration
More informationRole of CASP-10 gene polymorphisms in cancer susceptibility: a HuGE review and meta-analysis
Role of CASP-10 gene polymorphisms in cancer susceptibility: a HuGE review and meta-analysis S. Yan, Y.Z. Li, J.W. Zhu, C.L. Liu, P. Wang and Y.L. Liu Department of Urological Surgery, Fourth Affiliated
More informationInt J Clin Exp Pathol 2018;11(8): /ISSN: /IJCEP Qing Wang 1*, Fangzhi Chang 2*, Wei Li 3
Int J Clin Exp Pathol 2018;11(8):4140-4146 www.ijcep.com /ISSN:1936-2625/IJCEP0077403 Original Article A single nucleotide polymorphism of the interferon-γ gene and susceptibility to hepatitis B virus-related
More information