Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Size: px
Start display at page:

Download "Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array."

Transcription

1 Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs _s1 Actb actin, beta Mm _s1 Mm , Mm , Mm Actb actin, beta Mm _g1 Mm , Mm , Mm Angpt1 angiopoietin 1 Mm _m1 Mm Angpt2 angiopoietin 2 Mm _m1 Mm Anpep alanyl (membrane) Mm _m1 Mm.4487 aminopeptidase Bai1 brain-specific Mm _m1 Mm angiogenesis inhibitor 1 Ccl11 chemokine (C-C motif) Mm _m1 Mm.4686 ligand 11 Ccl2 chemokine (C-C motif) Mm _m1 Mm ligand 2 Cdh5 cadherin 5 Mm _s1 Mm Col18a1 collagen, type XVIII, Mm _m1 Mm.4352 alpha 1 Col4a3 collagen, type IV, alpha Mm _m1 Mm Csf3 colony stimulating factor Mm _g1 Mm (granulocyte) Ctgf connective tissue growth Mm _g1 Mm factor Cxcl1 chemokine (C-X-C Mm _m1 Mm motif) ligand 1 Cxcl2 chemokine (C-X-C Mm _m1 Mm.4979 motif) ligand 2 Cxcl5 chemokine (C-X-C Mm _g1 Mm.4660 motif) ligand 5 Efna1 ephrin A1 Mm _m1 Mm Efnb2 ephrin B2 Mm _m1 Mm Egf epidermal growth factor Mm _m1 Mm Eng endoglin Mm _m1 Mm Epas1 endothelial PAS domain Mm _m1 Mm.1415 protein 1 Ephb4 Eph receptor B4 Mm _m1 Mm Ereg epiregulin Mm _m1 Mm.4791 F2 coagulation factor II Mm _m1 Mm Fgf1 fibroblast growth factor 1 Mm _s1 Mm Fgf2 fibroblast growth factor 2 Mm _m1 Mm Fgf6 fibroblast growth factor 6 Mm _m1 Mm.3403 Fgfr3 fibroblast growth factor Mm _s1 Mm.6904 receptor 3 Figf c-fos induced growth factor Mm _m1 Mm

2 Flt1 FMS-like tyrosine kinase Mm _m1 Mm Fzd5 frizzled homolog 5 (Drosophila) Mm _s1 Mm , Mm Gapdh glyceraldehyde-3- Mm _g1 Mm phosphate dehydrogenase Gna13 guanine nucleotide Mm _m1 Mm binding protein, alpha 13 Gusb glucuronidase, beta Mm _m1 Mm.3317 Gusb glucuronidase, beta Mm _s1 Mm.3317 Hand2 heart and neural crest Mm _m1 Mm derivatives expressed transcript 2 Hgf hepatocyte growth factor Mm _m1 Mm Hif1a hypoxia inducible factor 1, alpha subunit Mm _m1 Mm.3879, Mm Hprt1 hypoxanthine guanine Mm _m1 Mm phosphoribosyl transferase 1 Hsp90ab1 heat shock protein 90 Mm _g1 Mm.2180 alpha (cytosolic), class B member 1 Iapp islet amyloid polypeptide Mm _m1 Mm.415 Ifng interferon gamma Mm _m1 Mm Igf1 insulin-like growth factor Mm _m1 Mm Il1b interleukin 1 beta Mm _m1 Mm Il6 interleukin 6 Mm _m1 Mm.1019 Itgav integrin alpha V Mm _m1 Mm.227 Itgb3 integrin beta 3 Mm _m1 Mm Jag1 jagged 1 Mm _s1 Mm Kdr kinase insert domain Mm _m1 Mm.285 protein receptor Lama5 laminin, alpha 5 Mm _m1 Mm.4339 Lect1 leukocyte cell derived Mm _m1 Mm chemotaxin 1 Lep leptin Mm _m1 Mm Mapk14 mitogen-activated protein Mm _m1 Mm kinase 14 Mdk midkine Mm _m1 Mm.906 Mmp19 matrix metallopeptidase Mm _m1 Mm Mmp2 matrix metallopeptidase Mm _m1 Mm Mmp9 matrix metallopeptidase Mm _m1 Mm Npr1 natriuretic peptide Mm _m1 Mm.4627 receptor 1 Nrp1 neuropilin 1 Mm _m1 Mm , Mm Nrp2 neuropilin 2 Mm _m1 Mm Pdgfa platelet derived growth Mm _m1 Mm.2675

3 factor, alpha Pdx1 pancreatic and duodenal Mm _m1 Mm homeobox 1 Pecam1 platelet/endothelial cell Mm _m1 Mm adhesion molecule 1 Pgf placental growth factor Mm _m1 Mm.4809 Plau plasminogen activator, Mm _m1 Mm.4183 urokinase Plg plasminogen Mm _m1 Mm.971 Plg plasminogen Mm _m1 Mm.971 Ptgs1 prostaglandinendoperoxide Mm _m1 Mm synthase 1 S1pr1 sphingosine-1-phosphate Mm _m1 Mm.982 receptor 1 Serpinf1 serine (or cysteine) Mm _m1 Mm.2044 peptidase inhibitor, clade F, member 1 Smad5 MAD homolog 5 Mm _g1 Mm (Drosophila) Sphk1 sphingosine kinase 1 Mm _g1 Mm Stab1 stabilin 1 Mm _m1 Mm Tbp TATA box binding Mm _m1 Mm protein Tbp TATA box binding Mm _m1 Mm protein Tbx1 T-box 1 Mm _m1 Mm Tbx4 T-box 4 Mm _m1 Mm Tek endothelial-specific Mm _m1 Mm receptor tyrosine kinase Tgfa transforming growth Mm _m1 Mm factor alpha Tgfb1 transforming growth Mm _m1 Mm factor, beta 1 Tgfb2 transforming growth Mm _m1 Mm factor, beta 2 Tgfb3 transforming growth Mm _m1 Mm.3992 factor, beta 3 Tgfbr1 transforming growth factor, beta receptor I Mm _m1 Mm , Mm Thbs1 thrombospondin 1 Mm _m1 Mm.4159 Thbs2 thrombospondin 2 Mm _m1 Mm Timp1 tissue inhibitor of Mm _m1 Mm.8245 metalloproteinase 1 Timp2 tissue inhibitor of Mm _m1 Mm metalloproteinase 2 Tmprss6 transmembrane serine Mm _m1 Mm protease 6 Tnf tumor necrosis factor Mm _m1 Mm.1293 Tnfaip2 tumor necrosis factor, Mm _m1 Mm alpha-induced protein 2 Tnfsf12 tumor necrosis factor (ligand) superfamily, Mm _m1 Mm.8983

4 member 12 Tymp thymidine phosphorylase Mm _m1 Mm Vegfa vascular endothelial growth factor A Mm _m1 Mm , Mm Vegfb vascular endothelial Mm _g1 Mm growth factor B Vegfc vascular endothelial growth factor C Mm _m1 Mm.1402

5 Supplementary Table 2. Characteristics of islets for transplantation. Islet purity as assessed by dithizone (%) 1 day 4 days Intact Fragmented Intact 95±1 88±3* 100±0 Insulin release ng/10 islets x h Low glucose (1.67 mmol/l) High glucose (16.7 mmol/l) 15±3 34±6* 12±4 68±4 94±7* 72±6 All values are given as means ± SEM for 6-7 experiments in each group. * denotes P< 0.05 when compared to 1-day intact islets. Supplementary Figure 1. Representative images of Oil Red O staining of cryosections obtained from liver of high fat diet treated mice (positive control; A), and islet graft bearing liver (B), respectively. Arrow in B depicts islet. Scale bar is 100 µm.

B16F1 B16F10 Supplemental Figure S1

B16F1 B16F10 Supplemental Figure S1 B16F1 B16F1 Supplemental Figure S1 Representative microangiography images of B16F1 and B16F1 tumors grown in the cranial windows. FITC-dextran (2 million MW) was injected systemically to visualize blood

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases

Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases Supplementary Tables: Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases Supplementary Table 2: Contingency tables used in the fisher exact

More information

SUPPLEMENTARY FIG. S2. b-galactosidase staining of

SUPPLEMENTARY FIG. S2. b-galactosidase staining of SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived

More information

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D ) 1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo

More information

In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell

In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell Supplementary Methods BrdU incorporation in vivo In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell proliferation in the heart. Mice were subjected to LI-TAC, and 5 days later

More information

Expression levels of b-pix mrna in ALS-MSCs and C-MSCs.

Expression levels of b-pix mrna in ALS-MSCs and C-MSCs. Supplementary Data SUPPLEMENTARY FIG. S1. The neurological functioning of ischemic rats depends on the origin of the transplanted MSCs. The scores of healthy rats in tests on forelimb placing, forelimb

More information

SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death

SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation

More information

Mechanisms underlying chemotherapy-induced vascular proliferation in ovarian cancer

Mechanisms underlying chemotherapy-induced vascular proliferation in ovarian cancer Western University Scholarship@Western Electronic Thesis and Dissertation Repository August 2017 Mechanisms underlying chemotherapy-induced vascular proliferation in ovarian cancer Zeynep Gülsüm Kahramanoğlu

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

* Kyoto Encyclopedia of Genes and Genomes.

* Kyoto Encyclopedia of Genes and Genomes. Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited

More information

Supporting Information

Supporting Information Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,

More information

ELISA kits for Cancer

ELISA kits for Cancer ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL

More information

The Role of Microenvironment in the Control of Tumor Angiogenesis

The Role of Microenvironment in the Control of Tumor Angiogenesis The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,

More information

Temporal expression analysis of angiogenesis-related genes in brain development

Temporal expression analysis of angiogenesis-related genes in brain development Özkan et al. Vascular Cell 2012, 4:16 VASCULAR CELL RESEARCH Open Access Temporal expression analysis of angiogenesis-related genes in brain development Abdulkadir Özkan 1,2, Atilla Biçer 1, Timuçin Avşar

More information

Data Package. Multiplex Oncology I 96 96

Data Package. Multiplex Oncology I 96 96 Data Package Multiplex Oncology I 96 96 Table of contents 1. Introduction 3 1.1 Technology 3 1.2 Data analysis 3 2. Performance characteristics 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection

More information

Supplemental Figure Legends

Supplemental Figure Legends Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p

More information

Cardiovascular Disease Products

Cardiovascular Disease Products Cardiovascular Disease Products For more information, visit: www.bosterbio.com Cardiovascular Disease Research Cardiovascular disease is the leading cause of death in developed nations. Boster Bio aims

More information

Increased adipose tissue hypoxia and capacity for angiogenesis and inflammation in young diet-sensitive C57 mice compared with diet-resistant FVB mice

Increased adipose tissue hypoxia and capacity for angiogenesis and inflammation in young diet-sensitive C57 mice compared with diet-resistant FVB mice International Journal of Obesity (2013) 37, 853 860 & 2013 Macmillan Publishers Limited All rights reserved 0307-0565/13 www.nature.com/ijo ORIGINAL ARTICLE and inflammation in young diet-sensitive C57

More information

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57 Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

More information

The Influence of Birch Bark Triterpenes on. Keratinocytes and Fibroblasts from Diabetic and

The Influence of Birch Bark Triterpenes on. Keratinocytes and Fibroblasts from Diabetic and 1 1 2 3 The Influence of Birch Bark Triterpenes on Keratinocytes and Fibroblasts from Diabetic and Nondiabetic Donors 4 5 Tina Wardecki,#, Philipp Werner,#, Maria Thomas, Markus F. Templin, Gudula Schmidt,

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP

More information

Applied Biosystems models 7500 (Fast block), 7900HT (Fast block), StepOnePlus, ViiA 7 (Fast block)

Applied Biosystems models 7500 (Fast block), 7900HT (Fast block), StepOnePlus, ViiA 7 (Fast block) RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human HIV Infection and Host Response Cat. no. 330231 PAHS-051YA For pathway expression analysis Format Format A Format C Format D Format

More information

Tissue repair. (3&4 of 4)

Tissue repair. (3&4 of 4) Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

Table S1. Metadata for transcriptome interaction network and pathway analysis of 5448 intracelluarly infected TEpi cells in comparison to mock TEpi cells. Gene symbol Full name Log2FC gene expression in

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

TITLE: Genetic and epigenetic biomarkers for recurrent prostate cancer after radiotherapy

TITLE: Genetic and epigenetic biomarkers for recurrent prostate cancer after radiotherapy AD Award Number: W81XWH-12-1-0113 TITLE: Genetic and epigenetic biomarkers for recurrent prostate cancer after radiotherapy PRINCIPAL INVESTIGATOR: Jong Park CONTRACTING ORGANIZATION: H. Lee Moffitt Cancer

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236 Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine

More information

To compare the relative amount of of selected gene expression between sham and

To compare the relative amount of of selected gene expression between sham and Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter

More information

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21

More information

Supplementary Note

Supplementary Note Supplementary Note 1. Carmeliet, P. et al. Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 380, 435-9 (1996). 2. Ferrara, N. et al. Heterozygous embryonic

More information

ESM Methods Preparation and characterization of human MAPC Marginal mass syngeneic islet transplantation diabetes model

ESM Methods Preparation and characterization of human MAPC Marginal mass syngeneic islet transplantation diabetes model ESM Methods Preparation and characterization of human MAPC Human MAPC (n=2) used in this study were isolated by ReGenesys BVBA (Athersys Inc. affiliate in Heverlee, Belgium) from bone marrow of a 30-year-old

More information

Supplementary Data. Supplementary Tables. Table 1S: qrt-pcr Primers

Supplementary Data. Supplementary Tables. Table 1S: qrt-pcr Primers Supplementary Data Supplementary Tables Table 1S: qrt-pcr Primers Mouse Accession Forward Primer Reverse Primer Collagen1A1 Col1A1 NM_7742.3 TAGGCCATTGTGTATGCAGC ACATGTTCAGCTTTGTGGACC Collagen1A2 Col1A2

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points

Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

More information

Impact of breast cancer surgery on angiogenesis circulating biomarkers: a prospective longitudinal study

Impact of breast cancer surgery on angiogenesis circulating biomarkers: a prospective longitudinal study Georgiou et al. World Journal of Surgical Oncology 2013, 11:213 WORLD JOURNAL OF SURGICAL ONCOLOGY RESEARCH Open Access Impact of breast cancer surgery on angiogenesis circulating biomarkers: a prospective

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo. T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8

More information

DATA PACKAGE. Multiplex CVD I 96 96

DATA PACKAGE. Multiplex CVD I 96 96 DATA PACKAGE Multiplex CVD I 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection limit

More information

Cell Signaling part 2

Cell Signaling part 2 15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,

More information

Editor Journal of Allergy and Therapy

Editor Journal of Allergy and Therapy Editor Journal of Allergy and Therapy Biography Prof. Domenico Ribatti was awarded his MD degree on October 1981 with full marks. His present position is of a full-time professor of Human Anatomy at the

More information

ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were

ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were Supplementary Figure 1. Characterization of EVs from intestine. (a, b) Intestinal tissues were ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were isolated by

More information

Supporting Information

Supporting Information Supporting Information Gorgun et al. 10.1073/pnas.0901166106 SI Text Animals, Disease Detection and Infusion of CLL Cells. Mice were examined for lymphadenopathy and splenomegaly and at specific ages or

More information

SUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish

SUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish SUPPLEMENTARY INFOATION Divergent TLR7/9 signaling and type I interferon production distinguish pathogenic and non-pathogenic AIDS-virus infections Judith N. Mandl, Ashley P. Barry, Thomas H. Vanderford,

More information

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis

More information

Research Article Expression Profiling of Genes Related to Endothelial Cells Biology in Patients with Type 2 Diabetes and Patients with Prediabetes

Research Article Expression Profiling of Genes Related to Endothelial Cells Biology in Patients with Type 2 Diabetes and Patients with Prediabetes BioMed Research International Volume 2016, Article ID 1845638, 12 pages http://dx.doi.org/10.1155/2016/1845638 Research Article Expression Profiling of Genes Related to Endothelial Cells Biology in Patients

More information

Principles of Genetics and Molecular Biology

Principles of Genetics and Molecular Biology Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

More information

Additional file 2 List of pathway from PID

Additional file 2 List of pathway from PID Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent

More information

Identification of the angiogenic gene signature induced by EGF and hypoxia in colorectal cancer

Identification of the angiogenic gene signature induced by EGF and hypoxia in colorectal cancer Khong et al. BMC Cancer 2013, 13:518 RESEARCH ARTICLE Open Access Identification of the angiogenic gene signature induced by EGF and hypoxia in colorectal cancer Tak L Khong 1,2, Ngayu Thairu 1,2, Helene

More information

Cell populations size is determined by rate of proliferation, Differentiation, and death by apoptosis. Figure 3-1

Cell populations size is determined by rate of proliferation, Differentiation, and death by apoptosis. Figure 3-1 Cell populations size is determined by rate of proliferation, Differentiation, and death by apoptosis Figure 3-1 Terminally differentiated cells not capable of replication 1. myocytes 2. neurons Quiescent

More information

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

More information

CELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES.

CELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES. !! www.clutchprep.com CONCEPT: CELL-CELL ADHESION Cells must be able to bind and interact with nearby cells in order to have functional and strong tissues Cells can in two main ways - Homophilic interactions

More information

Supporting Information. Evaluation of Toxicity and Gene Expression Changes Triggered by Oxide Nanoparticles

Supporting Information. Evaluation of Toxicity and Gene Expression Changes Triggered by Oxide Nanoparticles Evaluation of Toxicity and Gene Expression Changes Triggered Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 1 DOI 10.5012/bkcs.2011.32.6. Supporting Information Evaluation of Toxicity and Gene Expression

More information

Growth Factors. BIT 230 Walsh Chapter 7

Growth Factors. BIT 230 Walsh Chapter 7 Growth Factors BIT 230 Walsh Chapter 7 3 Definitions Autocrine: a mode of hormone action in which a hormone affects the function of the cell type that produced it. Paracrine: Relating to the release of

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Table 1A. Genes enriched as over-expressed in DPM treatment group

Table 1A. Genes enriched as over-expressed in DPM treatment group Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597

More information

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in

More information

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

REPRODUCTIVE CYCLE OF FEMALE MAMMAL

REPRODUCTIVE CYCLE OF FEMALE MAMMAL REPRODUCTIVE CYCLE OF FEMALE MAMMAL Fig. 8-12 Secondary follicles growing follicles increase in number of layers of granulosa cells Tertiary follicles maturing follicles antrum formation fluid filled space

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Aylwin Ng, D.Phil Lecture 6 Notes: Control Systems in Gene Expression Pulling it all together: coordinated control of transcriptional regulatory molecules Simple Control:

More information

THE BIOLOGY OF PLATELET-GEL THERAPY

THE BIOLOGY OF PLATELET-GEL THERAPY THE BIOLOGY OF PLATELET-GEL THERAPY The synopsis of normal healing includes a well known sequence of coordinated phases. The unique process leading to healing is ontologically partitioned in three sequential

More information

Vets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system

Vets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system Vets 111/Biov 111 Cell Signalling-2 Secondary messengers the cyclic AMP intracellular signalling system The classical secondary messenger model of intracellular signalling A cell surface receptor binds

More information

Data supplement. Netrin-1 promotes adipose tissue macrophage accumulation and insulin resistance in obesity

Data supplement. Netrin-1 promotes adipose tissue macrophage accumulation and insulin resistance in obesity Data supplement Netrin- promotes adipose tissue macrophage accumulation and insulin resistance in obesity Bhama Ramkhelawon, Elizabeth J Hennessy, Mickaël Ménager 2, Tathagat D. Ray, Frederick J Sheedy,

More information

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,

More information

Contribution of the intronic mir-338-3p and its Hosting Gene AATK to Compensatory β-cell Mass Expansion

Contribution of the intronic mir-338-3p and its Hosting Gene AATK to Compensatory β-cell Mass Expansion Contribution of the intronic mir-338-3p and its Hosting Gene AATK to Compensatory β-cell Mass Expansion Cécile Jacovetti 1, Veronica Jimenez 2, Eduard Ayuso 2#, Ross Laybutt 3, Marie-Line Peyot 4, Marc

More information

Review of relationship between vascular endothelial growth factor family & receptors and tumor angiogenesis

Review of relationship between vascular endothelial growth factor family & receptors and tumor angiogenesis 16 1 2004 2 hinese Bulletin of Life Sciences Vol. 16, No. 1 Feb., 2004 1004-0374 (2004) 01-0019-05 1 201203 2 200025 (vascular endothelial growth factor, ) (vascular permeability factor, VPF), -A -B -

More information

SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans

SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans water-soluble mannoprotein-beta-glucan complex (CAWS) Noriko Nagi-Miura 1,, Daisuke

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

Genetics and Cancer Ch 20

Genetics and Cancer Ch 20 Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)

More information

Laura Smart 9/22/2011

Laura Smart 9/22/2011 Laura Smart 9/22/2011 Fibrosis is a wound healing response in which damaged regions are encapsulated by an extracellular matrix or scar. Fibrosis develops in almost all patients with chronic liver injury

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or

More information

T cell Receptor. Chapter 9. Comparison of TCR αβ T cells

T cell Receptor. Chapter 9. Comparison of TCR αβ T cells Chapter 9 The αβ TCR is similar in size and structure to an antibody Fab fragment T cell Receptor Kuby Figure 9-3 The αβ T cell receptor - Two chains - α and β - Two domains per chain - constant (C) domain

More information

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018 Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette Liz Mason Kunming, China 26 th October 2018 CONTENT 1. Background Biomarkers of exposure and effect

More information

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest

More information

Supplementary Materials:

Supplementary Materials: Supplementary Materials: Supplemental Figure 1: Profibrotic markers in wt/wt or ex/ex mouse kidneys 42 days post IRI. The levels of fibronectin and αsma were examined by immunostaining in ADAM17 wt/wt

More information

Cellular Signaling Pathways. Signaling Overview

Cellular Signaling Pathways. Signaling Overview Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the

More information

The recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation

The recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation The migration of a particular type of leukocyte into a restricted type of tissue, or a tissue with an ongoing infection or injury, is often called leukocyte homing, and the general process of leukocyte

More information

Project Summary. Principal Investigator: C. Krehbiel Oklahoma State University

Project Summary. Principal Investigator: C. Krehbiel Oklahoma State University Project Summary Skeletal muscle differentially influences marbling development through IGF-I and myostatin pathways in growing versus finishing beef cattle Principal Investigator: C. Krehbiel Oklahoma

More information

Supplemental Table 1:

Supplemental Table 1: Supplemental Table 1: Gene up-regulated in remnant kidneys of the lesion-prone FVB/N mice as compared to the resistant B6D2F1 animals 2 months after 75% nephron reduction. Gene Symbol Gene Name F FDR Accession

More information

Understanding Root Cause: Pathogenesis of Hepatic Fibrosis

Understanding Root Cause: Pathogenesis of Hepatic Fibrosis 10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis

More information

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad

More information

Microenvironmental factors and tumorigenesis. Rama Khokha Ontario Cancer Institute. 8 th PHM Conference

Microenvironmental factors and tumorigenesis. Rama Khokha Ontario Cancer Institute. 8 th PHM Conference Microenvironmental factors and tumorigenesis Rama Khokha Ontario Cancer Institute 8 th PHM Conference The mammary tissue microenvironment Mouse Human mammary breast tissue gland section H&E Stromal Compartment

More information

Phospho-AKT Sampler Kit

Phospho-AKT Sampler Kit Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody

More information

MAPK Pathway

MAPK Pathway MAPK Pathway Mitogen-activated protein kinases (MAPK) are proteins that are serine/ threonine specific kinases which are activated by a wide range of stimuli including proinflammatory cytokines, growth

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

More information

Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical

Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical adenomatous hyperplasia/epithelial hyperplasia (AAH/EH),

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Supplementary Table 1: Motor-clutch gene mrna expression Myosin Motors

Supplementary Table 1: Motor-clutch gene mrna expression Myosin Motors Supplementary Table 1: Motor-clutch gene mrna expression Myosin Motors Symbol Description Expression Rank MYL6 myosin, light chain 6, alkali, smooth muscle and non-muscle 11903 79 MYH9 myosin, heavy chain

More information

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna

More information