Transduction of lentivirus to human primary CD4+ T cells
|
|
- Nancy Gallagher
- 5 years ago
- Views:
Transcription
1 Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen) for 16 hours, followed by IL-2 (10ng/ml) for 5 hours in RPMI + 10% FCS. Lentivirus expressing GFP + c-myb-1, and c-myb-3, or scrambled sequence control shrna were freshly prepared in 293FT cells (Invitrogen). The Lentivirus were added to the stimulated CD4 + T cells (CD4 + T cells 5 10^6/ml:viral supernatant = 1:1.5 vol/vol, Polybrene 8 µg/ml). Five days post-transduction, GFP positive cells were sorted by the FACSAria cell sorter (BD Biosciences). Transduction efficiency ranged from % of live cells (Fig. S1). The GFP positive cells were further sorted using magnetic beads conjugated with anti-cd45ro + antibody (CD45 MicroBeads, Mileni Biotec). Alternatively, GFP + CD4 + T cells were sorted with CD45RA-PE antibody using the FACSAria cell sorter. The cells selected negatively with CD45RO, or positively CD45RA positive cells, were classified as naïve CD4 + T cells. ChIP assay for histone modifications of locus in Jurkat cells and human primary CD4 + T cells. Jurkat cells were infected with Lentivirus expressing GFP + shrna targeted to c-myb, or a scrambled (SCR) shrna sequence control. GFP positive cells were sorted and used to establish stable cell lines expressing c-myb or control shrna. The efficiency of silencing was ~60% in c-myb shrna expressing Jurkat cells. The shrna expressing Jurkat cells were then transfected with c-myb1 and c-myb3 sirna using Lonza s transfection system (Lonza). SCR control shrna expressing Jurkat cells were transfected with control sirna. This method further decreases protein expression to ~10 20% of that found in wild type Jurkat cells (Fig. 4C). At 48 hr post transfection, a cross-link reaction for the ChIP assay was performed. Chromatin captured by each antibody was then amplified by QRT-PCR (Fig. 7A) using the locus primer pairs shown in Table S2. In experiments employing primary human CD4 + T cells, we utilized the shrna lentivirus silencing system described above. The sorted GFP + CD45RA + and GFP + CD45RA cells were stimulated under Th2 promoting conditions for 7 and 4 days respectively, after which time cross-linking reactions were carried out. QRT-PCR analysis was performed with primer sets #1 to #15 as shown in Table S2. Magna ChIP TM G kit (Millipore) was employed for ChIP assays. For each experiment, CD4 + T cells were used.
2 Table S1. Fold-up or -down change induced by silencing in CD4 + CD45RO + cells PCR Array (Human Th1-Th2-Th3 RT² Profiler PCR Array, SABiosciences) was performed with human primary CD4 + CD45RO + cells transduced with c-myb-1 and 3, or scrambled shrna expression vectors. Fold changed was calculated with reference to results obtained with the scrambled shrna. CCL CCL CCL CCR CCR CCR CCR CD CD CD40LG 1.38 CD CD CD CEBPB 1.82 CREBBP 1.20 CSF CTLA CXCR FASLG 1.69 GATA GFI GLMN 1.12 GPR HAVCR ICOS 1.28 IFNG 2.08 IGSF IL IL12B 1.10 IL12RB IL13 IL13RA IL IL IL18R IL1R IL1R IL IL2RA 6.77 IL IL4R 7.26 IL IL IL6R 2.71 IL IL INHA 1.56 INHBA 3.16 IRF IRF JAK JAK LAG LAT 2.20 MAF 1.58 MAP2K MAPK NFATC NFATC NFATC2IP 2.75 PCGF PTPRC 1.04 SFTPD 1.82 SOCS1 SOCS SOCS SPP STAT STAT STAT TBX TFCP TGFB TLR TLR TMED TNF 1.47 TNFRSF TNFRSF TNFRSF TNFSF TYK YY B2M 1.36 HPRT RPL13A 1.67 GAPDH 1.58 ACTB 1.95
3 Table S2. Primer pairs employed for ChIP assays described in Fig. 7 #1 Forward: 5 -TCTGTACCCGACTGGGTTTC-3 Reverse: 5 -CGGGGTATGTGTGTCCTCTT-3 #2 Forward: 5 -TTTAGAGAGCGCTGTGAGCA-3 Reverse: 5 -GTTTCTCCTGAGCCCACTTG-3 #3 Forward: 5 -GCTCCAGTCAAAGGCATCTC-3 Reverse: 5 -TAGGCACGCATGGATCATTA-3 #4 Forward: 5 -TTGGGTTGCAGTTTCCTTGT-3 Reverse: 5 -CGACGCAACTTAAGGAGGTT-3 #5 Forward: 5 -GAGAGAGACGGAGGGAGAGC-3 Reverse: 5 -CTGGGTAGCGAAGAGCAGAG-3 #6 Forward: 5 -CAACCACTTGGGAGGACCTA-3 Reverse: 5 -AGTCCCAGGGCTGACTGTTA-3 #7 Forward: 5 -TTCTGCCGTACCCAGTTTTT-3 Reverse: 5 -AAGCAAAGGTGAGCAAAGGA-3 #8 Forward: 5 -TCACACCCTTCTCCTTGACC-3 Reverse: 5 -GGCGACTTGAAAGCAAAGAC-3 #9 Forward: 5 -CTTCAGGCCTCCTCACTCAC-3 Reverse: 5 -TTGGCCTCTCCAGATACACC-3 #10 Forward: 5 -CTGCTTCATGGATCCCTACC-3 Reverse: 5 -GATGGACGTCTTGGAGAAGG-3 #11 Forward: 5 -TGCCATTCTTCCCATTCTTC-3 Reverse: 5 -TTCCTATCCCAGCTCATTGG-3 #12 Forward: 5 -AGGCTAGCTGGTGGAGTCAA-3 Reverse: 5 -TGCACCCCACTTCTTAATCC-3 #13 Forward: 5 -GAAACGGTTGAAGTCGTGGT-3 Reverse: 5 -AGGTGGCAGTGGAGCTAAGA-3 #14 Forward: 5 -AAGGCAGGGAGTGTGTGAAC-3 Reverse: 5 -CTTCGCTTGGGCTTAATGAG-3 #15 Forward: 5 -GTGGCAACATTCCTTGGTCT-3 Reverse: 5 -TTGGTCACTTCCCATTCACA-3 #16 Forward: 5 -CTGCAGCCAGGAGAGCAG-3 Reverse: 5 -AGTAGAGCCCACAGGCATTG-3 #17 Forward: 5 -GCTGAACAGGGAGGAGACAG-3 Reverse: 5 -GAAAAAGAAGCAGGGTGCTG-3 #18 Forward: 5 -TTCGACTTGCATTTTTGCAG-3 Reverse: 5 -ACAGATGGGGTCCAGATTCA-3 #19 Forward: 5 -CTGGCCACAGTTGTTTGATG-3 Reverse: 5 -GCTCTCTGAAACCCTCAACG-3 #20 Forward: 5 -TGCCTGCCTTGGATATTTTC-3 Reverse: 5 -CTCTGTCCAGGCAGATCACA-3
4 Figure S1. Typical flow analysis of shrna transduced cells The live cells were 46.8 % of all events, and GFP + cells were 41.3% of live cells (19.0% of all cells). β-actin shrna SCR shrna Figure S2. protein suppression by shrna Lentivirus system in the naive T cells under Th2 promoting conditions Normal human peripheral blood CD4 + T cells were transduced with lentivirus constructs expressing GFP + c-myb shrna. Sorted GFP positive CD4 + CD45RO cells were cultured under Th2 promoting conditions for 5 days. Western blotting was carried out with anti antibody. SCR= scrambled shrn.
5 IL-4 APC RBP-J? NF-kB? STAT6 Menin Pol II promoter Naive CD4+ T Developing Th2 Effector Th2 MLL? Menin Histone modification promoter Memory Th2 Figure S3 Model for the regulation of the expression during Th2 cell development. IL-4/STAT6 signaling initiates expression leading to the development of Th2 cells. Subsequently, activates its own promoter by forming an auto-regulatory complex with and Menin that markedly increases expression. During the process of generating memory Th2 cell, the / complex recruits MLL. These events sustain expression, and are permissive of cytokine production as a result of hypothesized changes in histone modifications at the locus (Memory Th2). Transcriptionally active proteins identified to regulate expression are shown clustered on the promoter (thick blue line). The pink filled circles with dashed lines denote the presence of as yet unidentified proteins that likely play a role as co-transcriptional regulators.
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationqpcr-array Analysis Service
qpcr-array Analysis Service Customer Name Institute Telephone Address E-mail PO Number Service Code Report Date Service Laboratory Department Phalanx Biotech Group, Inc 6 Floor, No.6, Technology Road 5,
More informationFor focused group profiling of human HIV infection and host response genes expression
ExProfile TM Human HIV Infection and Host Response Related Gene qpcr Array For focused group profiling of human HIV infection and host response genes expression Cat. No. QG023-A (1 x 96-well plate, Format
More informationDevelopment of a Novel IL-12 DNA-based Immunotherapy in Combination with Chemotherapy for Treatment of Advanced Ovarian Cancer
Development of a Novel IL-12 DNA-based Immunotherapy in Combination with Chemotherapy for Treatment of Advanced Ovarian Cancer Khursheed Anwer, Ph.D. Executive Vice President and CSO Molecular Medicine
More informationEosinophils! 40! 30! 20! 10! 0! NS!
A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the
More informationPrimary Adult Naïve CD4+ CD45RA+ Cells. Prepared by: David Randolph at University of Alabama, Birmingham
Primary Adult Naïve CD4+ CD45RA+ Cells Prepared by: David Randolph (drdrdr@uab.edu) at University of Alabama, Birmingham Goal: To obtain large numbers of highly pure primary CD4+ CD45RO- CD25- cells from
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationComparison of in vitro transfection efficiency of HBV plasmids between genotypes HBV expressing plasmids (5
Supplemental Materials Figures legend Supplemental Table 1, 2 and 3 Supplemental Figure 1, Figure 2 and Figure 3 Supplemental Figure 1 Comparison of in vitro transfection efficiency of HBV plasmids between
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More informationBezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
More informationThe epigenetic landscape of T cell subsets in SLE identifies known and potential novel drivers of the autoimmune response
Abstract # 319030 Poster # F.9 The epigenetic landscape of T cell subsets in SLE identifies known and potential novel drivers of the autoimmune response Jozsef Karman, Brian Johnston, Sofija Miljovska,
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationFunctional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationSupplementary Figures
MiR-29 controls innate and adaptive immune responses against intracellular bacterial infection by targeting IFN-γ Feng Ma 1,2,5, Sheng Xu 1,5, Xingguang Liu 1, Qian Zhang 1, Xiongfei Xu 1, Mofang Liu 3,
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationCommercially available HLA Class II tetramers (Beckman Coulter) conjugated to
Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,
More information1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created.
938 939 940 941 942 Figure S1 Schematic of the in silico TCRminer and MiXCR validation. 1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created. Then, 100,000 simulated 80 bp
More informationSupplementary Material
Supplementary Material Taghon, Yui, and Rothenberg: Mast cell diversion of T-lineage precursor cells by the essential T-lineage transcription factor GATA Supplemental Table Supplemental Figures 1-6 Supplemental
More informationSupplementary Figure 1. Ex vivo IFNγ production by Tregs. Nature Medicine doi: /nm % CD127. Empty SSC 98.79% CD25 CD45RA.
SSC CD25 1.8% CD127 Empty 98.79% FSC CD45RA CD45RA Foxp3 %IFNγ + cells 4 3 2 1 + IL-12 P =.3 IFNγ p=.9 %IL-4+ cells 3 2 1 IL-4 P =.4 c %IL-1 + cells IFNγ 4 3 2 1 Control Foxp3 IL-1 P =.41.64 4.76 MS 2.96
More informationRelevant Disclosures
6/18/215 Therapeutic developments for autoimmune demyelinating diseases: Musings from a MD (Mouse Doctor) Michael K. Racke, M.D. May 28, 215 Relevant Disclosures Editorial Boards for Journal of Neuroimmunology,
More informationTel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary Data. Treg phenotype
Supplementary Data Additional Experiment An additional experiment was performed using cryopreserved peripheral blood mononuclear cells (PBMC) derived from five renal cell carcinoma (RCC) patients [see
More informationTo compare the relative amount of of selected gene expression between sham and
Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter
More informationSupplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
More informationYork criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
More informationSupplementary Information
Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara
More informationSupplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
More informationMolecular Profiling of Tumor Microenvironment Alex Chenchik, Ph.D. Cellecta, Inc.
Molecular Profiling of Tumor Microenvironment Alex Chenchik, Ph.D. Cellecta, Inc. Cellecta, Inc. Founded: April 2006 Headquarters: Mountain View, CA 12 SBIR Grants Custom Service Provider for Functional
More informationSupporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationBlocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationfor six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and
SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationL1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
More informationApplied Biosystems models 7500 (Fast block), 7900HT (Fast block), StepOnePlus, ViiA 7 (Fast block)
RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human HIV Infection and Host Response Cat. no. 330231 PAHS-051YA For pathway expression analysis Format Format A Format C Format D Format
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationSupplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
More informationHTG EdgeSeq Immuno-Oncology Assay Gene List
A2M ABCB1 ABCB11 ABCC2 ABCG2 ABL1 ABL2 ACTB ADA ADAM17 ADGRE5 ADORA2A AICDA AKT3 ALCAM ALO5 ANA1 APAF1 APP ATF1 ATF2 ATG12 ATG16L1 ATG5 ATG7 ATM ATP5F1 AL BATF BA BCL10 BCL2 BCL2L1 BCL6 BID BIRC5 BLNK
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationCover Page. The handle holds various files of this Leiden University dissertation.
Cover Page The handle http://hdl.handle.net/1887/23854 holds various files of this Leiden University dissertation. Author: Marel, Sander van der Title: Gene and cell therapy based treatment strategies
More informationHuman and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-1 Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald, James A. Dromey, Bo Han Lee, Junyan Qian, Ralph M Böhmer and Leonard
More informationSupporting Information
Supporting Information van der Windt et al. 10.1073/pnas.1221740110 SI Materials and Methods Mice and Reagents. C57BL/6 and major histocompatibility complex class I-restricted OVA-specific T-cell receptor
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationSupplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
More informationHelios Induces Epigenetic Silencing of Gene Expression in Regulatory T Cells Il2
This information is current as of January 11, 2019. Helios Induces Epigenetic Silencing of Gene Expression in Regulatory T Cells Il2 Ian Baine, Samik Basu, Rachel Ames, Rani S. Sellers and Fernando Macian
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationT Cell Activation. Patricia Fitzgerald-Bocarsly March 18, 2009
T Cell Activation Patricia Fitzgerald-Bocarsly March 18, 2009 Phases of Adaptive Immune Responses Phases of T cell responses IL-2 acts as an autocrine growth factor Fig. 11-11 Clonal Expansion of T cells
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationCPM (x 10-3 ) Tregs +Teffs. Tregs alone ICOS CLTA-4
A 2,5 B 4 Number of cells (x 1-6 ) 2, 1,5 1, 5 CPM (x 1-3 ) 3 2 1 5 1 15 2 25 3 Days of culture 1/1 1/2 1/4 1/8 1/16 1/32 Treg/Teff ratio C alone alone alone alone CD25 FoxP3 GITR CD44 ICOS CLTA-4 CD127
More informationSUPPLEMENTARY INFORMATION
Supplementary Discussion The cell cycle machinery and the DNA damage response network are highly interconnected and co-regulated in assuring faithful duplication and partition of genetic materials into
More informationSupplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
More informationSUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
More informationSupplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
More informationAn epithelial circadian clock controls pulmonary inflammation and glucocorticoid action
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action Supplementary Figure : Expression levels of toll-like receptor 4 (Tlr4) in muse lung does not change throughout the
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationAppendix Figure S1 A B C D E F G H
ppendix Figure S1 C D E F G H ppendix Figure S1. RT and chemotherapy alter PD-L1 expression in PDC cells. Flow cytometric analysis of PD-L1 expression in () KPC and () Pan02 cells following treatment with
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationBET bromodomain inhibition enhances T cell persistence and function in adoptive immunotherapy models
BET bromodomain inhibition enhances T cell persistence and function in adoptive immunotherapy models Yuki Kagoya,, Cheryl H. Arrowsmith, Naoto Hirano J Clin Invest. 2016;126(9):3479-3494. https://doi.org/10.1172/jci86437.
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationactivation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
More informationD CD8 T cell number (x10 6 )
IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p
More informationThe innate immune system: Contributions to Immunogenicity of Therapeutic Proteins
The innate immune system: Contributions to Immunogenicity of Therapeutic Proteins Daniela Verthelyi, M.D., Ph.D. Laboratory of Immunology Division of Therapeu8c Proteins OBP, CDER, FDA Map to the talk:
More informationSupplementary Data Cyclophilin B Supports Myc and Mutant p53 Dependent Survival of Glioblastoma Multiforme Cells
Supplementary Data Cyclophilin B Supports Myc and Mutant p53 Dependent Survival of Glioblastoma Multiforme Cells Jae Won Choi, Mark A. Schroeder, Jann N. Sarkaria, and Richard J. Bram 1 Figure S1. Pharmacological
More informationFigure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with
Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with isografts (control) at the 2nd week, 4th and 8th week by RT-PCR. At the advanced stage, the expression of these three
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationSupplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis rasseit and Steiner et al. .. Supplementary Figure 1 % of initial
More informationAspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.
Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,
More informationKerdiles et al - Figure S1
Kerdiles et al - Figure S1 a b Homo sapiens T B ce ce l ls c l M ls ac r PM oph N ag es Mus musculus Foxo1 PLCγ Supplementary Figure 1 Foxo1 expression pattern is conserved between mouse and human. (a)
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationTumor Microenvironments Direct the Recruitment and Expansion of Human Th17 Cells
This information is current as of May 2, 2018. Tumor Microenvironments Direct the Recruitment and Expansion of Human Th17 Cells Xinming Su, Jian Ye, Eddy C. Hsueh, Yanping Zhang, Daniel F. Hoft and Guangyong
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplementary appendix
Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kennedy GA, Varelias A, Vuckovic S, et al.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
More informationof whole cell cultures in U-bottomed wells of a 96-well plate are shown. 2
Supplementary online material Supplementary figure legends Supplementary Figure 1 Exposure to T reg cells causes loss of T resp cells in co-cultures. T resp cells were stimulated with CD3+CD28 alone or
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationSirt1 Hmg20b Gm (0.17) 24 (17.3) 877 (857)
3 (0.17) 24 (17.3) Sirt1 Hmg20 Gm4763 877 (857) c d Suppl. Figure 1. Screen validation for top candidate antagonists of Dot1L (a) Numer of genes with one (gray), two (cyan) or three (red) shrna scored
More informationEpigenetic Instability of Cytokine and Transcription Factor Gene Loci Underlies Plasticity of the T Helper 17 Cell Lineage
Article Epigenetic Instability of Cytokine and Transcription Factor Gene Loci Underlies Plasticity of the T Helper 17 Cell Lineage Ryuta Mukasa, 1,3 Anand Balasubramani, 1,2,5 Yun Kyung Lee, 1,2,5 Sarah
More informationSupplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
More informationmicrorna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationSupplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
More informationYour Partner in Proteomics. Reporter System Luciferase Reporter Stable Cell Lines One-Step Luc Assay Kit Stable Cell Lines.
Reporter System Luciferase Reporter Stable Cell Lines One-Step Luc Assay Kit Stable Cell Lines www.abeomics.com Reporter Cell Lines Reporter cell lines are used for cell-based assays for screening of drugs/compounds
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More information