Significant protection against high-dose simian immunodeficiency virus challenge conferred by a new prime-boost vaccine regimen

Transcription

1 JVI Accepts, published online ahead of print on 1 April 0 J. Virol. doi:./jvi.00- Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved Significant protection against high-dose simian immunodeficiency virus challenge conferred by a new prime-boost vaccine regimen John B. Schell, 1 Nina F. Rose, 1 Kapil Bahl, 1 Kathryn Diller, 1 Linda Buonocore, 1 Meredith Hunter, Preston A. Marx, Ratish Gahmbira, Haili Tang, David C. Montefiori, Welkin E. Johnson, and John K. Rose 1 1 Yale University School of Medicine, New Haven, CT Tulane National Primate Research Center, Covington, LA Duke University Medical Center, Durham, NC New England Regional Primate Research Center, Harvard University, Southborough, MA Running Head: Vaccine Protection from SIV challenge 1 0 Corresponding author: John K. Rose Department of Pathology Yale University School of Medicine Cedar St. New Haven, CT. 0 john.rose@yale.edu Tel 0-- Fax 0-- 1

2 We constructed vaccine vectors based on live recombinant vesicular stomatitis virus (VSV) and a Semliki Forest Virus replicon (SFVG) that propagates through expression of the VSV glycoprotein (G). These vectors expressing SIV Gag and Env proteins were used to vaccinate rhesus macaques in a new heterologous prime-boost regimen designed to optimize induction of antibody. Six vaccinated animals and six controls were then given a high-dose mucosal challenge with the diverse SIVsmE0 quasispecies. All control animals became infected and had peak viral RNA loads of - copies/ml. In contrast, four of the vaccinees showed significant (p=0.0) apparent sterilizing immunity and no detectable viral load. Subsequent CD + T cell depletion confirmed the absence of SIV infection in these animals. The two other vaccinees had peak viral loads of x and x copies/ml, levels below all of the controls, and showed undetectable virus loads by day post-challenge. The vaccine regimen induced high-titer pre-challenge serum neutralizing antibodies (nab) to some cloned SIVsmE0 Env proteins, but antibodies able to neutralize the challenge virus swarm were not detected. The cellular immune responses induced by the vaccine were generally weak and did not correlate with protection. Although the immune correlates of protection are not yet clear, the heterologous VSV/SFVG prime-boost is clearly a potent vaccine regimen for inducing virus nabs and protection against a heterogeneous viral swarm.

3 Development of an effective HIV-1 (human immunodeficiency virus type 1) vaccine is a critical global health priority and has been a major scientific challenge for over years. Initial clinical trials of an HIV-1 Env (Envelope) protein vaccine showed no efficacy (, ). This failure was likely due to the inability of the vaccine to generate neutralizing antibodies (nabs) to the diverse HIV-1 Env proteins present in the infecting strains and potentially to the high-risk population used in the clinical trial. Studies in non-human primates using defective adenovirus type vectors (Ad) indicated that induction of potent cellular immunity to the simian immunodeficiency (SIV) proteins could reduce viral loads following SIV infection and at least slow disease progression (,,, ). Such studies led to clinical trials of Ad vectors expressing HIV-1 Gag, Pol, and Nef proteins. Despite the induction of significant cellular immune responses in vaccinees, this vaccine failed to protect against HIV-1 infection or to reduce viral loads following infection (, ). In addition, vaccinees with pre-existing Ad-specific nabs exhibited an enhanced rate of HIV-1 acquisition. The latter finding has led to major concerns with the use of vaccine vectors for which there is significant pre-existing immunity in the human population. A more recent clinical trial in a low-risk population in Thailand generated renewed hope for HIV vaccine development because it showed marginally significant protection from infection (1). The vaccine employed a heterologous prime-boost strategy using the canary pox vector ALVAC-HIV, expressing HIV Gag, Pro, and Env, followed by boosting with purified HIV Env protein. The vaccine did not generate consistent cellular or

4 detectable nab responses to HIV-1 and the immune correlates of protection remain unknown. These results suggests that a more potent vaccine regimen will be required to generate an HIV-1 vaccine providing more significant protection. Our own studies have been directed toward development of two virus-derived vaccine vectors for which there is no significant pre-existing immunity in the human population. The two vector systems are based on attenuated vesicular stomatitis virus (0,,, ) and an alphavirus, Semliki Forest Virus, replicon (SFVG) that is packaged by a VSV glycoprotein into infectious vesicles (, ). VSV-based HIV vaccine vectors () are scheduled for clinical trials beginning in 0. In previous studies, VSV vectors expressing Env and Gag proteins have provided protection against disease following challenge with an SIV/HIV (SHIV) hybrid virus (). A heterologous prime-boost regimen employing VSV and modified vaccinia virus Ankara (MVA) vectors was also highly effective against this SHIV challenge (0) and provided protection lasting over five years (). Vaccine regimens using heterologous viral vectors for priming and boosting are highly effective at focusing the boost response on the vaccine antigens expressed in the vectors (1,, 1,,, ). In addition, the potency of the vector combinations may derive from the induction of a more diverse set of innate immune responses that act as adjuvants. An extensive comparison of six different vaccine vectors in heterologous primeboost combinations showed that a VSV vector combined with an alphavirus replicon was the most synergistic combination for induction of antibody to a viral protein (1).

5 In the SIV vaccine study reported here, we have tested VSV and SFVG alphavirus replicon vectors expressing SIV Env and Gag proteins in a heterologous prime-boost regimen. Our goal was to induce optimal nab responses to the SIV challenge virus and determine if the vaccine regimen might be sufficient to provide protection against challenge with a highly pathogenic SIV quasispecies, SIVsmE0. We report that this vaccine regimen provided statistically significant and apparently sterilizing protection from high-dose mucosal challenge. MATERIALS AND METHODS Vaccine vector construction. To construct a DNA vector expressing an SFV RNA replicon with two SFV subgenomic promoters, we started with the pbk-t-sfv plasmid that has a CMV promoter preceding the SFV replicon sequence (0). The single Apa I site in this vector was eliminated with T DNA polymerase. To generate a plasmid designated pbksfvg-gp10, an Spe I-Sac I fragment containing the CMV promoter and the beginning of the SFV replicon (, nucleotides) from this plasmid was ligated to a, nucleotide Spe I-SacI fragment from psfvg-gp10 (). This vector encodes the SFV replicon with one subgenomic promoter driving expression of VSV G and a second SFV subgenomic promoter driving expression of HIV gp10. Apa I sites flank the gp10 sequence in this plasmid. E0 env and gag genes were obtained by PCR of DNA from CEMx1 cells infected with SIVsmE0, and cloned into pbssk +. An E0 envg gene was then generated by overlap extension PCR (1). The E0 envg gene encodes an Env protein with its cytoplasmic domain replaced with the VSV G cytoplasmic domain for efficient

6 incorporation into VSV particles. E0 envg was amplified by PCR from the plasmid pbse0envg using the forward primer: GATCGATCGGGCCCTTAATTAACTCGAGAAGATGGGATGTCTTGGGAATCAGC- and the reverse primer: GATCCCCCCCGGGCCCTGCAGGCTAGCTTACTTTCCAAGTCGGTTCATCTC-. Both primers contained Apa I sites (underlined) and also introduced unique Pac I and Sbf I sites for use in subsequent directional cloning. The PCR product was digested with Apa I and then cloned into pbksfvg-gp10 following excision of the gp10 insert with Apa I. The plasmid obtained was designated pbksfvg-e0envg. To construct pbksfvg-e0gag, the E0 gag gene was amplified by PCR using the forward primer: -GATCGATCGGGCCCTTAATTAAGGATCCAAGATGGGCGCGAGAAACTCCGTC- containing an underlined Pac I site, and a reverse primer: -GATCGATCGGGCCCTGCAGGGATCCCTACTGGTCTTCTCCAAAGAGAG- containing an underlined Sbf I site. The PCR product was digested with Pac I and Sbf I and cloned into pbksfvg-e0envg after excising the E0EnvG with Pac I and Sbf I. The E0 gag and EnvG genes were also inserted into the fifth position of the pvsv- XN plasmids expressing either the VSV Indiana or New Jersey serotype G proteins (,, 1). VSV recombinants expressing the proteins were then derived by standard procedures (). Correct protein expression was verified by [ S] methionine labeling and SDS-PAGE of lysates from infected cells and by immunofluorescence microscopy. The vectors are shown in Fig. 1A.

7 1 1 Preparation of vaccine stocks. To prepare SFVG replicon particles, BHK-1 cells on cm diameter dishes ( x cells/dish) were transfected with µg of pbksfvg- E0Gag or pbksfvg-e0envg using Lipofectamine (Invitrogen) and OptiMEM medium according to the manufacturers protocol. After five hours, the transfection medium was removed and replaced with ml DMEM + % FBS. After hours, the cells were sonicated to obtain optimal release of the infectious particles and particles were then concentrated and titered as described previously for cells transfected directly with SFVG replicon RNA (). Serum-free stocks of VSV vectors were grown on BHK-1 cells and titered as described previously (). Vaccinations. Indian rhesus macaques were housed and cared for at the Tulane National Primate Research Center (TNPRC). Vaccinations followed the schedule shown in Fig. 1B. For the VSV prime and second boost, a total of 1x plaque forming units (pfu) of both VSV-E0Gag and VSV-E0EnvG viruses were delivered intramuscularly (IM; x 1 pfu) and intranasally (IN; x pfu) to each monkey. The SFVG replicon particle boost was delivered by intramuscular injection only. Each animal received 1x infectious units (i.u.) of both SFVG-Gag and SFVG-EnvG. Animals in the control group were primed and boosted with VSV vectors expressing an influenza hemagglutinin protein. Samples and viral load assays. All tissue and serum samples were shipped cryogenically frozen to Yale University and were stored in liquid nitrogen upon arrival. Branched DNA (bdna) analysis on serum samples was done by Siemens Diagnostics, Clinical Laboratory (Berkeley, CA).

8 Neutralization Assays. Neutralization was measured as a function of reductions in luciferase reporter gene expression after either a single round of infection in TZM-bl cells () or multiple rounds of replication in..egfp.luc.m (M-Luc) cells (). Neutralization titers in both assays are the dilution at which relative luminescence units (RLU) were reduced by 0% compared to virus control wells after subtraction of background RLUs. Assay stocks of molecularly cloned Env-pseudotyped virus E0/CR-PK-A and SIVsmE0. were prepared by transfection in T cells and were titrated in TZM-bl cells as described (). E0/CR-PK-A and BR-CGV.IR are SGA-derived plasma clones obtained at peak viremia during primary infection after intrarectal challenge () and exhibit a resistant tier neutralization phenotype (D. Montefiori, unpublished data). E0. is a functional rev-env cassette cloned from DNA of PBMC infected in vitro and exhibits a highly sensitive tier 1A neutralization phenotype. An uncloned stock of SIVsmE0 was prepared in CEMx1 cells and titrated in M-Luc cells () for use in neutralization assays. The VSV G-E0EnvG-GFP and VSV G neutralization assays were described previously (, ). The VSV GE0EnvG-GFP neutralization assay used HOS-CD-CCR cells obtained from the NIH AIDS research and reference reagent program and were described previously (). An endpoint of ninety percent neutralization of infection was scored by counting infected (GFP + ) cells by fluorescence microscopy. VSV vector neutralization assays were described previously (). ELISA for serum antibody to oligomeric SIV Env. Enzyme-linked immunosorbent assays (ELISAs) were performed essentially as described previously for HIV Env (),with

9 modifications published previously (). SIV gp10 was obtained from the medium of cells infected with a vaccinia virus recombinant (vpaul) encoding the secreted SIVmac gp10 (a gift from Dr. R. Doms, University of Pennsylvania). Optical densities were determined at a wavelength of 1 nm in a Bio-Rad ELISA plate reader. Titers were determined from graphs of the data and are given as the reciprocal of the serum dilution that gave an absorbance of 0. after subtraction of background values obtained from an identical dilution series with preimmune sera. Flow cytometry. For cell surface marker and tetramer analysis, cryo-preserved cells were washed in staining buffer (PBS containing % fetal calf serum) and stained for surface marker expression. Directly conjugated monoclonal antibodies (BD; San Jose, CA) CD-V0 (SP-), CD-PerCP (L00), and CD-Alexa Fluor-00 (RPA-T) were used to discern T cell subsets. Cells were co-stained with both Mamu-A*01 specific APC and PE conjugated tetramer containing the SIV gag peptide pc (Beckman Coulter; Fullerton, CA). Cell viability was assessed with the LIVE/DEAD Fixable Aqua dead cell stain kit (Molecular Probes; Eugene, OR). Following surface staining, cells were washed in staining buffer and fixed using Cytofix fixation buffer (BD). Cells were then resuspended in staining buffer prior to data acquisition using a multicolor LSR II flow cytometer (BD). Collected data was analyzed using FlowJo software version.. (Treestar; Ashland, OR). ELISpot assays. The ELISpot protocol has been described previously in greater detail (0). Cryo-preserved PBMCs were thawed and pelleted by centrifugation. Cells were infected with recombinant vaccinia virus (rvv) expressing either SIV Gag, Env, or bacteriophage T RNA polymerase (negative control) at a multiplicity of infection (MOI)

10 of. In parallel, cells were either treated with PMA (0 ng/ml) and ionomycin (0 ng/ml) or mock infected, and served as positive and negative controls, respectively. Cultures were stimulated for 1 hours in a humidified incubator before being used in the ELISpot assay. MultiScreen HTS -well plates (Millipore; Bedford, MA) were coated with mouse anti-human interferon gamma antibody at a final concentration of 1µg/well (BD). After overnight infection or stimulation described above, x PBMCs were transferred to the antibody coated plates. After a five-hour incubation at o C, the cells were washed off the plates using PBS-Tween (0.0%) and then treated with an anti-mouse IgG biotinylated antibody (Invitrogen; Camarillo, CA) for one hour. Upon washing, plates were then treated with streptavadin-hrp (Southern Biotech; Birmingham, AL) and then exposed to one-step chromogenic substrate (Thermo Scientific; Rockford, IL). Plates were washed, allowed to air dry and finally counted for spot forming cells (SFC). Data was analyzed and plotted using Instat software, version.0b (GraphPad Software; San Diego, CA). CD + T cell depletion For CD + T cell depletion experiments, animals were injected 1 days post-challenge with a rhesus recombinant anti-cdα antibody from the NIH Nonhuman Primate Reagent Resource (M-T0). The initial dose of antibody ( mg/kg body weight) was delivered subcutaneously, whereas the three subsequent doses ( mg/kg) were delivered intravenously RESULTS

11 Study design and antibody responses to vectors. In this study two groups of rhesus macaques were vaccinated, boosted, and challenged according to the schedule shown in Fig. 1B. In each group, we included three animals carrying the MamuA*01 MHC I allele to allow enumeration of SIV Gag-specific, CD T cells using MHC I tetramers. Animals with other MHC I alleles that have been associated with better control of SIV replication (B0, B1) were excluded from the vaccine group. The six vaccine group animals were primed with VSV-based vectors expressing EnvG and Gag proteins derived from SIVsmE0 quasispecies (Fig. 1A). The EnvG protein is an E0 Env with its cytoplasmic tail replaced with the VSV G cytoplasmic tail. This modification enhances EnvG protein incorporation into VSV particles (1). The six control group animals received VSV vectors expressing an unrelated influenza antigen. The priming vector expressed the VSV New Jersey (NJ) serotype glycoprotein and nabs to VSV NJ were detected in all animals by day (Fig. 1C). The vaccine group animals were then boosted at day with SFVG propagating replicons expressing the same EnvG and Gag proteins (Fig. 1A), but expressing the Indiana (I) serotype glycoprotein to avoid nabs generated to the priming vector. At day, the animals had all developed nabs to VSV(I), but these were between and -fold lower than we have previously seen in macaques vaccinated with VSV(I) vectors (Fig. 1C, and (0)). We then boosted all vaccine group animals at day with a VSV(I) vector expressing the E0 EnvG and Gag proteins. Following the boost, the nab responses to VSV(I) increased more than -fold by day 1. This result suggested that the boost was effective despite the exposure to the VSV G(I) protein encoded by the SFVG boosting vector. Control and vaccine group animals

12 were all given a high-dose (000 TCID0), intrarectal challenge of a SIVsmE0 stock at day 1 (Fig. 1B). Viral loads following SIVsmE0 challenge. For the initial evaluation of the vaccine effectiveness we measured viral loads in the vaccine and control groups (Figs. A, B). After challenge, all control animals became infected and had peak viral loads between 1x and x copies/ml of plasma (Fig. A). The three control animals with the highest loads all progressed to AIDS within three to eight months following challenge. Interestingly, two of these animals, EN and N carried the MamuA*01 MHC allele that is associated with better control of SIVmac/1 challenge (,, ), but was not sufficient to provide control of SIVsmE0 loads. The three other control animals were able to reduce their viral loads to below detection within eight months. The viral load results in the vaccine group were significantly different. No viral loads were detected at any time in four out of six vaccine group animals (Fig. B). The two vaccinees that became infected, had lower peak viral loads than any of the control animals. Animal DG1 had a peak viral load of x copies/ml of plasma, and had an undetectable load by day 1 days following challenge. Animal DF had a peak viral load of.x copies/ml of plasma, and controlled the infection to below the limit of detection days after the challenge. The control and vaccinee peak viral loads (geometric means) at 1 days post-infection were 1x and x copies/ml, respectively and the difference is significant (P<0.001, two-tailed Mann-Whitney test). Effects of SIV challenge on CD T cells in the gut and peripheral blood. Pathogenic infection with SIV causes rapid depletion of the CCR + memory CD + T cells residing in 1

13 the gut lamina propria without causing substantial depletion of the CD + peripheral blood T cells that are largely naïve (, ). To examine the effects of the SIV challenge on these cells in the vaccine and control groups, we analyzed the percentage of total T cells in the gut that were CD + at day of challenge (day 0), and and 0 days following challenge (Fig. A, B). CD + T cell counts were also measured in the peripheral blood (expressed as percent pre-challenge CD + cell counts) at these same time points and at later times throughout the study (Fig. C, D). Five of the six control animals showed major depletion of the gut CD + T cells by day following challenge while the CD + T cells counts in the blood showed at most a 0% decrease. The animals showing the highest peak loads (indicated by asterisks) also showed the largest decreases in gut CD + T cells. Large decreases in the blood CD + T cell counts were seen in three control animals at later times as they developed AIDS. In contrast, the vaccine group showed good preservation of the gut CD + T cell population as would be expected from the apparent lack of infection in four animals and the greatly reduced loads in the two animals that became infected. DF, the animal with the highest peak viral load did show an early decrease in gut CD + T cells followed by a recovery. Peripheral blood CD + T cell counts in the vaccine group animals showed no significant decrease over time. Antibodies to SIV Envs. The SIVsmE0 quasispecies is relatively resistant to nab although antibodies capable of neutralizing it do develop following infection of macaques. These antibodies are, however, insufficient to control the virus (, ). To elucidate the immune correlates of protection in the vaccine group animals, we first tested for the 1

14 presence of nab to the SIVsmE0 quasispecies following priming, boosting, the day of challenge, and up to 0 days post-challenge. No nab to the quasispecies was detectable even at serum dilutions of 1:0 in CEMx1 cells. Because results of a nab assay using a complex quasispecies is difficult to interpret, we next measured nabs using two different Env pseudotypes derived from cloned Env sequences of SIVsmE0. No nabs to tier Envs (CR-PK-A and BR-CGV.IR) were detected even at serum dilutions of 1:0. However, we did detect very high levels of nab to the tier 1A E0. envelope (Fig. A). All vaccine group animals showed nab to E0. after the prime, and a dramatic increase in neutralizing antibody (nab) titers (approximately 0-fold) was seen after the SFVG replicon boost. The second VSV boost was less effective, but did increase waning Ab titers an average of about -fold. At the time of challenge, all animals had antibodies capable of neutralizing the E0. envelope. We did not detect a correlation between the magnitude of the nab titers to the E0. Env and protection. The two animals that became infected (DF and DG1) had higher pre-challenge nab titers than two of the protected animals (CM1 and FP). Following challenge, nab titers continued to increase in DF and DG1, consistent with an anamnestic immune response following infection. In the four protected animals, nab titers decreased or stayed the same, consistent with these animals being protected from SIV infection. We also measured nabs to a VSV recombinant (VSV G-EGFP) expressing the E0- EnvG protein used in the vaccine. These surrogate viruses lack VSV G protein, but have the EnvG protein incorporated into the VSV envelope, and infect cells via CD and CCR 1

15 1 1 (). In this assay, the nab titers were lower than, but largely paralleled what was seen in the E0. pseudotype assay. Total serum antibody to oligomeric SIV Env gp10 was also measured by ELISA assay at the time of challenge and post-challenge (Fig. S1). The titers decreased following challenge in the four uninfected vaccinees consistent with lack of infection, while anamnestic increases occurred in the two vaccinees that became infected. However, the pre-challenge titers did not correlate with protection since the animal with the highest prechallenge titer (DF) was one of the two vaccinees that became infected. CD + T cell responses did not correlate with protection. MHC class I tetramers were used to quantify the percentage of CD + CD + T cells capable of recognizing the immunodominant gag epitope, pc, from the three MamuA*01 + animals in the vaccine group. Fig. A shows the results of tetramer analysis in these animals at one week after prime (day ), one week after the second boost (day ), and also at days post- 1 challenge (day 1 post-prime). Two of the animals (DG1 and DT0) showed approximately 0.% pc + cells after the second boost, while the third animal, CJ, had a tetramer response that was less than 0.1%. Following challenge, the one MamuA*01 vaccine animal that was infected (DG1), showed a six-fold increase in pc + CD cells consistent with an anamnestic response to infection. By day post-challenge, pc + CD cells were low to undetectable in the uninfected animals and had decreased by six-fold in DG1 consistent with effective control of the infection (data not shown). Therefore, pc tetramer positivity was not predictive of protection since an animal with the lowest 1

16 response (CJ) was protected from infection, while DG1, an animal with a much greater response, was infected. We next measured functional responses of the T cells isolated from these animals to Gag by using an interferon-gamma (IFN-γ) ELISpot assay (Fig. B). Gag-specific responses were minimal in all animals, but were generally consistent with the tetramer results. While an anamnestic response in DG1 was apparent post-challenge, none of the animals made significant pre- or post-challenge responses to SIV Env in ELISpot assays (data not shown). T cell responses in the non-mamua*01 animals were also analyzed using Gag and Env ELISpot assays. The responses to Gag and Env were at the background level in these animals and also did not correlate with protection from infection (data not shown). CD depletion in the vaccine group animals confirms apparent sterilizing immunity. The lack of detectable viral loads and absence of anamnestic antibody and T cell responses in the four protected animals in the vaccine group was consistent with complete protection, but did not rule out a very low level of infection. To determine if the four protected animals in the vaccine group had a low level infection that was being controlled by CD T cells, we depleted this population in all six vaccine group animals by four subcutaneous injections of rhesus anti-cd Ab given at three day intervals. Depletion was started 1 days after the SIV challenge. By three days following the first SC injection, all animals showed complete depletion of CD + T cells in the peripheral blood (Fig. A). The two animals that were definitely infected initially, DF and DG1, showed a rapid reappearance of viral RNA in the blood by three and seven days post- 1

17 depletion. In contrast, there was no detectable viral RNA in the four protected animals consistent with lack of any initial infection. The rate of reappearance of viral RNA in DF and DG1 correlated with their initial peak viral loads. Interestingly, while DF was able to control its viral load within a month following the last injection, DG1 was not. The control by DF corresponded to a rapid reappearance of CD + T cells in this animal. CD + T cells in DG1 did not return to normal levels and this animal maintained high levels of viremia. DISCUSSION Virus based vaccine vectors are often strong inducers of immune responses, and 1 can be particularly potent when used in a heterologous prime-boost regimen. The goal of our current study was to test a new vaccine vector prime-boost combination for its ability to induce immune responses and protect macaques against a single, high-dose mucosal challenge with a highly pathogenic SIV quasispecies, SIVsmE0 (1). We chose to challenge with SIVsmE0 because this virus swarm shows a moderate degree of resistance to nab, however some nabs to the swarm typically develop in infected animals within - months post-infection, much like in HIV-1 infection (). In contrast, the more commonly used SIVmac1 quasispecies is extremely resistant to nab (). Therefore, E0 might be a more relevant model for obtaining sterilizing immunity based on induction of nab. As with other pathogenic SIV challenges, high-dose SIVsmE0 challenge has proven difficult to protect against. Several vaccine studies have employed IV challenges 1

18 with SIVsmE0 with only partial success at obtaining control of virus replication (, 1, 1,, ). A vaccine study employing a high-dose rectal challenge with SIVsmE0 was reported by Johnston et al. (00). In that study, they observed better control of peak virus load in vaccinees compared to controls, and one out of six vaccinees appeared not to be infected after challenge (1). A more recent vaccine study employed multiple low-dose rectal challenges with the E0 virus swarm (). A significant reduction in rate of acquisition of E0 infection was seen in animals vaccinated with the heterologous live-attenuated SIVmac nef. In addition, reductions in viral loads were seen in animals that became infected. However, much like the study presented here, the immune correlates of protection were not clear. In the present study we used a mucosal challenge because this mode of transmission accounts for the majority of human HIV infections. Although a multiple lowdose challenge might better mimic typical human HIV transmission, we used a high-dose challenge to ensure infection of all control animals after a single challenge. Protection from high-dose challenge could also provide stronger evidence of vaccine effectiveness because multiple distinct viral genotypes should be transmitted simultaneously (). The level of protection we observed was striking with all six controls infected, and only two of six vaccinees infected. The protection from infection was statistically significant (p=0.0, Fisher s exact test) and was verified by CD + cell depletion, which showed no virus rebound in the four completely protected animals. Virus rebound in the two initially infected animals indicated an important role for CD + cells in control of replication. The ability of CD + T cells to control SIV infection is well established (0,, 0). The results 1

19 also show that any antibodies that may have been present at the time of depletion were insufficient to prevent a rapid rebound of virus replication. The immune correlates of apparently sterilizing protection in our study are not yet clear. Cellular immune responses to both Gag and Env antigens in the vaccine were modest prior to challenge and their magnitudes did not correlate with protection. It is, of course, possible that cellular immune responses at the site of infection were generated and were sufficient to clear brief transient infection that went undetected (). Such a mechanism has been reported for a rhesus cytomegalovirus-vectored SIV vaccine inducing strong effector-memory T cells (1). There was clear evidence of anamnestic antibody and cellular immune responses in the vaccinees that became infected in that study. However, the lack of any anamnestic T cell or antibody responses in our protected animals argues against infection in these animals. Determining the possible contribution of virus neutralizing antibody to protection is especially complicated when multiple genotypes are present in the quasispecies challenge. After the priming vaccination, all vaccinees made detectable serum nabs to a specific Env clone (E0.) derived from the quasispecies and to the cloned E0 EnvG envelope used in the vaccine. There was a striking increase in these nab titers (0-fold) after the SFVG vector boost with titers exceeding in one animal. However, we did not detect nabs to the E0 quasispecies itself or to other E0 Env clones (CR-PK-A and BR-CGV.IR). Despite the absence of nab to the quasispecies in the in vitro assay, it is still possible that the majority of the viruses infecting in vivo are nab sensitive and that 1

20 mucosal nab responses could explain the protection. Recent studies indicate that even relatively low levels of mucosal nabs can protect against mucosal SHIV challenge (1). Detection of nabs in fecal samples or rectal washes is difficult and has not yet given us consistent results even in SIVsmE0 infected animals with high serum nab titers. It is also possible that non-neutralizing mucosal antibodies played a role in protection through clearance of immune complexes or antibody-dependent cell-mediated cytotoxicity. We analyzed the E0 challenge stock by single genome amplification (SGA) and sequencing of sixty env genes (1, ). The results showed a mixture of sequences (Fig. S A, B). The complexity was high with a maximum difference of 1.% between individual sequences, similar to the result of 1.% obtained by Keele et al, 00 for a related SIVsmE0 stock (). The portion of the env gene used in the vaccine (lacking the Env cytoplasmic tail coding sequence) was an outlier sequence (Fig. S C) and differed from the consensus sequence of the quasispecies at 1 amino acid positions out of (%). In the future it should be possible using SGA to determine the sequences the founder virus env genes from the control and vaccinated animals. Analysis of the nab sensitivities of these viruses could provide support for a role of nab in protection if the majority of control animals were infected with founder viruses sensitive to nab induced in the protected vaccinees. A recent study assessed the effect of TRIMα on viral load in rhesus macaques infected with SIVsmE- (), a clone of a virus related to the SIVsmE0 quasi-species. That study showed a trend toward better control of SIVsmE- replication in animals homozygous for the TRIM TFP/TFP allele compared to animals heterozygous for the 0

21 TRIM TFP/Q allele. Although it is not known if the SIVsmE0 quasispecies are subject to TRIMα restriction, we retrospectively determined the TRIMα status of the animals in this study. The results are shown in Table S1. All animals were either heterozygous TFP/ Q, or homozygous TFP/TFP at the TRIMα locus. The only TRIM TFP/TFP animal in the control group (FT0) had a low viral setpoint at day 1, but this setpoint was no lower than other control animals that were TRIM TFP/Q (DD0 and EP). Three control animals developed high viral loads by day 1 and were also predicted to be moderate controllers (TFP/Q). Therefore it is not clear from our limited data if SIVsmE0 replication is affected by TRIMα. A larger study of more than one hundred control animals (including the animals from this study) infected with SIVsmE0 has not revealed statistically significant effects of TRIMα alleles on SIVsmE0 replication (Welkin Johnson, unpublished results). In the vaccine group there were three TFP/TFP animals and all of these as well as one TFP/Q animal were protected from infection. The two vaccine group animals that became infected were TFP/Q and exhibited rapid control of viral loads. Although vaccinated animals were protected from infection independent of their TRIMα allele status, it remains possible that the TRIMα status could limit initial virus replication and thereby enhance vaccine efficacy. This issue could be avoided in future studies by eliminating potentially protective TRIMα alleles in control and vaccine groups. Recent results from the Thai vaccine trial suggest that a modest level of protection from HIV infection is possible (1). The consistent immune response seen in vaccinees was induction of anti-hiv Env antibody suggesting that antibody may have played a role 1

22 in protection. Given the marginal effects of that vaccine, it would be useful to have an animal model where consistent protection from SIV infection can be achieved. The experimental vaccine that we describe here combining VSV and SFVG replicon particles generates robust nab responses and provides a high level of protection. It could prove useful for understanding mechanisms of sterilizing protection from immunodeficiency virus challenge as well as control of virus replication following infection. This vector system should also be considered a strong candidate for future SIV and HIV vaccine studies attempting to elicit broadly neutralizing antibodies with novel antigens ACKNOWLEDGEMENTS We thank Dr. Philip Johnson for a generous supply of the SIVsmE0 challenge stock and for helpful suggestions. We thank Drs. Gunilla Karlsson and Peter Lilejstrom for providing the pbk-t-sfv vector and Dr. Robert Doms for providing vaccinia virus recombinants expressing SIV Env proteins. This work was supported by NIH grants AI and AI-0, the Tulane National Primate Research Center base grant RR0001, and NIAID contract AI.

23 Barefoot, B., N. J. Thornburg, D. H. Barouch, J. S. Yu, C. Sample, R. E. Johnston, H. X. Liao, T. B. Kepler, B. F. Haynes, and E. Ramsburg. 00. Comparison of multiple vaccine vectors in a single heterologous prime-boost trial. Vaccine :-1.. Barouch, D. H., J. Kunstman, M. J. Kuroda, J. E. Schmitz, S. Santra, F. W. Peyerl, G. R. Krivulka, K. Beaudry, M. A. Lifton, D. A. Gorgone, D. C. Montefiori, M. G. Lewis, S. M. Wolinsky, and N. L. Letvin. 00. Eventual AIDS vaccine failure in a rhesus monkey by viral escape from cytotoxic T lymphocytes. Nature 1:-.. Boritz, E., J. Gerlach, J. E. Johnson, and J. K. Rose. 1. Replication-competent rhabdoviruses with human immunodeficiency virus type 1 coats and green fluorescent protein: entry by a ph-independent pathway. J Virol :-.. Buchbinder, S. P., D. V. Mehrotra, A. Duerr, D. W. Fitzgerald, R. Mogg, D. Li, P. B. Gilbert, J. R. Lama, M. Marmor, C. Del Rio, M. J. McElrath, D. R. Casimiro, K. M. Gottesdiener, J. A. Chodakewitz, L. Corey, and M. N. Robertson. 00. Efficacy assessment of a cell-mediated immunity HIV-1 vaccine (the Step Study): a double-blind, randomised, placebo-controlled, test-of-concept trial. Lancet :-.. Casimiro, D. R., F. Wang, W. A. Schleif, X. Liang, Z. Q. Zhang, T. W. Tobery, M. E. Davies, A. B. McDermott, D. H. O'Connor, A. Fridman, A. Bagchi, L. G. Tussey, A. J. Bett, A. C. Finnefrock, T. M. Fu, A. Tang, K. A. Wilson, M. Chen, H. C. Perry, G. J. Heidecker, D. C. Freed, A. Carella, K. S. Punt, K. J. Sykes, L. Huang, V. I. Ausensi, M. Bachinsky, U. Sadasivan-Nair, D. I. Watkins, E. A. Emini, and J. W. Shiver. 00. Attenuation of simian immunodeficiency virus SIVmac infection by prophylactic immunization with dna and recombinant adenoviral vaccine vectors expressing Gag. J Virol :1-.. Cooper, D., K. J. Wright, P. C. Calderon, M. Guo, F. Nasar, J. E. Johnson, J. W. Coleman, M. Lee, C. Kotash, I. Yurgelonis, R. J. Natuk, R. M. Hendry, S. A. Udem, and D. K. Clarke. 00. Attenuation of recombinant vesicular stomatitis virus-human immunodeficiency virus type 1 vaccine vectors by gene translocations and g gene truncation reduces neurovirulence and enhances immunogenicity in mice. J Virol :0-1.. Davis, N. L., I. J. Caley, K. W. Brown, M. R. Betts, D. M. Irlbeck, K. M. McGrath, M. J. Connell, D. C. Montefiori, J. A. Frelinger, R. Swanstrom, P. R. Johnson, and R. E. Johnston Vaccination of macaques against pathogenic simian immunodeficiency virus with Venezuelan equine encephalitis virus replicon particles. J Virol :1-.. Davis, N. L., A. West, E. Reap, G. MacDonald, M. Collier, S. Dryga, M. Maughan, M. Connell, C. Walker, K. McGrath, C. Cecil, L. H. Ping, J. Frelinger, R. Olmsted, P. Keith, R. Swanstrom, C. Williamson, P. Johnson, D. Montefiori, and R. E. Johnston. 00. Alphavirus replicon particles as candidate HIV vaccines. IUBMB Life :0-.. Deng, H., R. Liu, W. Ellmeier, S. Choe, D. Unutmaz, M. Burkhart, P. Di Marzio, S. Marmon, R. E. Sutton, C. M. Hill, C. B. Davis, S. C. Peiper, T. J. Schall, D. R. Littman, and N. R. Landau. 1. Identification of a major co-receptor for primary isolates of HIV- 1. Nature 1:1-.. Flynn, N. M., D. N. Forthal, C. D. Harro, F. N. Judson, K. H. Mayer, and M. F. Para. 00. Placebo-controlled phase trial of a recombinant glycoprotein 10 vaccine to prevent HIV-1 infection. J Infect Dis 11:-.

24 Haglund, K., I. Leiner, K. Kerksiek, L. Buonocore, E. Pamer, and J. K. Rose. 00. Robust recall and long-term memory T-cell responses induced by prime-boost regimens with heterologous live viral vectors expressing human immunodeficiency virus type 1 Gag and Env proteins. J Virol : Hansen, S. G., C. Vieville, N. Whizin, L. Coyne-Johnson, D. C. Siess, D. D. Drummond, A. W. Legasse, M. K. Axthelm, K. Oswald, C. M. Trubey, M. Piatak, Jr., J. D. Lifson, J. A. Nelson, M. A. Jarvis, and L. J. Picker. 00. Effector memory T cell responses are associated with protection of rhesus monkeys from mucosal simian immunodeficiency virus challenge. Nat Med 1:-. 1. Hessell, A. J., P. Poignard, M. Hunter, L. Hangartner, D. M. Tehrani, W. K. Bleeker, P. W. Parren, P. A. Marx, and D. R. Burton. 00. Effective, low-titer antibody protection against low-dose repeated mucosal SHIV challenge in macaques. Nat Med 1: Hirsch, V. M., R. A. Olmsted, M. Murphey-Corb, R. H. Purcell, and P. R. Johnson. 1. An African primate lentivirus (SIVsm) closely related to HIV-. Nature :-. 1. Johnson, J. E., W. Rodgers, and J. K. Rose. 1. A plasma membrane localization signal in the HIV-1 envelope cytoplasmic domain prevents localization at sites of vesicular stomatitis virus budding and incorporation into VSV virions. Virology 1:-. 1. Johnson, J. E., M. J. Schnell, L. Buonocore, and J. K. Rose. 1. Specific targeting to CD+ cells of recombinant vesicular stomatitis viruses encoding human immunodeficiency virus envelope proteins. J Virol 1: Johnson, P. R., B. C. Schnepp, M. J. Connell, D. Rohne, S. Robinson, G. R. Krivulka, C. I. Lord, R. Zinn, D. C. Montefiori, N. L. Letvin, and K. R. Clark. 00. Novel adenoassociated virus vector vaccine restricts replication of simian immunodeficiency virus in macaques. J Virol :-. 1. Johnston, M. I., and A. S. Fauci. 00. An HIV vaccine--challenges and prospects. N Engl J Med : Johnston, R. E., P. R. Johnson, M. J. Connell, D. C. Montefiori, A. West, M. L. Collier, C. Cecil, R. Swanstrom, J. A. Frelinger, and N. L. Davis. 00. Vaccination of macaques with SIV immunogens delivered by Venezuelan equine encephalitis virus replicon particle vectors followed by a mucosal challenge with SIVsmE0. Vaccine :-. 0. Karlsson, G. B., and P. Liljestrom. 00. Delivery and expression of heterologous genes in mammalian cells using self-replicating alphavirus vectors. Methods Mol Biol :-. 1. Keele, B. F., E. E. Giorgi, J. F. Salazar-Gonzalez, J. M. Decker, K. T. Pham, M. G. Salazar, C. Sun, T. Grayson, S. Wang, H. Li, X. Wei, C. Jiang, J. L. Kirchherr, F. Gao, J. A. Anderson, L. H. Ping, R. Swanstrom, G. D. Tomaras, W. A. Blattner, P. A. Goepfert, J. M. Kilby, M. S. Saag, E. L. Delwart, M. P. Busch, M. S. Cohen, D. C. Montefiori, B. F. Haynes, B. Gaschen, G. S. Athreya, H. Y. Lee, N. Wood, C. Seoighe, A. S. Perelson, T. Bhattacharya, B. T. Korber, B. H. Hahn, and G. M. Shaw. 00. Identification and characterization of transmitted and early founder virus envelopes in primary HIV-1 infection. Proc Natl Acad Sci U S A :-.. Keele, B. F., H. Li, G. H. Learn, P. Hraber, E. E. Giorgi, T. Grayson, C. Sun, Y. Chen, W. W. Yeh, N. L. Letvin, J. R. Mascola, G. J. Nabel, B. F. Haynes, T. Bhattacharya, A. S. Perelson, B. T. Korber, B. H. Hahn, and G. M. Shaw. 00. Low-dose rectal inoculation of rhesus macaques by SIVsmE0 or SIVmac1 recapitulates human mucosal infection by HIV-1. J Exp Med 0:1-.

25 Kim, E. Y., R. S. Veazey, R. Zahn, K. J. McEvers, S. H. Baumeister, G. J. Foster, M. D. Rett, M. H. Newberg, M. J. Kuroda, E. P. Rieber, M. Piatak, Jr., J. D. Lifson, N. L. Letvin, S. M. Wolinsky, and J. E. Schmitz. 00. Contribution of CD+ T cells to containment of viral replication and emergence of mutations in Mamu-A*01-restricted epitopes in Simian immunodeficiency virus-infected rhesus monkeys. J Virol :1-.. Kirmaier, A., F. Wu, R. M. Newman, L. R. Hall, J. S. Morgan, S. O'Connor, P. A. Marx, M. Meythaler, S. Goldstein, A. Buckler-White, A. Kaur, V. M. Hirsch, and W. E. Johnson. 0. TRIM suppresses cross-species transmission of a primate immunodeficiency virus and selects for emergence of resistant variants in the new species. PLoS Biol.. Lawson, N. D., E. A. Stillman, M. A. Whitt, and J. K. Rose. 1. Recombinant vesicular stomatitis viruses from DNA. Proc Natl Acad Sci U S A :-1.. Letvin, N. L., J. R. Mascola, Y. Sun, D. A. Gorgone, A. P. Buzby, L. Xu, Z. Y. Yang, B. Chakrabarti, S. S. Rao, J. E. Schmitz, D. C. Montefiori, B. R. Barker, F. L. Bookstein, and G. J. Nabel. 00. Preserved CD+ central memory T cells and survival in vaccinated SIV-challenged monkeys. Science 1:10-.. Li, M., F. Gao, J. R. Mascola, L. Stamatatos, V. R. Polonis, M. Koutsoukos, G. Voss, P. Goepfert, P. Gilbert, K. M. Greene, M. Bilska, D. L. Kothe, J. F. Salazar-Gonzalez, X. Wei, J. M. Decker, B. H. Hahn, and D. C. Montefiori. 00. Human immunodeficiency virus type 1 env clones from acute and early subtype B infections for standardized assessments of vaccine-elicited neutralizing antibodies. J Virol :-.. Li, Q., L. Duan, J. D. Estes, Z. M. Ma, T. Rourke, Y. Wang, C. Reilly, J. Carlis, C. J. Miller, and A. T. Haase. 00. Peak SIV replication in resting memory CD+ T cells depletes gut lamina propria CD+ T cells. Nature :-.. Li, Q., P. J. Skinner, S. J. Ha, L. Duan, T. L. Mattila, A. Hage, C. White, D. L. Barber, L. O'Mara, P. J. Southern, C. S. Reilly, J. V. Carlis, C. J. Miller, R. Ahmed, and A. T. Haase. 00. Visualizing antigen-specific and infected cells in situ predicts outcomes in early viral infection. Science : Lifson, J. D., J. L. Rossio, M. Piatak, Jr., T. Parks, L. Li, R. Kiser, V. Coalter, B. Fisher, B. M. Flynn, S. Czajak, V. M. Hirsch, K. A. Reimann, J. E. Schmitz, J. Ghrayeb, N. Bischofberger, M. A. Nowak, R. C. Desrosiers, and D. Wodarz Role of CD(+) lymphocytes in control of simian immunodeficiency virus infection and resistance to rechallenge after transient early antiretroviral treatment. J Virol : Liu, J., K. L. O'Brien, D. M. Lynch, N. L. Simmons, A. La Porte, A. M. Riggs, P. Abbink, R. T. Coffey, L. E. Grandpre, M. S. Seaman, G. Landucci, D. N. Forthal, D. C. Montefiori, A. Carville, K. G. Mansfield, M. J. Havenga, M. G. Pau, J. Goudsmit, and D. H. Barouch. 00. Immune control of an SIV challenge by a T-cell-based vaccine in rhesus monkeys. Nature :-1.. Metzner, K. J., X. Jin, F. V. Lee, A. Gettie, D. E. Bauer, M. Di Mascio, A. S. Perelson, P. A. Marx, D. D. Ho, L. G. Kostrikis, and R. I. Connor Effects of in vivo CD(+) T cell depletion on virus replication in rhesus macaques immunized with a live, attenuated simian immunodeficiency virus vaccine. J Exp Med 11: Montefiori, D. C. 00. Evaluating neutralizing antibodies against HIV, SIV, and SHIV in luciferase reporter gene assays. Curr Protoc Immunol Chapter 1:Unit 1.. Nilsson, C., B. Makitalo, P. Berglund, F. Bex, P. Liljestrom, G. Sutter, V. Erfle, P. ten Haaft, J. Heeney, G. Biberfeld, and R. Thorstensson Enhanced simian

26 immunodeficiency virus-specific immune responses in macaques induced by priming with recombinant Semliki Forest virus and boosting with modified vaccinia virus Ankara. Vaccine 1:-.. O'Connor, D. H., B. R. Mothe, J. T. Weinfurter, S. Fuenger, W. M. Rehrauer, P. Jing, R. R. Rudersdorf, M. E. Liebl, K. Krebs, J. Vasquez, E. Dodds, J. Loffredo, S. Martin, A. B. McDermott, T. M. Allen, C. Wang, G. G. Doxiadis, D. C. Montefiori, A. Hughes, D. R. Burton, D. B. Allison, S. M. Wolinsky, R. Bontrop, L. J. Picker, and D. I. Watkins. 00. Major histocompatibility complex class I alleles associated with slow simian immunodeficiency virus disease progression bind epitopes recognized by dominant acute-phase cytotoxic-t-lymphocyte responses. J Virol :0-0.. Ourmanov, I., M. Bilska, V. M. Hirsch, and D. C. Montefiori Recombinant modified vaccinia virus ankara expressing the surface gp10 of simian immunodeficiency virus (SIV) primes for a rapid neutralizing antibody response to SIV infection in macaques. J Virol :0-.. Ourmanov, I., T. Kuwata, R. Goeken, S. Goldstein, R. Iyengar, A. Buckler-White, B. Lafont, and V. M. Hirsch. 00. Improved survival in rhesus macaques immunized with modified vaccinia virus Ankara recombinants expressing simian immunodeficiency virus envelope correlates with reduction in memory CD+ T-cell loss and higher titers of neutralizing antibody. J Virol :-00.. Pitisuttithum, P., P. Gilbert, M. Gurwith, W. Heyward, M. Martin, F. van Griensven, D. Hu, J. W. Tappero, and K. Choopanya. 00. Randomized, double-blind, placebocontrolled efficacy trial of a bivalent recombinant glycoprotein 10 HIV-1 vaccine among injection drug users in Bangkok, Thailand. J Infect Dis 1:-1.. Priddy, F. H., D. Brown, J. Kublin, K. Monahan, D. P. Wright, J. Lalezari, S. Santiago, M. Marmor, M. Lally, R. M. Novak, S. J. Brown, P. Kulkarni, S. A. Dubey, L. S. Kierstead, D. R. Casimiro, R. Mogg, M. J. DiNubile, J. W. Shiver, R. Y. Leavitt, M. N. Robertson, D. V. Mehrotra, and E. Quirk. 00. Safety and immunogenicity of a replication-incompetent adenovirus type HIV-1 clade B gag/pol/nef vaccine in healthy adults. Clin Infect Dis : Ramsburg, E., N. F. Rose, P. A. Marx, M. Mefford, D. F. Nixon, W. J. Moretto, D. Montefiori, P. Earl, B. Moss, and J. K. Rose. 00. Highly effective control of an AIDS virus challenge in macaques by using vesicular stomatitis virus and modified vaccinia virus Ankara vaccine vectors in a single-boost protocol. J Virol : Rerks-Ngarm, S., P. Pitisuttithum, S. Nitayaphan, J. Kaewkungwal, J. Chiu, R. Paris, N. Premsri, C. Namwat, M. de Souza, E. Adams, M. Benenson, S. Gurunathan, J. Tartaglia, J. G. McNeil, D. P. Francis, D. Stablein, D. L. Birx, S. Chunsuttiwat, C. Khamboonruang, P. Thongcharoen, M. L. Robb, N. L. Michael, P. Kunasol, and J. H. Kim. 00. Vaccination with ALVAC and AIDSVAX to prevent HIV-1 infection in Thailand. N Engl J Med 1:0-0.. Reynolds, M. R., A. M. Weiler, S. M. Piaskowski, H. L. Kolar, A. J. Hessell, M. Weiker, K. L. Weisgrau, E. J. Leon, W. E. Rogers, R. Makowsky, A. B. McDermott, R. Boyle, N. A. Wilson, D. B. Allison, D. R. Burton, W. C. Koff, and D. I. Watkins. 0. Macaques vaccinated with simian immunodeficiency virus SIVmacDelta nef delay acquisition and control replication after repeated low-dose heterologous SIV challenge. J Virol :10-.