Early Diagnosis of HIV-1: Infected Infants in Brazil using Nested-PCR

Transcription

1 Early Diagnosis of HIV-1: Infected Infants in Brazil using Nested-PCR by R. M. Molina, A. D. C. Toro, M. T. N. Silva, M. M. S. Vilela, and S. C. B. Costa Universidade Estadual de Campinas, Unicamp, São Paulo, Brazil Summary The polymerase chain reaction (PCR) has been the most promising test for HIV-1 early diagnosis in infants suspected of perinatal transmission. The first and second reactions of the amplification in 41 infants (under 18 months old) suspected of HIV-1 perinatal infection, were standardized and carried out in the present study. The first and the second PCR were carried out with the sets of primers JA4 JA7, JA9 JA12, JA13 JA16, and JA17 JA20 for the first reaction of amplification (outer primers) and JA5 JA6, JA10 JA11, JA14 JA15, and JA18 JA19 for the second reaction of amplification (inner primers), resulting in amplification of 131, 341, 172, and 129 pb, respectively. From 41 patients analysed, 12 patients presented positive to HIV-1 infection by PCR. The gag, env (region 1), and pol regions presented a greater sensitivity. The first and the second reactions of the amplification were performed with the same concentration of MgCl 2 for all sets of primers. The results agree with several studies that affirm that the PCR is the indicated method for HIV-1 early diagnosis in infants suspected of perinatal infection. Introduction The ELISA (Enzyme Linked Immunosorbent Assay) is one of the most utilized tests for the diagnosis of HIV-1 infection and is currently used for the detection of specific antibodies against HIV-1. However, this test can present a false-positive result in patients with perinatal contamination since it does not discriminate between the IgG produced by the mother and transferred to the child and those produced by the fetus. The maternal IgG can persist until the child is nearly 18 months old. 1,2 Another complementary test is the Western blot, 3 but this also detects antibodies of the IgG class. Research on the IgA and IgM anti-hiv antibodies is useful, 4 since both of them cannot pass through the placenta. Thus, the presence of such antibodies in the serum can indicate infection in the child. 5 The detection of the p24 antigen can also be utilized. This method presents a sensitivity of 18 per cent in the diagnosis of HIV-1 in the neonatal period. 6 Acknowledgements The authors thank the team from the Laboratório de Diagnóstico de Doenças Infecciosas por Métodos de Biologia Molecular da Faculdade de ciências Médicas and the nursing staff responsible for the material collection of the Universidade Estadual de Campinas, SP Brasil. Correspondence: S. C. B. Costa, Disciplina de Medicina Interna, Departamento de Clínica Médica, FCM, Unicamp Campinas, SP Brazil. Fax: <Costa@fcm.unicamp.br>. The culture of HIV is a technique sensitive to the detection of HIV in infants that are suspected of being infected perinatally. However, it is not used routinely as it involves technical difficulties that require special safe laboratory conditions, 7 and because it takes approximately 2 4 weeks for a definitive result of the test to be obtained. 8 The PCR allows the detection of HIV infection before serum conversion, making possible an early diagnosis in children. 9 The nested-pcr has been applied in order to increase even more the specification of the method. The technique consists of a second PCR, with the utilization of internal primer pairs to the first reaction of the amplification. 1 The purpose of this study was the early detection of HIV-1 infection in peripheral blood of infants born to viral-infected mothers who were being followed at the Immunodeficiency Clinic at The State University of Campinas, São Paulo, Brazil. A further aim was the evaluation of the specification and sensitivity of the method compared with the ELISA carried out in children over 18 months old. Materials and Methods Informed consent was obtained from all patients and the protocol was approved by the Hospital s Ethics Committee. Patients Forty-one patients under 18 months old (range months) born to HIV-1 infected mothers, were studied in order to obtain the specificity and Journal of Tropical Pediatrics, Vol. 50, No. 2 Oxford University Press 2004; all rights reserved 107

2 TABLE 1 Sequence of the primers used in PCR and nested-pcr and its localization in HIV-1 genome and in the human genome. The primers that flank the genetic fragments of HIV-1 were described by Albert and Fenyo 10 and synthesized by GIBCO, BRL, Life Technologies, USA Primers Sequence of nucleotides (5 3 ) Gene and localization JA4 GAAGGCTTTCAGCCCAGAAG gag ( ) a JA5 ACCATCAATGAGGAAGCTGC gag ( ) b JA6 TATTTGTTCCTGAAGGGTAC gag ( ) b JA7 TCTCCTACTGGGATAGGTGG gag ( ) a JA9 CACAGTACAATGTACACATG env ( ) a JA10 AAATGGCAGTCTAGCAGAAG env ( ) b JA11 ACAATTTCTGGGTCCCCTCC env ( ) b JA12 ACAGTAGAAAAATTCCCCTC env ( ) a JA13 TTCCTTGGGTTCTTGGGAGC env ( ) a JA14 GCAGCAGGAAGCACTATGGG env ( ) b JA15 CCAGGACTCTTGCCTGGAGC env ( ) b JA16 AGGTATCTTTCCACAGCCAG env ( ) a JA17 TACAGGAGCAGATGATACAAG pol ( ) a JA18 GGAAACCAAAAATGATAGGG pol ( ) b JA19 ATTATGTTGACAGGTGTAGG pol ( ) b JA20 CCTGGCTTTATTTTTACTGG pol ( ) a a Primers used in the first PCR (outer primers). b Primers used in the Nested-PCR (inner primers). The set of primers (JA9, JA10, JA11, JA12) was called primers of HIV-1gene env (region 1) and the set of primers (JA13, JA14, JA15, JA16) was designated primers of HIV-1 gene env (region 2) in order to facilitate the quotations. sensitivity of the nested-pcr to HIV-1 diagnosis in these patients. Blood samples Four to five milliliters of peripheral blood was collected through venous puncture into sterile test tubes containing EDTA as anticoagulant. Two collections per patient studied were performed at intervals of approximately 3 months between each collection to observe the validity of the results through both collections. DNA extraction Plasma was eliminated by centrifugation at 2500 r.p.m. for 20 min. The red blood cells were then treated with NH 4 Cl at M (five-fold the cell volume) and NH 4 HCO 3 at 0.01 M (0.5-fold the cell volume). The leukocytes went through two washing stages. The first was with Tris-HCl 10 mm (ph = 7.6); KCl 10 mm; MgCl 2 10 mm and EDTA 20 mm and 50 µl of Nonidet p40. The second washing was carried out with 0.8 ml of solution containing Tris- HCl 10 mm (ph = 7.6), KCl 10 mm, NaCl 0.4 M, MgCl 2 10 mm, EDTA 2 mm, and ml of duodecil sodium sulfate (SDS) 20 per cent, incubated for 40 min at a temperature of 56 C. After incubation, 0.3 ml of NaCl 5 M was added. The DNA was precipitated with the addition of 4 ml of absolute ethanol iced and solubilized in distilled, deionized, and sterile water, and kept for 8 h at 37 C. The DNA concentration was evaluated in a spectrophotometer, with an optical density value for a 260 nm wave. Polymerase Chain Reaction (PCR) PCR was performed in two stages; the first with pairs of outer primers and the second with inner primers. The reaction was conducted in Eppendorf tubes, with a capacity of 0.6 ml, and a total volume of 20 µl to the reaction of the amplification. The mixture for each reaction contained 0.4 µl of DNA, 50 mm of KCl, 10 mm of Tris-HCl (ph = 8.4), 2.5 mm of MgCl 2, 0.1 mm of each primer (JA4 JA7, JA9 JA12, JA13 JA16, and JA17 JA20) (Table 1), 200 mm of the deoxyribonucleic mixture dntps (datp, dgtp, dctp, dttp) (GIBCO-BRL), 2.0 U of Taq DNA polymerase (GIBCO-BRL) and 30 µl of mineral oil (Sigma). The target DNA was amplified using a Cetus (Perkin-Elmer Cetus, Norwalk, Conn) thermal cycler. The reaction was initially performed with one cycle at 94 C for 5 min, and after that by 30 cycles of amplification, each cycle having the following conditions: 94 C for 30 s, 57 C for 30 s, 75 C for 30 s. This was followed by a cycle of 75 C for 5 min. A volume, 0.4 µl, of the product from the first PCR (performed with outer primers to each viral region) was then transferred into a second test tube containing 19.6 µl of the same medium of reaction described in the first reaction, but with the pair of inner primers (JA5 and JA6, JA10 and JA11, JA14 and JA15, JA18 and JA19). Symptomatic 108 Journal of Tropical Pediatrics Vol. 50, No. 2

3 TABLE 2 Calculation of the sensitivity and specificity of the nested-pcr to each viral gene tested Gene gag env (1) env (2) pol 1st C sensitivity 100% 100% 100% 100% 1st C specificity 100% 100% 100% 100% 2nd C sensitivity 100% 100% 83.33% 100% 2nd C specificity 100% 100% 100% 100% Total 41 patients (100%) 1st C, the first collection of peripheral blood. 2nd C, the second collection of peripheral blood. patients known as HIV-1 infected were used as a positive control of the reaction. Patients who proved not to be HIV-1 infected were used as a negative control. Primers that flank the human gene of the β- globin were used as the inner control of the reaction. 16 The product of the second PCR (8 µl) was analysed through agarose gel electrophoresis 2.0 per cent stained with ethidium bromide. Hybridization Six samples were hybridized with the SK38 probe (ATAATCCACCTATCCCAGTAGGAGA). 11 The PCR that proceeded the hybridization was performed with the JA4 and JA7 primers. DNA sequencing Four samples were directly sequenced by the Sanger method 12 to the four viral areas tested in this study, to posterior comparison among the genetic fragments obtained by the nested-pcr, with HIV-1 sequences described in the GenBank. The Thermo Sequenase radiolabeled terminator cycle sequencing kit was used for the sequencing reaction (Amersham Life Science, Cleveland, OH). Informed consent was obtained from all patients and the protocol was approved by the Hospital s Ethics Committee. Statistical analysis The SAS (Statistical Analysis System SAS Institute 1996, Cary North Carolina) program V (6.12) was used for the calculation of the sensitivity and the specification of the nested-pcr for patients in this study. Results A double reaction of the amplification carried out initially with pairs of outer primers and then with pairs of inner primers demonstrated high sensitivity and specificity to the detection of DNA HIV-1 sequences in cell samples taken from the peripheral blood. The sets of primers belonging to the gag, env (region 1), and pol of HIV-1 genes showed a greater sensitivity in the detection of HIV-1 sequences when compared with those from the gene env (region 2) in the second collection of peripheral blood (Table 2). The calculation of the nested-pcr sensitivity and specificity was performed by comparison of the results from the reactions of the amplification with the results obtained through the ELISA. Two ELISA results were taken when each patient was over 18 months old. Those patients that presented amplification of the fragment through the nested- PCR in at least three of the four HIV-1 viral regions tested (genes gag, env (two regions), and pol) in each collection of peripheral blood and positive serology by the immunoenzymatic ELISA after they were over 18 months old, were considered as positive patients. Those that presented negative nested-pcr to the viral regions and negative ELISA after they were 18 months old were considered as negative patients. The regions of HIV-1 genes selected for amplification through the nested-pcr, presented fragments of 131 bp, 341 bp, 172 pb, and 129 bp, respectively, to HIV-1 genes gag (primers JA4 JA7), env (region 1) (primers JA9 JA12), env (region 2) (primers JA13 JA16), and pol (primers JA17 JA20) (Figs 1 4). The nested-pcr was standardized and applied to patients being followed-up at the Hospital de Clínicas da Universidade Estadual de Campinas, to four regions of the HIV-1 gene (gag, env, and pol), with MgCl 2 (2.5 mm) to the four sets of primers (JA4 JA7, JA9 JA12, JA13 JA16, and JA17 JA20). The amplification with the set of primers that flank the region of the gene of the human β-globin (P3, P5, and 109) was performed together with the PCR and nested-pcr of the regions of HIV-1 genes gag, env, and pol. The product of the amplification, with the primers to the β-globin, presented 365 bp. There was agreement between the results, obtained by the nested-pcr, of the first and second collections of the peripheral blood performed in each patient in the study. Journal of Tropical Pediatrics Vol. 50, No

4 FIG. 1. The amplification of the 131 pb, corresponding of the set of primers (JA4, JA5, JA6, and JA7), belonging to HIV-1 gene gag. P+, positive patient; P-, negative patient; L, molecular weight. FIG. 3. The amplification of the 172 pb, corresponding of the set of primers (JA13, JA14, JA15, and JA16), belonging to HIV-1 gene env (region 2). P+, positive patient; P-, negative patient; L, molecular weight. The rate of HIV-infected children in the studied population was 29.3 per cent. FIG. 2. The amplification of the 341 pb, corresponding of the set of primers (JA9, JA10, JA11, and JA12), belonging to HIV-1 gene env (region 1). P+, positive patient; P-, negative patient; L, molecular weight. Discussion An effective test for the early diagnosis of HIV-1 in infants born to HIV-positive mothers, is essential to be able to: begin early antiviral therapy; utilize a prophylaxis against opportunist infections; change the natural history of the disease; begin a treatment against bacterial 13 or viral 14,15 infections; avoid unnecessary procedures in patients that are not infected by the virus; reduce the anxiety for families of not knowing if a child is infected or not. The PCR described by Saiki, et al., 16 is a technique used to amplify specific fragments of DNA in vitro. It can be so sensitive as to detect a single molecule of DNA. 10 PCR has been utilized for the diagnosis of HIV-1 infection 17,18 during childhood since The method of diagnosis of HIV-1 culture has demonstrated sensitivity similar to that obtained by PCR. However, it is a complex and costly method and it takes 2 4 weeks to obtain a definitive result of the viral culture. 8 A study performed by Dunn, et al., 20 identified 38 per cent of neonates infected by HIV-1, with positive PCR within 48 h of birth. No substantial change was 110 Journal of Tropical Pediatrics Vol. 50, No. 2

5 FIG. 4. The amplification of the 129 pb, corresponding of the set of primers (JA17, JA18, JA19, and JA20), belonging to HIV-1 gene pol. P+, positive patient; P-, negative patient; P?, indeterminant result; L, molecular weight. observed in the sensitivity of the PCR during the first week of the child s life, although the sensitivity increased rapidly during the second week of the patient s life, rising to 93 per cent. 8 Another study by Kuhn, et al. 21 showed a sensitivity that surpassed 95 per cent in 39-day-old children, although the sensitivity of the PCR at birth was 22 per cent, increasing to 42 per cent when the children were 4 days old, 73 per cent when they were 14 days old, and 90 per cent when they were 21 days old. In this study the results showed high sensitivity and specificity (100 per cent) in the detection of HIV-1 infection in the three viral genes, showing a decrease in the sensitivity (83.33 per cent) in only one of the two collections of the peripheral blood (Table 2) in the region of the HIV-1 env gene. The set of primers used for the amplification of that region (JA13, JA14, JA15, JA16) had been designed to amplify the fragment belonging to the region with the largest diversity of HIV-1, that correspond to the V3 strap 22 of the glycoprotein of the viral envelope. 23,24 The nested-pcr (second PCR) re-amplified an inner fragment of the product obtained from the first PCR, 10 in order to amplify the specificity of the PCR test. The nested-pcr was used because it is a method that does not use radioactive material, it is less complex and much more rapid when compared to hybridization, and it gives high sensitivity. A potential problem with the high sensitivity of the PCR is the risk of contamination of the samples or reagents with the DNA target, where it can be amplified from a small quantity, and can subsequently generate a false-positive result. 10 Security rules were used in this study in order to reduce the risk of contamination during the stages of the PCR, thus minimizing its occurrence during the performance of the method. However, there were cases of contamination where the method had to be reperformed. Another difficulty was the presence of unspecified bands, although this was minimized during the standardization of the technique. The temperature of the pairs of primers with DNA at 57ºC and the concentration of MgC1 2 at 2.5 mm minimized the problem. The amplification by the nested-pcr in only one or two areas of the tested virus did not occur in any of the patients. The minimum obtained for positive patients were three viral regions amplified from the four tested by nested-pcr. The standardization of a program (94ºC for 5 min for 1 cycle; 94ºC for 30 min for 30 cycles; 57ºC for 30 min for 30 cycles; 75ºC for 30 min for 30 cycles; and 75ºC for 5 min for 1 cycle) was possible in this study, for the two steps of the PCR. The concentration of the MgCl 2 (2.5 mm) for all the sets of primers used in the two stages of the PCR was also standardized in contrast to Albert and Fenyö s study 10 that used variations in the temperature of the pairs for the four sets of primers used (50 C for the primers JA9 and JA12, JA10 and JA11, JA14 and JA15; 47 C for the sets JA4 and JA7; 45 C for JA13 and JA16; and 41 C for JA5 and JA6, JA17 and JA20, JA18 and JA19) and in the concentrations of MgCl 2 (7.0 mm for the primers JA4 and JA7, JA13 and JA16, JA17 and JA20; 4.0 mm for JA9 and JA12, JA14 and JA15; 3.0 mm for JA5 and JA6, JA10 and JA11, JA18 and JA19). The nested-pcr was performed with the primers that flank the region of the human β-globin gene as an inner control of the reaction in each patient s second collection, in order to confirm the reliability of the positive or negative state of HIV-1 infection detected through PCR. The primers of the β-globin gene worked efficiently. Hybridization with SK38/SK39 probes was also performed, in order to compare the results obtained by the nested-pcr with those observed by another method with high sensitivity and specificity. 23 The results of hybridization were in agreement with those obtained by the nested-pcr, through the use of primers JA4 JA8, JA9 JA12, JA13 JA16, and JA17 JA20. The direct sequence, by Sanger, et al. s method, 12 of HIV-1 fragments with primers JA6, JA10, JA15, Journal of Tropical Pediatrics Vol. 50, No

6 and JA19 was also performed in this study, so that it could be confirmed that the sequences amplified by the nested-pcr really belonged to HIV-1. The results of the sequencing showed an analogy between the sequences of HIV-1 fragments obtained by the test with those already described and inserted at the GenBank. The comparison and agreement of the results from the nested-pcr with those obtained from ELISA for patients over 18 months old, plus the confirmation by hybridization with probes marked with radioactive isotope and sequence gene assay, demonstrate that the PCR test is reliable. The results in this study confirm that the tests for the detection of the antibodies of the IgG anti-hiv class cannot be used as reliable tests to indicate infection in children before they are 18 months old. 25 On the other hand the PCR and the viral culture are probably the most sensitive and specific assays for the detection of HIV-1 in children born to mothers infected by the virus. 26,27 In all, the data obtained in this work, allied to those in the literature, indicate that the use of the nested-pcr is suitable for the early diagnosis of HIV infection in children born to mothers infected by the virus. Conclusions A nested-pcr test was standardized and applied to the early diagnosis of the HIV virus in the peripheral blood of infants born to HIV-infected mothers, who were being followed at the Ambulatório de Imunodeficiência Clínica do Hospital das Clínicas da UNICAMP. The nested-pcr was standardized for four regions of the HIV-1 gene (gag, env, and pol), with the same MgCl 2 concentration for the four sets of the primers used (JA4 JA7, JA9 JA12, JA13 JA16 and JA17 JA20), and with a program (temperatures, periods, and number of cycles) standardized for the first and second reactions of the amplification. The results obtained by the nested-pcr concur with studies that show PCR as an indicated method for the early diagnosis of HIV-1 in children with the suspicion of perinatal infection, when compared to the serum method ELISA. References 1. Moodley D, Bobat RA, Coutsoudis A, Coovadia HM. Predicting perinatal human immunodeficiency virus infection by antibody patterns. Pediatr Infect Dis J 1995; 14: Kellogg DE, Kwok S. Detection of human immunodeficiency virus. In: Innis MA, Gelfand, AH, Sninsky JJ, White TJ (eds), PCR Protocols: A Guide to Methods and Applications, 1st edn. Academic Press, Inc., California, 1990; Carvalho MB, Hamerschlak N, Vaz RS, Ferreira OCJ. Risk factor analysis and serological diagnosis of HIV-1/HIV-2 infection in a Brazilian blood donor population: validation of the World Health Organization strategy for HIV testing. AIDS 1996; 10: Steketee RW, Abrams EJ, Thea DM, et al. The New York City Perinatal HIV Transmission Collaborative Study. Early detection of perinatal human immunodeficiency virus (HIV) type 1 infection using HIV RNA amplification and detection. J Infect Dis 1997; 175: Husson RN, Comeau AM, Hoff R. Diagnosis of human immunodeficiency virus infection in infants and children. Pediatrics 1990; 86: Zöllner B, Feucht H-H, Mattner UM, Helling-Giese G, Baumgartner EM, Laufs R. Better prediction of vertical HIV-1 transmission from maternal blood at delivery compared with cord blood samples. AIDS 1996; 10: Edwards JR, Ulrich PP, Weintrub PS, et al. Polymerase chain reaction compared with concurrent viral cultures for rapid identification of human immunodeficiency virus infection among high-risk infants and children. J Pediatr 1989; 115: Centers for Disease Control. Guidelines for the use of antiretroviral agents in pediatric HIV infection. MMWR 1998; 47: Williams P, Simmonds P, Yap PL, et al. The polymerase chain reaction in the diagnosis of vertically transmitted HIV infection. AIDS 1990; 4: Albert J, Fenyö EM. Simple, sensitive and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J Clin Microbiol 1990; 28: Sanchez-Pescador R, Power MD, Barr PJ, et al. Nucleotide sequence and expression of AIDS-associated retrovirus (ARV- 2). Science 1985; 227: Sanger F, Niklen S, Coulson AR. DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA 1977; 74: Pietrella D, Monari C, Retini C, Palazzetti B, Bistoni F, Vecchiarelli A. Human immunodeficiency virus type 1 envelope protein gp120 impairs intracellular antifungal mechanisms in human monocytes. J Infect Dis 1998; 177: Forbes BA. Acquisition of cytomegalovirus infection. Clin Microbiol Ver 1989; 2: Stewart JA, Reef SE, Pellett PE, Corey L, Whitley RJ. Herpesvirus infections in persons infected with human immunodeficiency virus. Clin Infect Dis 1995; 21 (Suppl 1): S Saiki RK, Scharf S, Faloona F, et al. Enzymatic amplification of β-globin genomic sequences and restriction site analysis for diagnosis of sickle cell and anemia. Science 1985; 230: Slavik T, Wolfaardt M, Zyl HV, Simson IW. Retrospective determination of HIV-1 status by a PCR method on paraffin wax embedded sections. J Clin Pathol 1995; 48: Zazzi M, Romano L, Catucci M, et al. Low human immunodeficiency virus type 1 (HIV-1) DNA burden as a major cause for failure to detect HIV-1 DNA in clinical specimens by PCR. J Clin Microbiol 1995; 33: Clewley JP. The polymerase chain reaction, a review of the practical limitations for human immunodeficiency virus diagnosis. J Virol Meth 1989; 25: Dunn DT, Brandt CD, Krivine A, et al. The sensitivity of HIV- 1 DNA polymerase chain reaction in the neonatal period and the relative contributions of intra-uterine and intra-partum transmission. AIDS 1995; 9: F7-F Kuhn L, Abrams EJ, Chinchilla M, Tsai W-Y, Thea DM, and The New York City Perinatal HIV Transmission Collaborative Study Group. Sensitivity of HIV-1 DNA polymerase chain reaction in the neonatal period. AIDS 1996; 10: Journal of Tropical Pediatrics Vol. 50, No. 2

7 22. Robertson CA, Mok JYQ, Froebel KS, et al. Maternal antibodies to gp120 V2 sequence do not correlate with protection against vertical transmission of human immunodeficiency virus. J Infect Dis 1992; 166: Plantier JC, Pogam SL, Poisson F, Buzelay L, Lejeune B, Barin F. Extent of antigenic diversity in the V3 region of the surface glycoprotein, gp120, of human immunodeficiency virus type 1 group M and consequenses for serotyping. J Virol 1998; 72: Halapi E, Leitner T, Jansson M, et al. Correlation between HIV sequence evolution, specific immune response and clinical outcome in vertically infected infants. AIDS 1997; 11: Giri AA, Lillo FB, Madermott JL, et al. Detcction of HIV-1 sequences in children using radioactive and colorimetric polymerase chain reactions. J Med Virol 1994; 42: Domachowske JB. Pediatric human immunodeficiency virus infection. Clin Microbiol Rev 1996; 9: Centers for Disease Control. Revised classification system for human immunodeficiency virus infection in children less than 13 years of age. MMWR 1994; 43: Laure F, Rouzioux C, Veber F, et al. Detection of HIV-1 DNA in infants and children by means of the polymerase chain reaction. Lancet 1988; 3: Journal of Tropical Pediatrics Vol. 50, No