Unusual Distribution of Mutations Associated with Serial Bottleneck Passages of Human Immunodeficiency Virus Type 1

Transcription

1 JOURNAL OF VIROLOGY, Oct. 2000, p Vol. 74, No X/00/$ Copyright 2000, American Society for Microbiology. All Rights Reserved. Unusual Distribution of Mutations Associated with Serial Bottleneck Passages of Human Immunodeficiency Virus Type 1 ELOISA YUSTE, 1 CECILIO LÓPEZ-GALÍNDEZ, 2 AND ESTEBAN DOMINGO 1 * Centro de Biología Molecular Severo Ochoa, Universidad Autónoma de Madrid, Cantoblanco, Madrid, 1 and Centro Nacional de Biología Fundamental, Instituto de Salud Carlos III, Majadahonda, Madrid, 2 Spain Received 8 May 2000/Accepted 18 July 2000 Repeated bottleneck passages result in fitness losses of RNA viruses. In the case of human immunodeficiency virus type 1 (HIV-1), decreases in fitness after a limited number of plaque-to-plaque transfers in MT-4 cells were very drastic. Here we report an analysis of entire genomic nucleotide sequences of four HIV-1 clones derived from the same HIV-1 isolate and their low-fitness progeny following 7 to 15 plaque-to-plaque passages. Clones accumulated 4 to 28 mutations per genome, with dominance of A G and G A transitions (57% of all mutations) and 49% nonsynonymous replacements. One clone but not three sibling clones showed an overabundance of G A transitions, evidencing the highly stochastic nature of some types of mutational bias. The distribution of mutations along the genome was very unusual in that mutation frequencies in gag were threefold higher than in env. Particularly striking was the complete absence of replacements in the V3 loop of gp120, confirmed with partial nucleotide sequences of additional HIV-1 clones subjected to repeated bottleneck passages. The analyses revealed several amino acid replacements that have not been previously recorded among natural HIV-1 isolates and illustrate how evolution of an RNA virus genome, with regard to constant and variable regions, can be profoundly modified by alterations in population dynamics. Retroviruses and in particular human immunodeficiency virus type 1 (HIV-1) mutate and recombine at high rates (14, 15, 39, 55, 60, 61, 70, 74). Rapid genetic variation, together with the short replication times of HIV-1 (8), generates complex and highly dynamic mutant swarms termed viral quasispecies (10, 18 22, 42, 66, 69). The mutant spectra of viral quasispecies constitute reservoirs of phenotypically relevant variants, as evidenced by the nonsyncytial-to-syncytial switch in infected individuals or the rapid selection of antibody-, cytotoxic-t-cell-, or inhibitor-resistant mutants in viral populations in vivo (2 4, 32, 33, 36, 37, 41, 46, 47, 56, 59, 65). Although most individual mutations in mutant swarms of RNA viruses may not be of immediate or even long-term selective value for the virus (63), evolution of viral quasispecies can be adaptive and may exert an influence in viral pathogenesis (26, 34, 76; reviews in 10, 28, 29). The adaptive potential of viral quasispecies is manifested by quantitatively important fitness variations as viruses evolve in constant or changing environments (for recent examples and reviews, see 10, 11, 13, 31, 48, 50 52, 75). Large-population passages under a constant environment tend to produce fitness gains in viral populations (10, 11, 13, 25, 51, 52). In contrast, bottleneck events experimentally realized in an extreme case by serial plaque-to-plaque transfers of virus on cell monolayers often lead either to average fitness losses (6, 17, 24, 78) or to limitations of fitness gains (23, 51, 52). The decrease in fitness mediated by repeated bottlenecks has been interpreted as the result of an accentuation of Muller s ratchet effect (45). According to this model, asexual populations of organisms with a small population size will tend to incorporate deleterious mutations unless compensatory mechanisms such as recombination can restore mutation-free genomes (45). For RNA virus quasispecies, accumulation of * Corresponding author. Mailing address: Centro de Biología Molecular Severo Ochoa, Universidad Autónoma de Madrid, Cantoblanco, Madrid, Spain. Phone: Fax: edomingo@cbm.uam.es. deleterious mutations is expected from successive rounds of random sampling of genomes from the mutant spectrum (reviewed in 10, 11). In retroviruses, decreases in fitness as a result of serial bottleneck passages were first documented with HIV-1 following plaque-to-plaque passages on MT-4 cells (78). In this virus, fitness losses were unexpectedly drastic when compared with the fitness losses experienced by other RNA viruses, such as bacteriophage 6, vesicular stomatitis virus, or foot-andmouth disease virus (FMDV) subjected to similar passage regimens (6, 17, 24). Only 4 out of 10 HIV-1 clones could produce viable progeny after 15 plaque-to-plaque transfers, and 3 of the 4 survivors displayed important decreases in fitness (78). Very little is known about the numbers and types of mutations which accompany fitness decreases of RNA viruses when they are subjected to sequential bottleneck passages. In the case of the animal picornavirus pathogen FMDV, debilitated clones showed some unusual genetic lesions (infrequent or absent in populations evolved without intervening bottlenecks; 24, 25). Such lesions included mutations that resulted in amino acid replacements at internal sites of the viral capsid and a unique elongation of five adenylate residues which resulted in an internal polyadenylate tract of variable length preceding the second functional AUG initiation codon of the FMDV genome (24, 25). No information on genetic lesions associated with fitness losses in retroviral genomes is available. Here we report complete HIV-1 genomic sequences of HIV-1 clones subjected to plaque transfers that led to severe fitness losses. The results reveal a broad spectrum of mutations associated with fitness decrease and an unexpected distribution of mutations along the HIV-1 genome. MATERIALS AND METHODS HIV-1 clones. The origin and passage history of the biological clones of HIV-1 used in the present study have been previously described (78). Briefly, virus clones were isolated by plating a natural isolate of HIV-1, termed S61, on MT-4 cells. Virus populations D1, G1, I1, and K1 are from randomly chosen, individual plaques. After the first plating, viruses from individual plaques (in the range of 9546

2 VOL. 74, 2000 MUTATIONS AND BOTTLENECKS IN HIV each passaged clone relative to the corresponding initial clone showed that transitions were 2.8-fold more frequent than transversions and that A G and G A accounted for 20% and 36%, respectively, of all mutation types; nonsynonymous mutations represented 49% of the total; an insertion of one nucleotide was present in clone I15 (Table 2). Mutation frequencies varied up to sevenfold among lineages (range, 4.4 TABLE 1. Synthetic oligonucleotide primers employed for nucleotide sequence determination of the HIV-1 genome a Nucleotide sequence FIG. 1. Scheme of passages of HIV-1 clones subjected to plaque-to-plaque transfers in MT-4 cells. Clonal populations (HIV-1 isolated from individual plaques) are depicted as filled squares. The experimental procedures and the origins of natural HIV-1 isolate S61 and clones B1 to K1 are given in reference 78 and in Materials and Methods. HIV-1 clones are indicated by letters followed by a number which gives the total number of plaque-to-plaque transfers undergone by the clone. Infectious virus could not be rescued from viral populations B15, E13, G7, H13, and J15 as described in reference to 10 5 PFU) were diluted in 300 l of culture medium and plated on fresh MT-4 cells, and this process was repeated a number of times (Fig. 1). Plaques appeared 7 to 10 days after infection. Fitness of the clonal populations of HIV-1 was determined by growth-competition experiments in MT-4 cells, and populations were analyzed by the heteroduplex tracking assay as previously described (78). DNA extraction, PCR amplification, and nucleotide sequencing. DNA was extracted using an Instagene purification matrix (Bio-Rad) according to the manufacturer s instructions. To determine the consensus nucleotide sequence of the entire HIV-1 genome in individual virus clones, a collection of overlapping sets of oligonucleotide primers was used. They either have been previously described (46, 47) or were designed for the present experiments (Table 1). HIV-1 DNA was amplified using nested PCR. The first amplifications (external primers) were carried out using the GeneAmp PCR kit (Perkin-Elmer) and resulted in the copying of 1,235-, 4,253-, and 6,686-bp fragments, comprising residues 1 through 1235, 546 through 4799, and 2975 through 9661, respectively; residue numbers correspond to those of the genome of HIV-1 isolate HXB2 (35). Internal amplifications yielded fragments of 500 to 1,500 residues, which were used for nucleotide sequence determination. For amplification of short regions of gag (positions 1337 to 1598) and env (positions 7071 to 7333), a single PCR amplification was carried out. Both external and internal amplifications involved 35 cycles with temperatures chosen according to the composition of the oligonucleotide primers (78). Before sequencing, the PCR mixture was digested with exonuclease I and shrimp alkaline phosphatase (Amersham Life Sciences). Nucleotide sequences were determined on the two cdna strands, with an ABI 373 automatic sequencer. Multiple sequence alignments were obtained using the CLUSTAL W program (71). The newly determined nucleotide sequences have been deposited in the EMBL sequence database with accession numbers AF256204, AF256205, AF256206, AF256207, AF256208, AF256209, AF256210, and AF RESULTS Mutation accumulation as a result of bottleneck transfers. HIV-1 clones underwent severe fitness losses as a result of serial plaque-to-plaque transfers in MT-4 cells (78). To determine the types and numbers of mutations accumulated during bottleneck transfers, the entire genomic nucleotide sequence of four HIV-1 clones (D1, G1, I1, and K1) and their derivatives after 15, 7, 15, and 15 plaque-to-plaque passages, respectively (termed D15, G7, I15, and K15, respectively [Fig. 1]), were obtained. The comparison of genomic nucleotide sequences of GCTTCAAGTAGTGTGTGCCCGTCTG (563, S) AGAGTCACACAACAGACGGG (582, A) TGACTAAAAGGGTCTGAGGG (614, A) CTCTGGTAACTAGAGATCCC (615, S) TCTCTAGCAGTGGCGCCCGAACAGGGAC (626, S) AGACAGGATCAGAAGAA (995, S) GGTGATATGGCCTGATGTACCATTTGCCCCTG (1204, A) CCAGGCCAGATGAGAGAACCAAGGG (1462, S) TGTCCAGAATGCTGGTAGGG (1642, A) CTCTCAGAAGCAGGAGCCG (2205, S) GTATTTAGTAGGACCTACACCT (2475, S) TCTTCTGTCAATGGCCATTGTTTAAC (2635, A) GGATTAGATATCAGTACAATGTGCTT (2971, S) CATGGATCCGATATCTAATCCCTGG (2991, A) GCTGGTGACCTTTCCATCC (3022, A) TAGATATCAGTACAATGTGCTTCCAC (2975, S) TATTGCTGGTGATCCTTTCC (3026, A) AAACATCAGAAAGAACCTCC (3207, S) GTTCATAACCCATCCAAAGG (3249, A) GCGGAATCTGTATGTCATTGACAGTCCAGCT (3300, A) CATGGAGTGTATTATGACCC (3492, S) CTTTCCCCATATTACTATGC (3704, A) AGTTTGTCAATACCCCTCCC (3793, S) AATCATTCAAGCACAACCAG (4061, S) TTAGATGGAATAGATAAGGC (4233, S) CTTGAAGCTTATCTATTCCATCTAAAAATAGT (4257, A) GGCGAATTCACTAGCCATTGCTCTCCA (4284, A) AGTGATTTTAACC (4299, S) GCTTCTATATATCCACTGGC (4486, A) AAGTATGCTGTTTCTTGCCC (4528, A) AAGGGGGGATTGGGGGGTACAGTGCAGGG (4792, S) TAGCCCTTCCAGTCCCCCCTTTTCTTTTA (4799, A) CTTTCCCCTGCACTGTACCC (4825, A) TACTAATCTAGCCTCCCCTAGTGGGATGTG (5235, A) GCCTCTGTGGCCCTTGGTCTTCTGGGG (5595, A) CAGAAAAGCTTGTCGACATAGCAGAATAGG (5576, S) TTAGGCATCTCCTATGGCAGGAAGAAGCGG (5957, S) CCCATAATAGACTGTGACCC (6347, A) TGTGGGTTGGGGTCTGTGGG (6469, A) ATGGGATCAAAGCCTAAAGCCATGTG (6557, S) AGGATACCTTTGGACAGGCC (6852, A) TCAGCACAGTACAATGTACACATGG (6949, S) ATAAGCTTGCAGTCTAGCAGAAGAAGA (7004, S) CAATCCTCAGGAGGGGAC (7311, S) TGCATCTCAATTTCTGGGCTCCCCTCCTGAG (7345, A) AGGAGTCCTCCCCTGGGTCTTAAGTA (7648, A) AGTGCTTCCTGCTGCTCCCAAGAACCCAAG (7811, A) TCTTGCCTGGAGCTGTTTGATGCCCCAGAC (7961, A) TTGGAATTGGATAAGTGGGC (8205, S) GTGAATAGAGTTAGGCAGGG (8337, S) GAAATGACAATGGTGAGTATCCCTGCC (8376, A) CGATTCCTTCGGGCCTGTCGGGTCCCC (8424, A) TGTGGAACTTCTGGGACGCAGGGGGTGGG (8567, S) CAAGGAGGAGGAGGAGGTGGGTTTTCC (8977, S) TGGAAGGGCTAATTTGGTCCCAGA (9086, S) CTGGGACCAAATTAGCCCTTCCAGTCC (9108, A) a Sequences are written from 5 to 3 ; data in parentheses are the position of the 5 nucleotide of each primer according to the genomic nucleotide numbering of isolate HXB2 (35) and primer orientation (S, sense [same orientation as genomic RNA]; A, antisense [complementary to genomic RNA]). Oligonucleotide primers were purchased from Isogen (Maarssen).

3 9548 YUSTE ET AL. J. VIROL. TABLE 2. Number and types of mutations in the genome of HIV-1 clones subjected to serial plaque transfers Clones compared a Fitness decrease (%) b Mutation frequency c No. of mutationsd A 3 C A 3 G C 3 A C 3 G C 3 T G 3 A G 3 T T 3 A T 3 C T 3 G Other Total D1, D G1, G7 ND I1, I K1, K Total a The entire genomic nucleotide sequence of the indicated clones was determined as described in Materials and Methods. b Fitness decrease refers to the comparison of D15, I15, and K15 with their corresponding initial clones D1, I1, and K1; it is expressed as percent reduction, calculated as described in reference 78. For G7 a relative fitness value could not be calculated because the virus yield was insufficient to perform competition passages (78). c Mutation frequency is the number of mutations found in the genome of D15, G7, I15, or K15 (when compared with the corresponding initial clones D1, G1, I1, or K1) divided by the total number of nucleotides sequenced (in this case, the entire HIV-1 genome, or 9.1 kb); therefore, values are expressed in substitutions per nucleotide. d Transversions A 3 T and G 3 C were not found in the genomes of the clones analyzed. Other, nsertion of one nucleotide at genomic residue 584 (according to the numbering for the genome of HXB2 [35]) in the leader sequence. The location of mutations in the HIV-1 genome is given in Fig. 2 and is discussed in the text to substitutions per nucleotide [Table 2]). There was no obvious correlation between fitness decrease and mutation types or frequencies; for example, clone G7, which was debilitated to the point of not allowing a reliable determination of fitness value (78), showed a mutation frequency that was sevenfold lower than that of I15 (Table 2). Unusual distribution of mutations. Mutation frequencies in env are generally higher than in gag and pol when natural HIV-1 isolates are compared (35, 44, 57, 58). In contrast, the HIV-1 clones debilitated by serial plaque transfers showed average mutation frequencies that were threefold higher for gag than env (Fig. 2). No mutations were found in tat, vpu, and rev. Most remarkable was the absence of mutations in the regions encoding variable loops of gp120, particularly the V3 loop. The asymmetric distribution of mutations was visualized by dividing the HIV-1 genome into three arbitrary regions of similar length: region 1, residues 1 through 3028; region 2, residues 3029 through 6065; and region 3, residues 6066 through Taking into account all mutations scored for clones D15, G7, I15, and K15 (as quantitated in Table 2), we found mutation frequencies for regions 1, 2, and 3 of , , and substitutions per nucleotide, respectively. The results suggest that plaque-to-plaque transfers of HIV-1 lead to accumulation of mutations at multiple sites of the HIV-1 genome, following a pattern which is quite different from that observed in the natural evolution of HIV-1 in infected hosts. Conservation of the V3 loop. The unusual distribution of mutations found in D15, G7, I15, and K15 and the absence of mutations in the region encoding the variable V3 loop of gp120 prompted us to extend nucleotide sequence determinations to additional HIV-1 clones subjected to serial bottleneck events. These additional analyses included two clones from each of the lineages D15, G7, and K15, one clone from I15, and clones from independent lineages which were previously described (78), including three clones from F15 and one clone from H13 (Fig. 1). The analysis involved nucleotide sequences of residues 7071 to 7333 (which include the V3-coding region) and residues 1337 to 1598 (within the p24-coding region). The comparison of nucleotide sequences with those of the corresponding initial clones fully confirmed the bias in the distribution of mutations; in all, 13 replacements were found in the gag region analyzed (which represents a mutation frequency of substitutions per nucleotide), while no replacements were found in the V3-coding region (mutation frequency, substitutions per nucleotide). The statistical significance of the biased distribution of mutations was evaluated by comparing the expected versus the actual number of mutations in gag, pol, and env for regions 1, 2, and 3 into which the genome was arbitrarily divided (Fig. 2), as well as for the short gag and env stretches for the additional clones from populations D15, F15, G7, H13, I15, and K15. These results (Table 3) indicate high statistical significance of the biased mutant distribution. The degree of statistical significance of the biased distribution did not vary when either all G A mutations or just G A mutations found in clone I15 were excluded from the calculations (in all cases, P [ 2 test]). Therefore, accumulation of mutations that were associated with serial bottleneck events and with fitness loss of HIV-1 affected genomic regions that are less variable during the natural evolution of the virus. DISCUSSION The results reported here describe the numbers and types of mutations associated with fitness loss of HIV-1 as a result of the operation of Muller s ratchet (Table 2; Fig. 2). For clones D15, G7, and K15, the average mutation frequency ( substitutions per nucleotide, measured relative to the genomic nucleotide sequence of their respective parental clones D1, G1, and K1) was 12 mutations per genome (range, 10 to 15), with a predominance of transitions (75% of all mutations) over transversions. These figures are similar to those of previous determinations of the number of mutations accompanying Muller s ratchet in the FMDV genome an average of six mutations per genome, with 77% of these transition mutations (24). However, clone I15 displayed a different pattern in that its mutation frequency corresponded to 28 mutations per genome with an overabundance of G A transitions (43% of all mutations [Table 1]). G A is one of the substitutions that have been associated with hypermutagenesis in HIV-1 (72, 73) and a number of other viruses (reviewed in 5, 43). In clone I15, G A transitions were distributed rather uniformly along the genome. Several possible mechanisms have been proposed to explain biased hypermutagenesis (5, 43), including alterations in intracellular deoxynucleotide pools. The sequence context of 67% of the G A transitions in clone I15 was GpA or GpG, which suggests a possible influence of low dctp levels during minus cdna synthesis in the origin of this mutation type (43). Our results with debilitated HIV-1 clones emphasize the stochastic nature of the G A mutation bias because it was observed in only one of four clones derived from the same viral isolate, and these clones were subjected to identical treat-

4 VOL. 74, 2000 MUTATIONS AND BOTTLENECKS IN HIV FIG. 2. Location of mutations found in HIV-1 clones D15, G7, I15, and K15, relative to their parental counterparts. The upper part indicates HIV-1 genes and regulatory regions based on the compilation of Korber et al. (35). The four horizontal bars in the center of the figure indicate the positions of mutations along the genome (9.1 kb) in the four clones analyzed (from top to bottom, D15, G7, I15, and K15 [described in Materials and Methods]); vertical lines within these bars indicate one, two, or three mutations, according to thickness. Mutations were found at positions 35, 171, 377, 379, 570, 584, 760, 807, 833, 988, 1128, 1161, 1188, 1351, 1467, 1545, 1578, 1596, 1810, 1863, 1875, 1937, 1961, 1966, 2145, 2174, 2329, 2668, 2804, 3068, 3114, 3129, 3945, 4458, 5239, 5270, 5342, 5422, 5684, 5686, 6588, 6655, 6670, 7962, 8095, 8890, 8900, and 8989 according to the numbering of HIV-1 isolate HXB2 (35). The gp120-coding region of env has been enlarged to depict the positions of variable loops V1 to V5; two mutations affected the V1-coding region. The two shaded rectangles correspond to genome positions 1337 to 1598 (gag [left shaded rectangle]) and 7071 to 7333 (env [right shaded rectangle]), which have been sequenced for a number of additional HIV-1 clones to confirm the asymmetric distribution of mutations (see text). The mutations found in these additional clones are not included in this scheme. The bottom part shows the three arbitrary regions into which the HIV-1 genome was divided to illustrate the bias in the distribution of mutations along the genome. Procedures used for nucleotide sequence determination are described in Materials and Methods, and the oligonucleotide primers are listed in Table 1. ment during the serial plaque transfers (Fig. 1). If the mechanism of nucleotide pool bias was in operation (43), it must have been triggered either by extremely subtle perturbations in the intracellular environment or by differences among the genomes of the four clones, differences that existed initially or that were generated in the course of passaging. In the latter case, the mutational biases must be subjected to indeterminations derived from the dynamics of mutant generation within the quasispecies swarms (reviewed in 10, 20). A dominance of G A transitions was also found in an analysis of mutations in a lacz -based reporter gene, which was constructed to study a single cycle of HIV-1 replication (39). However, there are important differences in the mutant repertoire found following a single cycle of replication and in our clones subjected to serial plaque transfers. In the former study, G A, C T, and T C mutations occurred at frequencies of , , and substitutions per nucleotide, respectively, while in our study these same mutations occurred at frequencies of , , and , respectively (Table 2). After a singlecycle replication, T G, T A, and A G each occurred at a frequency of substitutions per nucleotide, while in our clones the values for these substitutions ranged from to substitutions per nucleotide. In addition, A C, C A, C G, and G T mutations found in HIV-1 TABLE 3. Expected versus actual number of mutations in different genomic regions of HIV-1 clones subjected to serial plaque transfers Genomic regions compared No. of mutations (P f ) Expected Found gag, pol, env a 8 gag, 15.7 pol, 13.2 env b 19 gag, 10pol, 5env ( 0.001) R1, R2, R3 a,c 15.8 R1, 15.8 R2, 15.8 R3 b 30 R1, 11 R2, 8 R3 ( 0.001) gag ( ), env ( ) d 6.8 gag, 6.8 env e 13 gag, 0env ( 0.001) a Comparisons involve mutations found in clones D15, G7, I15, and K15 relative to their corresponding parental clones D1, G1, I1, and K1 (Table 2). b The expected numbers of mutations are based on the mutation frequencies given in Table 2, assuming a random distribution of mutations along the genome. c R1, R2, and R3 indicate genomic regions 1, 2, and 3, as depicted in Fig. 2. d Comparisons involve mutations at genomic residues 1337 through 1598 and 7071 through 7333 found in three clones from lineage F15, two clones each from lineages D15, G7, and K15, and one clone each from lineages H13 and I15, as described in the text and in Fig. 1. e The expected numbers of mutations are based on the average mutation frequencies for genomic residues 1337 through 1598 (gag) and 7071 through 7333 (env) assuming a random distribution of mutations along the two genomic stretches. f P values were calculated by the 2 test.

5 9550 YUSTE ET AL. J. VIROL. clones (Table 2) were not represented among the mutations found after a single infectious cycle (39). These variations in mutation types and frequencies probably arose not only from differences in the number of replication cycles but also from the sequence context in the template being copied in a different biological environment (43). The most unexpected finding in the analysis of low-fitness HIV-1 clones was the distribution of mutations along the genome (Fig. 2), with a statistically significant accumulation of mutations in gag and the first third of the genome, relative to env, which appears as the most conserved genomic region in all clones examined (Fig. 2; Table 3). This is in sharp contrast to results with natural HIV-1 isolates (35, 44, 57, 58) and with large-population passages of HIV-1 clones derived also from natural isolate S61 in cell culture (64); in all of these analyses, gag and pol showed more nucleotide and amino acid sequence conservation than env. Several mechanisms could contribute to this striking difference in the distribution of mutations. In the course of plaque-to-plaque transfers, fitness gains or purifying selection is probably diminished since competition among genomes from the quasispecies is limited to the period of plaque development (10, 25). In this view, the higher variation normally seen in env relative to gag and pol would be essentially due to selection for immune evasion, for adaptation to alternative cellular receptors, increased particle stability, etc. Evidence for selection in vivo has been obtained for HIV-1 and for simian immunodeficiency virus (2, 3, 26, 34, 48, 54, 62, 77). However, even if replicative optimization of the mutant spectrum was limited as a result of bottlenecking, the deficit in mutations in env remains to be explained. There are at least two possibilities (which are not mutually exclusive): env may have a lower tolerance for mutations than gag and the 5 third of the genome under the cell culture environment in which the passages were carried out, or HIV-1 genome replication may be more error prone in the process of copying gag than when copying env. Constraints to accept replacements in surface proteins were documented through functional and structural studies with FMDV (12 and references therein). The mutant repertoire in viral quasispecies could be strongly influenced by tolerance to nucleotide and amino acid substitutions, including silent replacements in coding regions (12, 38, 40, 67). In HIV-1, constraints in surface proteins could come about from the need always to use the cellular receptors presented by MT-4 cells in culture and to enter this same cell type monotonously in an invariant cell culture environment. Purifying selection during plaque growth, which must include many cycles of replication, may have contributed to the observed bias in the distribution of mutations along the genome. A possible molecular basis for a difference in accuracy during copying of different genome segments of HIV-1 is not obvious. The lowest number of mutations was seen in the genomic region copied immediately after the first strand transfer in the synthesis of minus-strand DNA by reverse transcriptase (RT) (reviewed in reference 68). Since processivity of RT is limited, it could be proposed that as synthesis proceeds inside the nucleocapsid, accuracy may decrease as a result of environmental alterations (ionic composition, deoxynucleoside triphosphate pools, etc. [43]). It has been suggested that misalignment mutagenesis could be more frequent during dissociation and reinitiation of RT-catalyzed reactions (reviewed in 1). However, examination of the sequence context of each mutation suggests that the frequency of mutations which may have occurred as a result of template misalignment (1, 53) is not significantly different for regions 1, 2, and 3, into which we have divided the HIV-1 genome (52, 64, and 63%, respectively). Other effects on fidelity or, more likely, a combination of TABLE 4. Amino acid replacements associated with nonsynonymous mutations during plaque-to-plaque transfers of HIV-1 Amino acid replacement a Acceptability b Frequency in database c HIV-1 protein and possible structural and functional significance d R15K 5 High p17 matrix S67A 5 High p17 matrix S209A 5 High p 24 capsid C-terminal dimerization domain K14R 5 Not found p7 nucleocapsid flanking first zinc finger motif F16L 4 Not found p7 nucleocapsid in first zinc finger motif I14S 2 High p6 E40G 4 Not found RT in an -helix in fingers subdomain V189I e 5 Not found RT in palm subdomain near active site E194K 4 Not found RT in palm subdomain near active site V466I 5 High RT in a -sheet of RNase H V77I 5 Not found Integrase, in catalytic D, D-35-E domain ( 2) P67T 4 High Vif K77R 5 High Vif T101N 4 Low Vif V128I 5 High Vif G43E 4 Low Vpr S144I 2 Not found gp160, in V1 loop in gp120 E148G 4 Not found gp160, in V1 loop in gp120 V580I 5 High gp160, in gp41 ectodomain D624G 4 Low gp160, in gp41 ectodomain A32T 5 Not found Nef R35Q 3 High Nef E65Stop f Nef E154K 5 Low Nef a Amino acids are numbered for each individual protein, according to the numbering for isolate HXB2 found in the data banks (35). b The degree of acceptability of the amino acid substitution is given according to reference 27; the acceptability scale is from 0 to 6, with the latter value representing replacement by the same amino acid. c The database consulted is the one presented in reference 35, and it was again retrieved on April 18, 2000, by entering GenBank and EMBL databases. d Location of amino acid replacements and their possible significance is based on current databases (35) and overviews on HIV-1 structure-function relationships (references 7, 9, 28, and 30 and references therein). e This replacement has been correlated with resistance to nonnucleoside RT inhibitors (references 11, 28, 33, 35, and 46 and references therein). f This mutation leads to an amber termination codon in Nef. factors outlined in previous paragraphs may converge to produce the unusual distribution of mutations seen in HIV-1 clones as a result of operation of Muller s ratchet. A total of 8 out of 20 nonsynonymous replacements found among the HIV-1 clones analyzed have not been recorded in current sequence data banks (35; Table 4). An attractive possibility is that replacements in gag could have multiple effects in RNA-protein interactions, nucleocapsid assembly, and protein stability (16, 30) and that such effects could contribute to fitness loss. It must also be considered that Vif, Vpr, and Nef are dispensable functions for HIV-1 replication in some permissive cell lines, including MT-4 (7, 49). Therefore, the accumulation of nonsynonymous replacements in vif, vpr, and nef genes (Fig. 2) could be of little consequence for plaque formation in MT-4 cells. However, an evaluation of the influence of amino acid replacements (individually or in combination) in viral fitness would require analysis of the effects of candidate mutations when introduced into infectious clones or examination of possible reversions and fixation of compensatory mutations upon fitness recovery of the debilitated HIV-1 clones. These studies are now in progress. In conclusion, some mutations associated with the operation

6 VOL. 74, 2000 MUTATIONS AND BOTTLENECKS IN HIV of Muller s ratchet in HIV-1 have not been previously reported among natural isolates evolved over more than two decades (35; Table 4). Furthermore, the mutations were distributed along the viral genome, unlike mutations in natural HIV-1 isolates, and env was the most conserved genomic region. An interesting possibility is that, in vivo, HIV-1 is not subjected to as severe bottleneck events as in experiments designed to accentuate Muller s ratchet. The observations reported here add to the complexities inherent in the relationships between occurrence of mutations and what can be eventually observed upon examination of genomic nucleotide sequences. The HIV- 1 mutational pattern could be made to vary with respect to hundreds of sequences recorded in data banks simply by changing the passage regimen, without intervening, externally applied, selective forces. ACKNOWLEDGMENTS Work at Centro de Biología Molecular Severo Ochoa was supported by grants FIS98/ and PM C02-01 and that at Centro Nacional de Biología Fundamental was supported by grants FIS00/0266 and FIS98/ E.Y. was supported by a postdoctoral fellowship from Comunidad Autónoma de Madrid. REFERENCES 1. Bebenek, K., and T. A. Kunkel The fidelity of retroviral reverse transcriptases, p In A. M. Skalka and S. P. Goff (ed.), Reverse transcriptase. Cold Spring Harbor Laboratory Press, Gold Spring Harbor, N.Y. 2. Borrow, P., H. Lewicki, X. Wei, M. S. Horwitz, N. Peffer, H. Meyers, J. A. Nelson, J. E. Gairin, B. H. Hahn, M. B. Oldstone, and G. M. Shaw Antiviral pressure exerted by HIV-1-specific cytotoxic T lymphocytes (CTLs) during primary infection demonstrated by rapid selection of CTL escape virus. Nat. Med. 3: Borrow, P., and G. M. Shaw Cytotoxic T-lymphocyte escape viral variants: how important are they in viral evasion of immune clearance in vivo? Immunol. Rev. 164: Carrillo, C., J. Plana, R. Mascarella, J. Bergada, and F. Sobrino Genetic and phenotypic variability during replication of foot-and-mouth disease virus in swine. Virology 179: Cattaneo, R., and M. A. Billeter Mutations and A/I hypermutations in measles virus persistent infections. Curr. Top. Microbiol. Immunol. 176: Chao, L Fitness of RNA virus decreased by Muller s ratchet. Nature 348: Chen, I. S. Y., H. Koprowski, A. Srinivasan, and P. K. Vogt (ed.) Transacting functions of human retroviruses. Springer-Verlag KG, Berlin, Germany. 8. Coffin, J. M HIV population dynamics in vivo: implications for genetic variation, pathogenesis, and therapy. Science 267: Coffin, J. M., S. H. Hughes, and H. E. Varmus Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 10. Domingo, E., C. Biebricher, J. J. Holland, and M. Eigen Quasispecies and RNA virus evolution: principles and consequences. Landes Bioscience, Austin, Tex. 11. Domingo, E., C. Escarmís, L. Menéndez-Arias, and J. J. Holland Viral quasispecies and fitness variations, p In E. Domingo, R. G. Webster, and J. J. Holland (ed.), Origin and evolution of viruses. Academic Press, San Diego, Calif. 12. Domingo, E., M. G. Mateu, C. Escarmís, E. Martínez-Salas, D. Andreu, E. Giralt, N. Verdaguer, and I. Fita Molecular evolution of aphthoviruses. Virus Genes 11: Domingo, E., R. G. Webster, and J. J. Holland (ed.) Origin and evolution of viruses. Academic Press, San Diego, Calif. 14. Dougherty, J. P., and H. M. Temin Determination of the rate of base-pair substitution and insertion mutations in retrovirus replication. J. Virol. 62: Drake, J. W Rates of spontaneous mutation among RNA viruses. Proc. Natl. Acad. Sci. USA 90: Druillennec, S., A. Caneparo, H. de Rocquigny, and B. P. Roques Evidence of interactions between the nucleocapsid protein NCp7 and the reverse transcriptase of HIV-1. J. Biol. Chem. 274: Duarte, E., D. Clarke, A. Moya, E. Domingo, and J. Holland Rapid fitness losses in mammalian RNA virus clones due to Muller s ratchet. Proc. Natl. Acad. Sci. USA 89: Eigen, M Self-organization of matter and the evolution of biological macromolecules. Naturwissenschaften 58: Eigen, M On the nature of virus quasispecies. Trends Microbiol. 4: Eigen, M., and C. K. Biebricher Sequence space and quasispecies distribution, p In E. Domingo, P. Ahlquist, and J. J. Holland (ed.), RNA genetics, vol. 3. CRC Press, Inc., Boca Raton, Fla. 21. Eigen, M., J. McCaskill, and P. Schuster Molecular quasispecies. J. Phys. Chem. 92: Eigen, M., and P. Schuster The hypercycle: a principle of natural self-organization. Springer-Verlag KG, Berlin, Germany. 23. Elena, S. F., F. González-Candelas, I. S. Novella, E. A. Duarte, D. K. Clarke, E. Domingo, J. J. Holland, and A. Moya Evolution of fitness in experimental populations of vesicular stomatitis virus. Genetics 142: Escarmís, C., M. Dávila, N. Charpentier, A. Bracho, A. Moya, and E. Domingo Genetic lesions associated with Muller s ratchet in an RNA virus. J. Mol. Biol. 264: Escarmís, C., M. Dávila, and E. Domingo Multiple molecular pathways for fitness recovery of an RNA virus debilitated by operation of Muller s ratchet. J. Mol. Biol. 285: Evans, D. T., D. H. O Connor, P. Jing, J. L. Dzuris, J. Sidney, J. da Silva, T. M. Allen, H. Horton, J. E. Venham, R. A. Rudersdorf, T. Vogel, C. D. Pauza, R. E. Bontrop, R. DeMars, A. Sette, A. L. Hughes, and D. I. Watkins Virus-specific cytotoxic T-lymphocyte responses select for amino-acid variation in simian immunodeficiency virus Env and Nef. Nat. Med. 5: Feng, D. F., M. S. Johnson, and R. F. Doolittle Aligning amino acid sequences: comparison of commonly used methods. J. Mol. Evol. 21: Flint, S. J., L. W. Enquist, R. M. Krug, V. R. Racaniello, and A. M. Skalka Virology: molecular biology, pathogenesis, and control. ASM Press, Washington, D.C. 29. Forns, X., R. H. Purcell, and J. Bukh Quasispecies in viral persistence and pathogenesis of hepatitis C virus. Trends Microbiol. 7: Freed, E. O HIV-1 gag proteins: diverse functions in the virus life cycle. Virology 251: Goudsmit, J., A. de Ronde, E. de Rooij, and R. de Boer Broad spectrum of in vivo fitness of human immunodeficiency virus type 1 subpopulations differing at reverse transcriptase codons 41 and 215. J. Virol. 71: Goulder, P., D. Price, M. Nowak, S. Rowland-Jones, R. Phillips, and A. McMichael Co-evolution of human immunodeficiency virus and cytotoxic T-lymphocyte responses. Immunol. Rev. 159: Havlir, D. V., S. Eastman, A. Gamst, and D. D. Richman Nevirapineresistant human immunodeficiency virus: kinetics of replication and estimated prevalence in untreated patients. J. Virol. 70: Kimata, J. T., L. Kuller, D. B. Anderson, P. Dailey, and J. Overbaugh Emerging cytopathic and antigenic simian immunodeficiency virus variants influence AIDS progression. Nat. Med. 5: Korber, B., C. Kuiken, B. Foley, B. Hahn, F. McCutchan, J. Mellors, and J. Sodroski Human retroviruses and AIDS: a compilation and analysis of nucleic acids and amino acid sequences. Theoretical Biology and Biophysics Group T-10. Los Alamos, N.M. 36. Kurosaki, M., N. Enomoto, T. Nouchi, I. Sakuma, F. Marumo, and C. Sato Fraction-specific populations of the hypervariable region of the hepatitis C virus in a patient with cryoglobulinemia. J. Med. Virol. 46: Lech, W. J., G. Wang, Y. L. Yang, Y. Chee, K. Dorman, D. McCrae, L. C. Lazzeroni, J. W. Erickson, J. S. Sinsheimer, and A. H. Kaplan In vivo sequence diversity of the protease of human immunodeficiency virus type 1: presence of protease inhibitor-resistant variants in untreated subjects. J. Virol. 70: Lobert, P. E., N. Escriou, J. Ruelle, and T. Michiels A coding RNA sequence acts as a replication signal in cardioviruses. Proc. Natl. Acad. Sci. USA 96: Mansky, L. M., and H. M. Temin Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase. J. Virol. 69: McKnight, K. L., and S. M. Lemon Capsid coding sequence is required for efficient replication of human rhinovirus 14 RNA. J. Virol. 70: McMichael, A. J., and R. E. Phillips Escape of human immunodeficiency virus from immune control. Annu. Rev. Immunol. 15: Meyerhans, A., R. Cheynier, J. Albert, M. Seth, S. Kwok, J. Sninsky, L. Morfeldt-Manson, B. Asjo, and S. Wain-Hobson Temporal fluctuations in HIV quasispecies in vivo are not reflected by sequential HIV isolations. Cell 58: Meyerhans, A., and J.-P. Vartanian The fidelity of cellular and viral polymerases and its manipulation for hypermutagenesis, p In E. Domingo, R. G. Webster, and J. J. Holland (ed.), Origin and evolution of viruses. Academic Press, Inc., San Diego, Calif. 44. Montagnier, L Human immunodeficiency virus (Retroviridae). In A. Granoff and R. G. Webster (ed.), Encyclopedia of virology. Academic Press, Inc., San Diego, Calif.

7 9552 YUSTE ET AL. J. VIROL. 45. Muller, H. J The relation of recombination to mutational advance. Mutat. Res. 1: Nájera, I., A. Holguín, M. E. Quiñones-Mateu, M. A. Muñoz-Fernández, R. Nájera, C. López-Galíndez, and E. Domingo Pol gene quasispecies of human immunodeficiency virus: mutations associated with drug resistance in virus from patients undergoing no drug therapy. J. Virol. 69: Nájera, I., D. D. Richman, I. Olivares, J. M. Rojas, M. A. Peinado, M. Perucho, R. Najera, and C. Lopez-Galindez Natural occurrence of drug resistance mutations in the reverse transcriptase of human immunodeficiency virus type 1 isolates. AIDS Res. Hum. Retrovir. 10: Nijhuis, M., R. Schuurman, D. de Jong, J. Erickson, E. Gustchina, J. Albert, P. Schipper, S. Gulnik, and C. A. Boucher Increased fitness of drug resistant HIV-1 protease as a result of acquisition of compensatory mutations during suboptimal therapy. AIDS 13: Nishino, Y., M. Kishi, M. Sumiya, K. Ogawa, A. Adachi, K. Maotani-Imai, S. Kato, K. Hirai, and K. Ikuta Human immunodeficiency virus type 1 vif, vpr, and vpu mutants can produce persistently infected cells. Arch. Virol. 120: Novella, I. S., E. A. Duarte, S. F. Elena, A. Moya, E. Domingo, and J. J. Holland Exponential increases of RNA virus fitness during large population transmissions. Proc. Natl. Acad. Sci. USA 92: Novella, I. S., C. L. Hershey, C. Escarmis, E. Domingo, and J. J. Holland Lack of evolutionary stasis during alternating replication of an arbovirus in insect and mammalian cells. J. Mol. Biol. 287: Novella, I. S., J. Quer, E. Domingo, and J. J. Holland Exponential fitness gains of RNA virus populations are limited by bottleneck effects. J. Virol. 73: Pathak, V. K., and H. M. Temin Azacytidine and RNA secondary structure increase the retrovirus mutation rate. J. Virol. 66: Phillips, R. E., S. Rowland-Jones, D. F. Nixon, F. M. Gotch, J. P. Edwards, A. O. Ogunlesi, J. G. Elvin, J. A. Rothbard, C. R. Bangham, C. R. Rizza, and A. J. McMichael Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature 354: Preston, B. D., and J. P. Dougherty Mechanisms of retroviral mutation. Trends Microbiol. 4: Quiñones-Mateu, M. E., J. L. Albright, A. Mas, V. Soriano, and E. J. Arts Analysis of pol gene heterogeneity, viral quasispecies, and drug resistance in individuals infected with group O strains of human immunodeficiency virus type 1. J. Virol. 72: Quiñones-Mateu, M. E., A. Holguín, J. Dopazo, I. Nájera, and E. Domingo Point mutant frequencies in the pol gene of human immunodeficiency virus type 1 are two- to three-fold lower than those of env. AIDS Res. Hum. Retrovir. 12: Quiñones-Mateu, M. E., A. Holguín, V. Soriano, and E. Domingo env gene diversity of HIV type 1 isolates from Spain. AIDS Res. Hum. Retrovir. 12: Ribeiro, R. M., S. Bonhoeffer, and M. A. Nowak The frequency of resistant mutant virus before antiviral therapy. AIDS 26: Robertson, D. L., B. H. Hahn, and P. M. Sharp Recombination in AIDS viruses. J. Mol. Evol. 40: Robertson, D. L., P. M. Sharp, F. E. McCutchan, and B. H. Hahn Recombination in HIV-1. Nature 374: Rodrigo, A. G., and J. I. Mullins Human immunodeficiency virus type 1 molecular evolution and the measure of selection. AIDS Res. Hum. Retrovir. 12: Sala, M., and S. Wain-Hobson Drift and conservation in RNA virus evolution: are they adapting or merely changing? p In E. Domingo, R. G. Webster, and J. J. Holland (ed.), Origin and evolution of viruses. Academic Press, Inc., San Diego, Calif. 64. Sánchez-Palomino, S., J. M. Rojas, M. A. Martínez, E. M. Fenyö, R. Nájera, E. Domingo, and C. López-Galíndez Dilute passage promotes expression of genetic and phenotypic variants of human immunodeficiency virus type 1 in cell culture. J. Virol. 67: Schuitemaker, H., N. A. Kootstra, R. E. de Goede, F. de Wolf, F. Miedema, and M. Tersmette Monocytotropic human immunodeficiency virus type 1 (HIV-1) variants detectable in all stages of HIV-1 infection lack T-cell line tropism and syncytium-inducing ability in primary T-cell culture. J. Virol. 65: Schuster, P., and P. F. Stadler Nature and evolution of early replicons, p In E. Domingo, R. G. Webster, and J. J. Holland (ed.), Origin and evolution of viruses. Academic Press, Inc., San Diego, Calif. 67. Simmonds, P., and D. B. Smith Structural constraints on RNA virus evolution. J. Virol. 73: Telesnitsky, A., and S. P. Goff Strong-stop strand transfer during reverse transcription, p In A. M. Skalka and S. P. Goff (ed.), Reverse transcriptase. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 69. Temin, H. M Is HIV unique or merely different? J. Acquir. Immune Defic. Syndr. 2: Temin, H. M The high rate of retrovirus variation results in rapid evolution, p In S. S. Morse (ed.), Emerging viruses. Oxford University Press, Oxford, United Kingdom. 71. Thompson, J. D., D. G. Higgins, and T. J. Gibson CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: Vartanian, J. P., A. Meyerhans, B. Asjo, and S. Wain-Hobson Selection, recombination, and G3A hypermutation of human immunodeficiency virus type 1 genomes. J. Virol. 65: Vartanian, J. P., A. Meyerhans, M. Sala, and S. Wain-Hobson G3A hypermutation of the human immunodeficiency virus type 1 genome: evidence for dctp pool imbalance during reverse transcription. Proc. Natl. Acad. Sci. USA 91: Wain-Hobson, S Running the gamut of retroviral variation. Trends Microbiol. 4: Weaver, S. C., A. C. Brault, W. Kang, and J. J. Holland Genetic and fitness changes accompanying adaptation of an arbovirus to vertebrate and invertebrate cells. J. Virol. 73: Weiner, A., A. L. Erickson, J. Kansopon, K. Crawford, E. Muchmore, A. L. Hughes, M. Houghton, and C. M. Walker Persistent hepatitis C virus infection in a chimpanzee is associated with emergence of a cytotoxic T lymphocyte escape variant. Proc. Natl. Acad. Sci. USA 92: Wolinsky, S. M., B. T. Korber, A. U. Neumann, M. Daniels, K. J. Kunstman, A. J. Whetsell, M. R. Furtado, Y. Cao, D. D. Ho, and J. T. Safrit Adaptive evolution of human immunodeficiency virus-type 1 during the natural course of infection. Science 272: Yuste, E., S. Sánchez-Palomino, C. Casado, E. Domingo, and C. López- Galíndez Drastic fitness loss in human immunodeficiency virus type 1 upon serial bottleneck events. J. Virol. 73: