Emergence of cytotoxic T lymphocyte escape mutations in nonpathogenic simian immunodeficiency virus infection

Transcription

1 Eur. J. Immunol : CTL escape in nonpathogenic SIV infection 3207 Emergence of cytotoxic T lymphocyte escape mutations in nonpathogenic simian immunodeficiency virus infection Amitinder Kaur 1, Louis Alexander 2, Silvija I. Staprans 5, Lynn Denekamp 2, Corrina L. Hale 1,HaroldM.McClure 4, Mark B. Feinberg 5, Ronald C. Desrosiers 2 and R. Paul Johnson 1,3 1 Division of Immunology, New England Regional Primate Research Center, Harvard Medical School, Southborough, USA 2 Division of Microbiology, New England Regional Primate Research Center, Harvard Medical School, Southborough, USA 3 Infectious Disease Unit and Partners AIDS Research Center, Massachusetts General Hospital, Charlestown, USA 4 Divisions of Research Resources and Microbiology and Immunology, Yerkes Regional Primate Research Center, Emory University, Atlanta, USA 5 Departments of Medicine and Microbiology and Immunology, Emory University, Atlanta, USA Although CTL escape has been well documented in pathogenic simian immunodeficiency virus (SIV) infection, there is no information on CTL escape in nonpathogenic SIV infection in nonhuman primate hosts like the sooty mangabeys. CTL responses and sequence variation in the SIV nef gene were evaluated in one sooty mangabey and one rhesus macaque inoculated together with the same stock of cloned SIVmac239. Each animal developed an immunodominant response to a distinct CTL epitope in Nef, aa in the macaque and aa in the mangabey. Nonsynonymous mutations in their respective epitopes were observed in both animals and resulted in loss of CTL recognition. These mutations were present in the majority of proviral DNA sequences at 16 weeks post infection in the macaque and G 2 years post infection in the mangabey. These results document the occurrence of CTL escape in a host that does not develop AIDS, and adds to the growing body of evidence that CTL exert significant selective pressure in SIV infection. Key words: Simian immunodeficiency virus / Sooty mangabey / CTL escape Received 27/6/01 Accepted 2/8/01 1 Introduction A key feature of HIV and simian immunodeficiency virus (SIV) infection is the ability of the virus to persist and continuously replicate in its host despite a vigorous immune response [1]. Sequence variation in viral epitopes leading to loss of recognition by antibodies [2] or CTL [3 6] is one mechanism by which the virus can evade immune surveillance and persist in its host. The high replication rate of HIV coupled with a high mutation rate during reverse transcription is a source of considerable genetic variation in vivo [7]. Rapid evolution of CTL escape mutations as a direct result of selective pressure has been documented after lymphocytic choriomeningitis virus infection in mice transgenic for a virus-specific TCR where a single amino acid (aa) change occurred 8 days [I 22144] The first two authors contributed equally to this work Abbreviations: SIV: Simian immunodeficiency virus aa: Amino acid after infection and abrogated CTL recognition [8]. In HIV-1 infection, positive selection of drug-resistant mutants is evident within 1 2 weeks of starting monotherapy [9]. There is growing evidence that evolution of escape mutations plays a critical role in the ability of HIV and SIV to evade containment by CTL. Several initial reports failed to observe evidence for CTL escape based on instances of persistence of recognized epitopes [10] and lack of evidence of CTL-mediated sequence variation in an HLA-A*0201-restricted epitope between HLAmatched CTL responders and non-responders [11]. However, more recently, several longitudinal studies have documented instances of CTL escape in HIVinfected individuals in the setting of an immunodominant CTL response [3, 4]. CTL escape can occur rapidly in primary HIV infection [3], as well as after adoptive transfer of HIV CTL [12]. In these instances, early onset of CTL escape was associated with an oligoclonal or monospecific CTL response leading to rapid, complete fixation of escape mutations. Late-onset of CTL escape associated with progression to AIDS has also been documented [4]. WILEY-VCH Verlag GmbH, D Weinheim, /01/ $ /0

2 3208 A. Kaur et al. Eur. J. Immunol : The role of immune escape in disease progression can be well addressed in animal models where the virus inoculum and time of infection can be precisely defined and sequence variation can be studied from the onset of infection. Recently, two reports have documented the frequent occurrence of CTL escape in SIV-infected rhesus macaques [5, 6]. Evans et al. [5] demonstrated the appearance of escape mutations within multiple CTL epitopes in SIV nef and env genes in SIV-infected rhesus macaques. In acute SIV infection, Tat-specific CTL responses select for viral escape variants within the first 8 weeks of infection [6]. Despite the accumulating evidence documenting an association between CTL escape and disease progression in pathogenic primate lentivirus infection, there is currently no published data on CTL escape in nonpathogenic SIV infection in nonhuman primate hosts like the sooty mangabeys. We conducted a longitudinal study of CTL responses and sequence variation in the nef gene in two monkeys, one rhesus macaque and one sooty mangabey, that had divergent outcomes following inoculation with the same stock of molecularly cloned SIVmac239 [13]. As documented previously, SIVmac239 infection does not mimic the features of natural SIV infection in sooty mangabeys, since it results in low viral loads and vigorous CTL responses in sooty mangabeys [13]. While the rhesus macaque developed profound CD4 + T lymphocytopenia and progressed to AIDS within 54 weeks after SIV inoculation, the sooty mangabey maintained normal CD4 + T lymphocyte counts and remained asymptomatic until it was euthanized 104 weeks after SIV inoculation for a non-aids related condition. Both animals mounted a Nef-specific CTL response targeting different CTL epitopes in SIV Nef. Surprisingly, a predominance of nonsynonymous mutations in Nef, associated with CTL escape mutations, were observed in both animas. These data document CTL escape in a sooty mangabey for the first time, and suggest that CTL may be an important factor driving in vivo sequence variation in both nonpathogenic and pathogenic SIV infection. 2 Results 2.1 Longitudinal analysis of Nef-specific CTL activity in two SIVmac239-infected monkeys Previously we reported on the divergent courses of SIV infection in sooty mangabey Sm FWl and rhesus macaque Mm RGa3 that were inoculated concurrently with the same stock of SIVmac239 [13]. Sm FWl remained free of AIDS until 104 weeks when it was euthanized for self-mutilation; no evidence of AIDS was found at autopsy. In contrast, Mm RGa3 developed AIDS and died 54 weeks after SIV infection [13]. Although vigorous Nef-specific CTL responses targeting different epitopes in Nef were detected in both animals, the SIVspecific CTL response differed in the two animals. In Sm FWl, it was sustained and broadly directed, targeting two or more SIV proteins throughout the course of SIV infection. In Mm RGa3, CTL activity predominantly targeting Nef and Env had declined to low or undetectable levels after 36 weeks post infection (Fig. 1 and [13]). Fig. 1. Longitudinal comparison of the rate of evolution of CTL escape, viral load and magnitude of CTL activity in macaque Mm RGa3 and mangabey Sm FWl. Arrows depict time of death. The time line is not drawn to scale. The magnitude of CTL activity was graded as +++ G 40% specific lysis at two E/T ratios; ++ G 20% and X 40% specific lysis at two E/T ratios; + G 10% and X 20% specific lysis at one or more E/T ratios; X 10% specific lysis at all E/T ratios. nd not done. N total number of nonsynonymous nucleotide substitutions in SIV nef.

3 Eur. J. Immunol : CTL escape in nonpathogenic SIV infection 3209 We monitored recognition of Nef and Nef CTL epitopes in both animals using CTL clones and bulk stimulated PBMC. In macaque Mm RGa3, 17 Nef-specific CD8 + CTL clones were isolated at 6 weeks after SIV infection; 15 of them recognized a single peptide in Nef (aa ), which was fine-mapped to aa (data not shown). CTL recognition of this peptide was MHC restricted, but the restricting MHC class I allele was not defined (data not shown). The initial SIV-specific CTL response, as assessed by bulk 51 Cr-release assays, was predominantly directed towards Env and Nef proteins (Fig. 1). At 21 weeks, bulk CTL assays revealed a response predominantly directed against Nef (Fig. 1). Although vigorous Nef-specific CTL activity was detected at this time point, the Nef CTL epitope aa did not appear to be immunodominant (Fig. 2a). A global decline in SIV-specific CTL activity, including Nef was observed in Mm RGa3 from week 36 onwards, and no CTL activity was detected at the time of its death at 54 weeks post infection (Fig. 1). In the sooty mangabey Sm FWl, 11 SIV-specific CTL clones, all of which were Nef specific, were isolated at 40 weeks after SIV infection [14]. All the clones recognized a single epitope in Nef (aa 20 28) [14]. At 54 weeks, vigorous Gag, Env and Nef-specific CTL activity was detected, and the Nef CTL epitope was well recognized (Fig. 1, 2b). However, by week 104 after SIV infection Nef-specific CTL activity had declined, although CTL activity towards other SIV proteins was detected at levels comparable to earlier time points (Fig. 1, 2b and data not shown). At this time point, the original Nef CTL epitope was weakly recognized (Fig. 2b). 2.2 Longitudinal analysis of sequence changes within the Nef CTL epitopes To assess if decline of Nef-specific CTL activity and loss of recognition of Nef CTL epitopes were associated with sequence changes in Nef, we longitudinally analyzed Nef sequences in the macaque Mm RGa3 and the mangabey Sm FWl from the time of SIV inoculation until death. Proviral nef DNA sequences from macaque Mm RGa3 were analyzed at 1, 16, 21 and 45 weeks post infection. At 16, 21, and 45 weeks, all nucleotide changes were nonsynonymous, resulting in 5, 5, and 12 aa changes respectively, in Nef that were not present 1 week post infection (Fig. 3, Table 1). Surprisingly, no synonymous nucleotide substitutions were observed in Mm RGa3 nef sequences at any time point tested (Table 1). At weeks 16 and 21 post infection, 2 of the 5 aa changes observed were present within the Nef CTL epitope 157 QDYTSGPGIRY 167 recognized by Mm RGa3 (Fig. 3). In all, we observed 3 different aa changes in the CTL epitope sequence, which varied in frequency at different times post infection (Table 2). These were 158 D to E (D158E) (GAT to GAG); 161 S to L (S161L) (TCA to TTA) and 165 I to T (I165T) (ATT to ACT) (Table 2 and Fig. 3). The D158E change and the I165T change were detected in the majority of proviral sequences at week 16 after infection (Table 2). While the D158E change remained dominant at late time points post infection, the I165T change had partially reverted to the parental sequence by 45 weeks after SIV infection (Table 2). The partial reversion to the parental sequence was temporally associated with loss of Nef-specific CTL activity for at least the preceding 9 weeks. At 45 weeks, a dominant S161L change Fig. 2. CTL activity directed towards Nef and the principal Nef epitope in one rhesus macaque (Mm RGa3) and two sooty mangabeys (Sm FWl and Sm FYg) inoculated with SIVmac239. CTL activity was measured after days of in vitro stimulation with recombinant vaccinia encoding SIV Nef. Target cells consisted of autologous B-LCL infected with recombinant vaccinia encoding Nef (Vac/Nef) or pulsed with peptide containing the appropriate Nef CTL epitope for each animal (QDYTSGPGIRY for macaque Mm RGa3, LLRARGETY for mangabey Sm FWl, and LRARGETYGR for mangabey Sm FYg). Percent specific lysis was obtained after subtracting lysis of control target cells.

4 3210 A. Kaur et al. Eur. J. Immunol : Table 1. Analysis of synonymous and nonsynonymous mutations of proviral DNA nef sequences after SIV mac239 infection Animals Wks after SIV infection No. of nucleotide substitutions Mean (SD) a) Synonymous Nonsynonymous ds b) dn b) ds/dn c) Mm RGa (0.004) (0.004) (0.006 ) SmFW (0.002) (0.007) (0.005) d) 0.66 Sm FLg (0.011) (0.004) d) 1.88 Sm FYg (0.015) (0.003) d) 4.77 a) Comparison with SIV mac239 sequence. b) Rates of synonymous nucleotide substitution rate per synonymous site (ds) and nonsynonymous nucleotide substitution rate per nonsynonymous site (dn). c) Not calculated when ds value was zero. d) p value X for difference between ds and dn; unpaired t-test (two-tailed) not present at weeks 16 and 21 post infection was also observed (Table 2). The E residue at position 158 in Mm RGa3 Nef has not been observed in the Los Alamos SIV/HIV-2 sequences database, whereas the L at position 161 and the T at position 165 have been observed in 3 and 1 SIVsm isolates, respectively [15]. We also analyzed proviral nef sequences from mangabey Sm FWl at weeks 2, 32, 54, and 104 (time of death) post infection, and detected several changes in these sequences from SIVmac239 (Fig. 3). No sequence changes in nef were evident until 32 weeks post infection. Thereafter, as was seen in Mm RGa3 Nef, predominantly nonsynonymous mutations were observed and at week 104 post infection, the rate of nonsynonymous mutations (dn) was significantly higher than the rate of synonymous mutations (ds) in Sm FWl Nef sequences (Table 1). At week 104 post infection, eight nonsynonym- Table 2. Longitudinal analysis of escape mutations within Nef CTL epitopes of mangabey Sm FW1 and macaque Mm RGa3 inoculated with SIV mac239 SM FWl Mm RGa3 CTL epitope Nef Nef SIVmac239 sequence LLRARGETY QDYTSGPGIRY Sequence in recovered virus LLQARGENY QEYTLGPGTRY %MutantProviralDNA R22Q T27N D158E S161L I165T Time 1 a) X 5 X 5 X 5 X 5 X 5 Time 2 16 X 5 82 X 5 95 Time X 5 83 Time a) Times 1 to 4 for Sm FWl are weeks 2, 32, 54 and 104 after SIV infection, and for Mm RGa3 they are weeks 1, 16, 21 and 45 after SIV infection. The percentages of mutations were estimated from the sequence chromatograms as described in Sect. 4.

5 Eur. J. Immunol : CTL escape in nonpathogenic SIV infection 3211 Fig. 3. Alignment of consensus Nef aa sequences. Nef aa sequences from four infected monkeys from the indicated times post SIV inoculation were aligned to SIVmac239 Nef sequences. A period (.) indicates homology. The black boxes represent the mapped CTL epitopes recognized by a particular monkey. Numbers 1, 2 and 3 indicate that a mixture of two aa was observed ataparticularlocus:1=i/t,2=y/c,3=s/p. ous mutations and only one synonymous mutation were present in nef sequences of viral DNA from PBMC (Table 1). Two of the eight nonsynonymous mutations were located within its Nef CTL epitope 20 LLRARGETY 28 (Fig. 3); 22 R to Q (R22Q), (CGG to CAG) and 27 TtoN (T27N) (ACT to AAT). No mutations were observed in the regions flanking the CTL epitope (Fig. 3). Analysis of proviral sequences from earlier time points showed that the mutations in the CTL epitope had evolved slowly and were present in roughly two-thirds of proviral sequences at 104 weeks post infection (Table 2). 22 Q represents a consensus SIVsm nef sequence [15] and was observed in another SIVmac239-infected sooty mangabey Sm FYg (Fig. 3). 27 N has not been previously reported in SIVsm isolates and has been observed in one Mm isolate [15]. 2.3 Mutations in CTL epitope lead to loss of CTL recognition To determine if mutations in the CTL epitopes resulted in loss of recognition by CTL, we analyzed the ability of the CTL clones isolated from macaque Mm RGa3 and mangabey Sm FWl to lyse autologous target cells pulsed with a panel of variant peptides with one or more aa substitutions observed in the Nef sequences at late time points post infection. Cryopreserved CTL clones were tested against the original and variant peptides. Three CTL clones from sooty mangabey Sm FWl were tested against the optimal Nef epitope aa corresponding to the original SIVmac239 sequence ( 20 LLRARGETY 28 ), and variant peptides containing either the R22Q or T27N substitutions alone, or both substitutions together. The single R22Q substitution did not affect CTL recognition by any of the three CTL clones (Fig. 4). The peptide containing only the T27N substitution was not recognized by two of three clones but was suboptimally recognized by one clone (clone 34) (Fig. 4). The Nef peptide containing both R22Q and T27N substitutions was not recognized by any of the three clones (Fig. 4). Similar results were observed in replicate experiments. To determine if CTL recognizing the variant epitope had emerged at later time points, we stimulated PBMC obtained at week 104 post

6 3212 A. Kaur et al. Eur. J. Immunol : D158E or both D158E and S161L substitutions, did not affect in vitro CTL recognition (Fig. 5). Similar results were obtained in replicate experiments with all four clones. 2.4 Comparison of nef sequences in mangabey Sm FWl with two other SIVmac239-infected mangabeys Fig. 4. Comparison of recognition of optimal epitope and variant epitopes by CTL clones isolated from Sm FWl at 40 weeks after SIVmac239 infection. Three cryopreserved CTL clones were tested for CTL activity. All clones were tested on two separate occasions at an E/T ratio 5:1. Representative peptide titration assays from one experiment shown. Percent lysis is the value obtained after subtracting lysis of target cells not pulsed with peptide. infection with the variant peptides. No CTL activity against the Nef variants was detected (data not shown). Four CTL clones from macaque Mm RGa3 were tested against a panel of original peptides with the parental virus sequence 156 WQDYTSGPGIRYP 168, and variant peptides with aa substitutions present in the CTL epitope. Testing of the four clones from Mm RGa3 against the variant 13-aa peptides revealed loss of CTL recognition of target cells pulsed with variant peptides that had the I165T change in combination with either the D158E and S161L singly or together (Fig. 5). In the presence of the parental residue I at position 165, the presence of To determine if sequence changes in the Nef CTL epitope observed for mangabey Sm FWl were adaptive changes of SIVmac239 replication in sooty mangabeys, we examined nef sequences of proviral DNA from two other SIVmac239-infected sooty mangabeys that did not have evidence for CTL escape by CTL assays. SmFYg shared a MHC class I allele with Sm FWl based on isoelectric focusing gel electrophoresis of MHC class I immunoprecipitates, and recognized a similar Nef CTL epitope (aa 21 29) [14], which was immunodominant when tested 176 weeks after SIV inoculation (Fig. 2c). Based on isoelectric focusing gel electrophoresis, the second mangabey Sm FLg did not share MHC class I alleles with Sm FWl [14]. However, at 192 weeks after SIV inoculation, vigorous Nef-specific CTL activity targeting a hitherto uncharacterized epitope in the same region of Nef (aa 21 30) was identified (data not shown). Thus, all three sooty mangabeys studied recognized CTL epitopes contained within aa in Nef. We observed a R22Q change in 100% of viral DNA isolated from PBMC of Sm FYg at week 208 post infection, and a dominant T27S change in viral DNA from Sm FLg at week 192 after SIV infection (Fig. 3). The T27N change thatresultedinalossofctlrecognitioninsmfwlwas not observed in either of these two mangabeys. While the Q22 change is a consensus sequence of SIVsm Nef, S27 has not been reported previously in SIV [15]. In contrast to Sm FWl, ds was significantly higher than dn in Sm FLg and Sm FYg more than 3 years after SIV infection (Table 1). Fig. 5. Comparison of recognition of peptides with parental and mutant sequences by CTL clones isolated from Mm RGa3 at 6 weeks after SIVmac239 infection. Four cryopreserved CTL clones were tested for CTL activity. All clones were tested on two separate occasions at an E/T ratio 5:1. Representative peptide titration assays on two clones from one experiment shown. Percent lysis is the value obtained after subtracting lysis of target cells not pulsed with peptide.

7 Eur. J. Immunol : CTL escape in nonpathogenic SIV infection 3213 Table 3. Comparison of Nef sequences and viral loads in three SIVmac239-infected sooty mangabey Sequence of Nef aa Mangabey At inoculation Plasma SIV RNA (copies/ml) a) Late time Late time point b) weeks PI point b) SM FWl LLRARGETY LLQARGENY 4,220 80,700 SM FYg LLRARGETY LLQARGETY X 1,000 3,700 Sm FLg LLRARGETY LLRARGESY X 1,000 12,500 a) Plasma SIV RNA measured by quantitative competitive reverse transcription-pcr at weeks post-infection (PI) and by real-time PCR at late time point. b) Week 104 PI for Sm FWl, week 208 PI for Sm FYg and week 192 PI for Sm FLg. 2.5 Increase in viral load in association with escape mutations in mangabey Sm FWl Plasma viral RNA in all three SIVmac239-infected sooty mangabeys was analyzed longitudinally: Sm FWl with CTL escape, and Sm FYg and Sm FLg with vigorous Nef-specific CTL activity and intact recognition of a CTL epitope in the same region (aa 20 30). In contrast to mangabey Sm FWl, the set-point viremia in mangabeys Sm FYg and Sm FLg was consistently X 1,000 RNA copies/ml plasma [13]. In mangabey Sm FWl, a 20-fold increase in plasma viral RNA above that observed at 40 weeks post infection was seen at 104 weeks when escape mutations were dominant (Table 3). At this time point, the viral load in Sm FWl was 21-fold higher than in Sm FYg at week 208 post infection and 6-fold higher than in Sm FLg at week 192 post infection (Table 3), suggesting the possibility that evolution of escape sequences in mangabey Sm FWl was associated with higher rates of viral replication in vivo. 3 Discussion Here we report a longitudinal study of CTL escape in two monkeys of different species inoculated with the same stock of SIV, and document the first report of CTL escape in a sooty mangabey. We observed strong selection for nonsynonymous nucleotide changes in nef sequences in both the rhesus macaque and the sooty mangabey. A significant fraction of these nonsynonymous mutations occurred in the nucleotide sequence corresponding to the dominant Nef CTL epitope recognized by each animal. Furthermore, these changes resulted in a significant loss or abrogation of CTL recognition of the dominant variant sequences that emerged. Using the same stock of a molecularly cloned isolate of SIV, we were able to control for heterogeneity in the virus inoculum being a source of sequence variation. To minimize bias related to cloning, we used direct population sequencing to quantify changes in viral genotype in the peripheral blood. This approach can detect a viral mutant population comprising as little as 10% of the total virus population [9]. Remarkably, very few nucleotide substitutions were observed in nef in both monkeys, and all but one lead to aa substitutions. The degree of sequence variation, particularly synonymous mutations, may have been underestimated by direct sequencing since minor viral populations with point mutations not selected for by the host and hence present at a low frequency ( X 10%) would likely have been missed. Sequence variation was observed in conserved regions of Nef where aa substitutions have rarely been observed in SIV sequences in the Los Alamos [15] database, and roughly a third of these substitutions were present in regions that were defined dominant CTL epitopes. In all, these data indicate a significant degree of selective pressure on Nef, most likely exerted by CTL targeting the Nef protein. Several lines of evidence suggest that CTL were a driving force for mutations in Nef in the two SIVinfected monkeys. Two different monkeys inoculated at the same time with the same virus stock and targeting separate CTL epitopes in Nef developed unique sequence changes that resulted in loss of recognition of their CTL epitopes. In the rhesus macaque, despite a high rate of viral replication throughout infection, only nonsynonymous mutations were detected in Nef, indicating that they were not random mutations. Furthermore, at the height of Nef-specific CTL responses (week 21), only five aa changes were detected in the entire 263 aa long Nef protein, two of which were located in a dominant CTL epitope. A similar pattern of predominantly nonsynonymous mutations including aa substitutions in its CTL epitope, was observed in the sooty mangabey. Finally, the pattern of sequence variation in the sooty mangabey was unlikely to be due to a speciesspecific adaptation of SIVmac239 to its host, since it was not observed in two other SIVmac239-infected sooty mangabeys that did not have evidence of CTL escape. It should be noted that SIVmac239-infection in sooty mangabeys does not mimic natural SIV infection in this host, since it is associated with low viral loads and vigorous CTL responses [13]. Although similar selective pressures appeared to be driving sequence diversity in Nef in the two animals, each manifested a markedly different course of SIV infection. In the rhesus macaque that progressed to AIDS, we observed early complete fixation of CTL escape sequences in the Nef epitope (within the first four months) in association with an initial oligospecific CTL

8 3214 A. Kaur et al. Eur. J. Immunol : response followed by loss of CTL activity. Late partial fixation of CTL escape in the Nef epitope (more than 2 years after infection) in association with a sustained and broadly directed SIV-specific CTL response was observed in the concurrently infected sooty mangabey that did not develop AIDS. The efficiency of emergence of CTL escape mutations is likely to be dependent on the effectiveness of the CTL response, which in turn is likely to be affected by multiple factors, including the magnitude and breadth of CTL activity and the presence of T helper cells. Factors that may have contributed to the rapid evolution of CTL escape in the rhesus macaque include a high SIV replication rate (set-point viremia G 10 6 RNA copies/ml), significant CD4 + T lymphocytopenia and an ineffective CTL response. The evolution and consequences of CTL escape mutations in the background of an effective CTL response and intact T helper function are illustrated by the sooty mangabey. A low rate of viral replication (set-point viremia X 10 5 RNA copies/ml), persistent broadly directed SIV-specific CTL activity, and absence of CD4 + T lymphocytopenia, all likely contributed to the slow evolution of CTL escape mutations in the mangabey. At the last time point evaluated, the mutant sequences were present in approximately 60% of proviral DNA. However, a twenty-fold increase in plasma viral RNA was observed at this time point, suggesting that CTL escape in mangabey Sm FWl may have been associated with less effective control of viral replication. We do not know what final balance between viremia, Nef-specific CTL activity and escape mutations in Nef would have emerged if this animal had survived. A dynamic relationship between viral variation and host immune responses has been observed over time in asymptomatic HIV-infected individuals, where temporary amplification of Nef variants was followed by expansion of variant specific CTL, ultimately leading to disappearance of many epitope variants [16]. Variantspecific CTL were not detected at the time of death in this animal. However, we cannot rule out the possibility that had this animal survived, a shifting of antigenic immunodominance would have occurred and resulted in a new equilibrium between viral replication and CTL activity so as to abrogate the effect of CTL escape. Besides the breadth of CTL activity, differences in MHC alleles [17] and TCR repertoire can also determine the impact of CTL escape on disease progression. Single aa mutations in a CTL epitope can abrogate CTL recognition either by decreasing binding of peptide to class I MHC molecules or by abrogating recognition of the peptide-mhc complex by the TCR. The effect of mutations abrogating TCR recognition of the peptide-mhc complex maybe partially mitigated in the presence of a diverse TCR repertoire. In the sooty mangabey, the CTL clones targeting the Nef epitope appeared to be heterogeneous since they differed in their ability to recognize variant peptides with the T to N mutation. This may have been an additional factor contributing to the slow evolution and minimal impact of CTL escape in the sooty mangabey. The documentation of CTL escape in a sooty mangabey provides evidence that at least in the setting of SIVmac239 infection, functional CTL are generated in vivo in SIV-infected sooty mangabeys. Thus, the observation of high-level viremia and weak SIV-specific CTL activity in naturally SIV-infected sooty mangabeys is not due to a species-specific defect in mounting a functional CTL response. Whether CTL escape contributes to viral persistence and weak CTL responses in sooty mangabeys with natural SIV infection, and whether a relative deficiency of CTL activity contributes to nonpathogenic SIV infection in this natural host remains to be determined. 4 Materials and methods 4.1 Animals and virus Three adult sooty mangabeys, Sm FWl, Sm FLg and Sm FYg, and one adult rhesus macaque Mm RGa3, ranging in age from 6 to 10 years, were inoculated intravenously with 17.3 ng p27 of SIVmac239, a pathogenic molecular clone of SIV. The course of SIV infection and host immune responses in these animals have been described [13]. Two additional rhesus macaques inoculated with SIVmac239 and described in the previous report [13] were not included in the current study, since SIV-specific CTL epitopes were not mapped in these animals. Sm FWl and Mm RGa3 were infected concurrently with the same stock of SIVmac239 [13]. Mm RGa3 died of AIDS 54 weeks after SIV inoculation [13], while Sm FWl was euthanized at 104 weeks for a non- AIDS related condition (self-mutilation). Two other mangabeys, Sm FLg and Sm FYg, that were inoculated with SIVmac239 remain alive and healthy at 192 and 208 weeks after SIV infection, respectively. Animals were housed at the Yerkes Regional Primate Research Center and maintained in accordance with the guidelines of the institutional animal care and use committee and the Animal Welfare Act [18]. Blood was collected at weekly to monthly intervals for 1 year after SIV infection and thereafter, at less frequent intervals until death. Archived samples consisting of cryopreserved PBMC were stored in liquid nitrogen, and plasma or cell pellets were frozen at 80 C. 4.2 Detection of bulk SIV-specific CTL activity CTL activity was measured after in vitro antigen-specific stimulation of PBMC as previously described [13, 14]. Briefly, stimulator cells consisted of herpes papio-trans-

9 Eur. J. Immunol : CTL escape in nonpathogenic SIV infection 3215 formed autologous B-lymphoblastoid cell lines (B-LCL) infected overnight with vaccinia recombinants encoding SIV proteins and subsequently inactivated by long-wave UV irradiation in the presence of 10? g/ml psoralen (Sigma). Alternately, autologous PBMC infected with SIV vaccinia recombinants for 90 min at 37 C were used as stimulator cells. PBMC were mixed with stimulator cells at a responder to stimulator ratio of 10:1. Cells were cultured in RPMI medium supplemented with 10% FCS; 10 IU/ml of recombinant human IL-2 (donated by M. Gately, Hoffmann-La Roche) were added after 4 5 days. CTL assays were performed days after antigen-specific stimulation. 4.3 Chromium-release assay Target cells consisted of 51 Cr-labeled autologous B-LCL that had either been infected overnight with recombinant vaccinia viruses expressing individual SIV proteins, or pulsed with 100? g/ml peptide for 1 h at 37 C. Recombinant vaccinia viruses expressing SIV proteins have been described in detail previously [14]. CTL effectors were incubated with 10 4 target cells/well in 96-well U-bottom plates for 5 h at 37 C in a 5% CO 2 incubator. 51 Cr release was assayed in a 1450 MicroBeta Plus Liquid Scintillation Counter (Wallac, Finland) and cytotoxicity calculated as previously described [13]. Spontaneous release of target cells was X 25% in all assays. 4.4 Peptide synthesis Peptides with CTL epitope sequences of the parental and mutated virus were synthesized as free acids using Fmocprotected aa [14]. All peptides were reconstituted at 2 mg/ml in sterile distilled water with 10% DMSO. 4.5 Testing of SIV-specific CTL clones The isolation and characterization of SIV-specific CTL clones in sooty mangabeys has been described previously [14]. Cryopreserved CTL clones were thawed in the presence of irradiated (30 Gy) human feeder PBMC, Con A (5? g/ ml) and IL-2 (50 IU/ml). Clones were tested for CTL activity against autologous peptide-pulsed B-LCL target cells in 51 Cr-release assays. The sensitizing dose of any peptide required for 50% maximal lysis was determined by peptide titration assays as previously described [14]. 4.6 Plasma viral load Plasma SIV RNA concentrations for macaque Mm RGa3 and mangabeys Sm FWl, Sm FYg and Sm FLg were determined up to 1 year after SIV infection by a quantitative competitive reverse transcription-pcr (QC-RT-PCR) assay as reported previously [13]. Plasma SIV RNA at week 104 post infection in Sm FWl, and at weeks 194 and 208 post infection in Sm FLg and Sm FYg, respectively, were quantitated by real-time PCR (7700 Sequence Detection System, Perkin-Elmer) using primers and probe targeting a highly conserved region of the gag gene [19, 20]. Viral RNA from plasma was extracted with the QIAamp Viral RNA kit (Qiagen) and subjected to RT-PCR using random hexamers to prime reverse transcription. SIV RNA copy number was determined by comparison to an external standard curve consisting of virion-derived SIVmac239 RNA. The standards used in the real-time PCR assay had been previously quantified by the QC-RT-PCR assay used on the earlier samples [13], and were comparable in the two assays. 4.7 Isolation of cellular DNA Proviral nef sequences were longitudinally analyzed in Sm FWl and Mm RGa3 using archived cryopreserved PBMC from four time points after SIVmac239 infection. These sequences were analyzed for a single time point in Sm FLg andsmfyg.cellulardnawasextractedfrompbmcas described previously [21]. Briefly, PBMC were lysed in 0.5 ml lysis buffer containing 10 mm Tris, 0.4 M NaCl, 2 mm EDTA, ph 8.2, and 33? l of 10% SDS, and subjected to proteinase K digestion for 1 h at 56 C. After lysis, DNA was extracted using NaCl and isopropanol. 4.8 Amplification of SIVmac239 nef sequences One microgram of cellular DNA isolated from PBMC of the three sooty mangabeys and the one rhesus macaque served as the template for PCR amplifications of the nef region of the SIV genomes. Primers that annealed to the envelope 5 GCCGTCTGGAGATCTGCGACAG 3 and 3 LTR regions 5 GCAGAGCGACTGAATACAGAGCGAAA 3, respectively, were used to amplify the region spanning nef. These primers were designed with annealing temperatures of approximately 70 C as determined by the Oligo Primer Analysis program (National Biosciences, Plymouth, MN). A 200-? l reaction volume was used which included 2 U rtthxl (Perkin-Elmer Cetus, Norwalk, CT), 200 mm dntp and 0.2? M of each primer. This mixture was preheated for 60 s at 80 C before 1.0 mm magnesium acetate was added. The sample was then placed into an Omnigene PCR cycler (Hybaid, Franklin, MA) that was preheated to 80 C. Seventy five cycles of PCR were used to amplify SIVmac239 nef sequences. Each cycle consisted of a 93 C denaturation step followed by a rapid cooling step to 70 C and a slow cooling step to 60 C, which was carried out for 25 s. 4.9 SIVmac239 nef sequence analysis SIV nef DNA sequences were determined using an ABI 377 DNA sequencer (Perkin Elmer Cetus). The sense and antisense strands of two independent PCR amplifications from

10 3216 A. Kaur et al. Eur. J. Immunol : each sample were sequenced directly using Big Dye terminators (Perkin Elmer Cetus) and the consensus sequence generated from these reactions was used for further analysis. Sequence editing and assembly was performed with the Sequencher program (Gene Codes). Ambiguous sequences at sites with a mixture of bases were read manually using the predominant base in all the PCR reactions. Assessment of the ratio of nucleotides at polymorphic loci within the mapped CTL epitope regions in nef, was performed by analysis of the area under the curve of sequence chromatographs. The relative area was reported as the relative frequency of each nucleotide at a particular locus. These values were reproducible in replicate experiments and had a margin of error of roughly ±5% Statistical analysis The rates of synonymous nucleotide substitution per synonymous site (ds) and nonsynonymous nucleotide substitution per nonsynonymous site (dn) were computed by the method of Nei and Gojobori [22] using the online program SNAP (Synonymous Nonsynonymous Analysis Program; Theunpairedt-test was used to compare the group means of ds and dn at each time point for individual animals. Acknowledgements: This work was supported by Public Health Services Grants RR00168, AI38559, AI25328, RR00165, DA12121 and AI R.P.J. and M.B.F. are Elizabeth Glaser Scientists of the Pediatric AIDS Foundation. References 1 Desrosiers,R.C.,Strategies used by human immunodeficiency virus that allow persistent viral replication. Nat. Med : Burns, D. P. and Desrosiers, R. C., Selection of genetic variants of simian immunodeficiency virus in persistently infected rhesus monkeys. J. Virol : Borrow, P., Lewicki, H., Wei, X., Horwitz, M. S., Peffer, N., Meyers, H., Nelson, J. A., Gairin, J. E., Hahn, B. H., Oldstone, M. B. and Shaw, G. M., Antiviral pressure exerted by HIV-1- specific cytotoxic T lymphocytes (CTLs) during primary infection demonstrated by rapid selection of CTL escape virus. Nat. Med : Goulder, P. J., Phillips, R. E., Colbert, R. A., McAdam, S., Ogg, G., Nowak, M. A., Giangrande, P., Luzzi, G., Morgan, B., Edwards, A., McMichael, A. J. and Rowland-Jones, S., Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nat. Med : Evans, D. T., O Connor, D. H., Jing, P., Dzuris, J. L., Sidney, J., da Silva, J., Allen, T. M., Horton, H., Venham, J. E., Rudersdorf, R. A., Vogel, T., Pauza, C. D., Bontrop, R. E., DeMars, R., Sette,A.,Hughes,A.L.andWatkins,D.I.,Virus-specific cytotoxic T-lymphocyte responses select for amino-acid variation in simian immunodeficiency virus Env and Nef. Nat. Med : Allen, T. M., O Connor, D. H., Jing, P., Dzuris, J. L., Mothe, B. R., Vogel, T. U., Dunphy, E., Liebl, M. E., Emerson, C., Wilson, N., Kunstman, K. J., Wang, X., Allison, D. B., Hughes, A. L., Desrosiers, R. C., Altman, J. D., Wolinsky, S. M., Sette, A. and Watkins, D. I., Tat-specific cytotoxic T lymphocytes select for escape variants during resolution of primary viraemia. Nature : Coffin, J. M., HIV population dynamics in vivo: implications for genetic variation, pathogenesis, and therapy. Science : Pircher, H., Moskophidis, D., Rohrer, U., Burki, K., Hengartner, H. and Zinkernagel, R. M., Viral escape by selection of cytotoxic T cell-resistant virus variants in vivo. Nature : Wei, X., Ghosh, S. K., Taylor, M. E., Johnson, V. A., Emini, E. A., Deutsch, P., Lifson, J. D., Bonhoeffer, S., Nowak, M. A. and Hahn, B. H., Viral dynamics in human immunodeficiency virus type 1 infection. Nature : Meyerhans, A., Dadaglio, G., Vartanian, J. P., Langlade- Demoyen, P., Frank, R., Asjo, B., Plata, F. and Wain-Hobson, S., In vivo persistence of a HIV-1-encoded HLA-B27-restricted cytotoxic T lymphocyte epitope despite specific in vitro reactivity. Eur. J. Immunol : Brander, C., Hartman, K. E., Trocha, A. K., Jones, N. G., Johnson, R. P., Korber, B., Wentworth, P., Buchbinder, S. P., Wolinsky, S., Walker, B. D. and Kalams, S. A., Lack of strong immune selection pressure by the immunodominant, HLA- A*0201-restricted cytotoxic T lymphocyte response in chronic human immunodeficiency virus-1 infection. J. Clin. Invest : Koenig, S., Conley, A. J., Brewah, Y. A., Jones, G. M., Leath, S.,Boots,L.J.,Davey,V.,Pantaleo,G.,Demarest,J.F.and Carter, C., Transfer of HIV-1-specific cytotoxic T lymphocytes to an AIDS patient leads to selection for mutant HIV variants and subsequent disease progression. Nat. Med : Kaur, A., Grant, R. M., Means, R. E., McClure, H., Feinberg, M. and Johnson, R. P., Diverse host responses and outcomes following simian immunodeficiency virus SIVmac239 infection in sooty mangabeys and rhesus macaques. J. Virol : Kaur, A., Yang, J., Hempel, D., Gritz, L., Mazzara, G. P., McClure, H. and Johnson, R. P., Identification of multiple simian immunodeficiency virus (SIV)-specific CTL epitopes in sooty mangabeys with natural and experimentally acquired SIV infection. J. Immunol : Korber, B., Foley, B., Letner, T., McCutchan, F., Hahn, B., Mellors, J. W., Myers, G. and Kuiken, C. (Eds.) Human retroviruses and AIDS; a compilation and analysis of nucleic acid and amino acid sequences, theoretical biology and biophysics. Los Alamos National Laboratory, Los Alamos Haas, G., Plikat, U., Debre, P., Lucchiari, M., Katlama, C., Dudoit, Y., Bonduelle, O., Bauer, M., Ihlenfeldt, H. G., Jung, G., Maier, B., Meyerhans, A. and Autran, B., Dynamics of viral variants in HIV-1 Nef and specific cytotoxic T lymphocytes in vivo. J. Immunol : Wilson, C. C., Kalams, S. A., Wilkes, B. M., Ruhl, D. J., Gao, F., Hahn, B. H., Hanson, I. C., Luzuriaga, K., Wolinsky, S., Koup, R., Buchbinder, S. P., Johnson, R. P. and Walker, B. D., Overlapping epitopes in human immunodeficiency virus type 1 gp120 presented by HLA A, B, and C molecules: effects of viral variation on cytotoxic T-lymphocyte recognition. J. Virol : Anonymous, Guide for the Care and Use of Laboratory Animals. The Institute of Laboratory Animal Resources, National Research Council, 1996, pp

11 Eur. J. Immunol : CTL escape in nonpathogenic SIV infection Staprans, S. I., Corliss, B. C., Guthrie, J. L. and Feinberg, M. B., Quantitative methods to monitor viral load in simian immunodeficiency virus infections. In Adolphm K. W. (Ed.) Viral genome methods. CRC Press, Boca Raton 1996, pp Staprans, S. I., Dailey, P. J., Rosenthal, A., Horton, C., Grant, R. M., Lerche, N. and Feinberg, M. B., Simian immunodeficiency virus disease course is predicted by the extent of virus replication during primary infection. J. Virol : Alexander,L.,Weiskopf,E.,Greenough,T.C.,Gaddis,N.C., Auerbach,M.R.,Malim,M.H.,O Brien,S.J.,Walker,B.D., Sullivan, J. L. and Desrosiers, R. C., Unusual polymorphisms in human immunodeficiency virus type 1 associated with nonprogressive infection. J. Virol : Nei, M. and Gojobori, T., Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol : Correspondence: Amitinder Kaur, Division of Immunology, New England Regional Primate Research Center, One Pine Hill Drive, Southborough, MA 01772, USA Fax: amitinder kaur hms.harvard.edu L. Alexander s present address: Department of Epidemiology and Public Health, Yale University School of Medicine, New Haven, CT 06520, USA