Interferon alpha (IFN- ) is a key cytokine of the innate

Transcription

1 GASTROENTEROLOGY 2011;140: Hepatitis B Virus Limits Response of Human Hepatocytes to Interferon- in Chimeric Mice MARC LÜTGEHETMANN,*, TILL BORNSCHEUER,* TASSILO VOLZ,* LENA ALLWEISS,* JAN HENDRICK BOCKMANN,* JOERG M. POLLOK, ANSGAR W. LOHSE,* JOERG PETERSEN, and MAURA DANDRI* *Department of Internal Medicine, University Medical Hospital Hamburg-Eppendorf, Hamburg; Department of Medical Microbiology, Virology and Hygiene, University Medical Hospital Hamburg-Eppendorf, Hamburg; Department of Hepatobiliary Surgery, University Hospital Hamburg-Eppendorf, Hamburg; IFI Institute for Interdisciplinary Medicine at Asklepios Clinic St. Georg, Hamburg, Germany BACKGROUND & AIMS: Interferon (IFN)- therapy is not effective for most patients with chronic hepatitis B virus (HBV) infection for reasons that are not clear. We investigated whether HBV infection reduced IFN- mediated induction of antiviral defense mechanisms in human hepatocytes. METHODS: Human hepatocytes were injected into severe combined immune-deficient mice (SCID/beige) that expressed transgenic urokinase plasminogen activator under control of the albumin promoter. Some mice were infected with HBV; infected and uninfected mice were given injections of human IFN-. Changes in viral DNA and expression of human interferon-stimulated genes (ISGs) were measured by real-time polymerase chain reaction, using humanspecific primers, and by immunohistochemistry. RE- SULTS: Median HBV viremia (0.8log) and intrahepatic loads of HBV RNA decreased 3-fold by 8 or 12 hours after each injection of IFN-, but increased within 24 hours. IFN- activated expression of human ISGs and nuclear translocation of signal transducers and activators of transcription 1 (STAT1) in human hepatocytes that repopulated the livers of uninfected mice. Although baseline levels of human ISGs were slightly increased in HBV-infected mice, compared with uninfected mice, IFN- failed to increase expression of the ISGs OAS-1, MxA, MyD88, and TAP-1 (which regulates antigen presentation) in HBV-infected mice. IFN- did not induce nuclear translocation of STAT1 in HBVinfected human hepatocytes. Administration of the nucleoside analogue entecavir (for 20 days) suppressed HBV replication but did not restore responsiveness to IFN-. CONCLUSIONS: HBV prevents induction of IFN- signaling by inhibiting nuclear translocation of STAT1; this can interfere with transcription of ISGs in human hepatocytes. These effects of HBV might contribute to the limited effectiveness of endogenous and therapeutic IFN- in patients and promote viral persistence. Keywords: cccdna; upa; Antiviral Therapy; Innate Immunity. Interferon alpha (IFN- ) is a key cytokine of the innate immune response displaying both immune regulatory and antiviral activities. By binding to the type I IFN cellular receptor, IFN- directly stimulates intracellular signaling cascades involving translocation of activated signal transducers and activators of transcription (STAT) proteins into the nucleus, where they can induce an antiviral state characterized by expression of hundreds of different interferon-stimulated genes (ISGs). Some of these ISGs products, such as 2=-5= oligoadenylate synthase 1 (OAS-1) and myxovirus resistance protein A (MxA), are direct antiviral effectors, others encode for various pattern-recognition receptors, such as the tolllike receptors (TLRs), as well as for related adaptor molecules, such as the myeloid differential primary response protein (MyD88). Other ISG products play essential roles in antigen processing and presentation. During the last several years, it has been shown that several viruses, such as hepatitis C virus, influenza viruses, Sendai virus, and measles viruses, developed mechanisms to directly resist host innate immunity by suppressing the activation of ISGs. 1 The mechanism leading to hepatitis B virus (HBV) persistence is not fully understood, but it is thought to be multifactorial. Although the presence of the HBV transcriptional template, the covalently closed circular viral minichromosome (cccdna) permits maintenance of infection in hepatocyte nuclei, viral components may also contribute to circumvent activation of the immune response. Although recent studies detected transient activation of cellular components of the innate system in early phases of acute HBV infection in patients, 2,3 chronic Abbreviations used in this paper: cccdna, covalently closed circular DNA; ETV, entecavir; IFN, interferon; ISGs, interferon-stimulated genes; MHC, major histocompatibility complex; MxA, mixovirus resistance protein A; OAS-1, 2=-5= oligoadenylate synthase 1; PCR, polymerase chain reaction; pgrna, pregenomic RNA; rcdna, relaxed circular DNA; SCID, severe combined immune-deficient; STAT, signal transducers and activators of transcription; TLR, Toll-like receptor; upa, urokinase plasminogen activator by the AGA Institute /$36.00 doi: /j.gastro

2 June 2011 HBV-INDUCED INHIBITION OF THE IFN SYSTEM 2075 HBV infection is generally distinguished by dysfunctional innate and adaptive immune responses. 4 Experimental studies have also shown that type I IFNs are not induced in infected chimpanzees. 5 Although IFN- administration has shown to inhibit HBV replication in vitro and in vivo, 6 8 a large number of individuals, particularly those displaying high viral loads, respond poorly to IFN- treatment, suggesting that HBV may have evolved mechanisms to antagonize the IFN response. The lack of efficient models of HBV infection has hampered the investigation of the interplay between HBV and the IFN system of the host, as well as the study of the molecular mechanisms responsible for the ineffectiveness of IFN treatment. In this study, severe combined immune-deficient (SCID/beige) mice transgenic for the urokinase plasminogen activator (upa) under control of the albumin promoter were used to repopulate mouse livers with primary human hepatocytes derived from one liver donor. 9,10 The lack of an adaptive immune response in these mice permits investigations of in vivo interactions between HBV and the innate immune response of the human hepatocytes, the natural target cell of infection and replication. Experimental Procedures Generation of Human Chimeric Mice, HBV Infection Experiments, and Treatments upa transgenic mice (Jackson Laboratories, Bar Harbor, ME) crossed with SCID/beige mice (Taconic Farms, Laven, Denmark) were housed and maintained under specific pathogen-free conditions in accordance with institutional guidelines under approved protocols. The presence of the upa transgene and maintenance of the SCID phenotype were determined as reported. 10,11 Three to 4-week-old homozygous upa SCID/beige mice were anesthetized with isoflurane and injected intrasplenically with viable thawed human hepatocytes isolated from one liver specimen obtained from a reduced-sized liver transplant (C/C variant for IL28B locus). Procedures were approved by the Ethical Committee of the city and state of Hamburg and according to the principles of the Declaration of Helsinki. Informed consent was obtained from donors. Human hepatocyte repopulation levels were determined by measuring human serum albumin in mouse serum with the human albumin enzyme-linked immunosorbent assay quantitation kit (Bethyl Laboratories, Biomol GmbH, Hamburg, Germany). Human chimeric animals displaying human serum albumin concentrations of 1 mg/ml were used for the study. To establish HBV infection, animals received a single intraperitoneal injection of mouse-derived HBVpositive serum ( HBV genome equivalents, genotype D). Stably HBV-infected animals ( 10 weeks post- HBV injection) and uninfected chimeric mice received either IFN- (1350 IU/g body weight, daily) or saline. For entecavir (ETV) treatment, mice received drinking water supplemented with 1 g/ml Baraclude Solution (Bristol- Myers Squibb, Munich, Germany). Mice were sacrificed at established time points as indicated in the Results. Liver specimens removed at sacrifice were snap-frozen in liquid nitrogen for further histological and molecular analyses. All animal experiments were conducted in accordance with the European Communities Council Directive (86/ EEC) and were approved by the City of Hamburg, Germany. Virological Measurements Viral DNA was extracted from serum samples using the QiAamp MinElute Virus Spin Kit (Qiagen, Hilden, Germany). Real-time PCR was performed in a LightCycler (Roche Applied Science, Mannheim, Germany) using HBV-specific primers and FRET-hybridization probes as reported. 12 Known references of cloned HBV-DNA were amplified in parallel to establish a standard curve for quantification. DNA and RNA were extracted from mouse liver specimens using the MasterPure DNA purification kit (Epicentre, Madison, WI) and RNeasy RNA purification kit (Qiagen, Hilden, Germany). 12 Intrahepatic HBV-DNA values were normalized for cellular DNA contents using the -globin gene kit (Roche Applied Science, Mannheim, Germany), which recognize sequences of human origin. 10,11 After treating purified DNA with 20 U plasmidesafe DNAase I (Epicentre) to enrich the cccdna fraction, intrahepatic cccdna amounts were determined using cccdna-specific primers and FRET hybridization probes as reported. 12 The rcdna levels were estimated by subtracting cccdna amounts from the total HBV-DNA. Viral RNA was reverse transcribed from 1 g total RNA using oligo-dt primers and the Transcriptor Kit (Roche Applied Science) and quantified by using primers specific for pregenomic RNA (pgrna). 12 Steady-state levels of intrahepatic pgrna amounts were normalized using human specific glyceraldehyde-3-phosphate dehydrogenase primers (Qiagen). 10 Analysis of Human Gene Expression To determine expression levels of genes related to the IFN signaling in human hepatocytes repopulating the mouse liver parenchyma, primers specifically recognizing human transcripts and not cross-reacting with murine genes were designed and validated by real-time polymerase chain reaction (PCR) by using artificial mixtures of human and mouse oligo-dt reverse transcribed complementary DNAs. Human glyceraldehyde-3-phosphate dehydrogenase was used for normalization. The sequences of human and mouse specific primers are reported in Supplementary Table 1. Immunohistochemistry Cryostat sections of transplanted mouse livers were immunostained 10,11 with a cytokeratin 18 monoclo-

3 2076 LÜTGEHETMANN ET AL GASTROENTEROLOGY Vol. 140, No. 7 nal antibody (1:400 dilution, Dako Diagnostika, Hamburg, Germany) or a polyclonal rabbit anti-sp100 antibody (1:1000 dilution, kindly provided by H. Will) recognizing human cytokeratin 18 and SP100, respectively and not cross-reacting with mouse proteins. Major histocompatibility complex I (MHC-I) was detected with a mouse anti pan-mhc antibody (1:50 dilution; Leinco Technologies, St Louis, MO), STAT1 with human anti STAT1 (1:200 dilution; BD Transduction Laboratories, Heidelberg, Germany), HBcAg with rabbit anti HBcAg antiserum (1:2000; Dako) and TAP-1 with a human specific antibody (1:80 dilution, Santa Cruz Biotechnology, Heidelberg, Germany). Specific signals were visualized with Alexa 488 or 546 labeled secondary antibodies or TSA Fluorescein System (Perkin Elmer, Waltham, MA) and nuclear staining was achieved by DRAQ5 (1:2000 dilution; Axxora, Lörrach, Germany). Stained sections were mounted with flourescein mounting media (Dako) and analyzed by confocal laser scanning microscopy (Leika, Germany) using the same settings for the different experimental groups. Statistics. The Mann Whitney U test was used for nonparametric pair wise comparisons. P values.05 were considered significant. Results Kinetics of Expression of IFN- Induced ISGs in Chimeric upa/scid Mice upa/scid mice harboring human hepatocytes expected to be IFN responsive based on the polymorphism analysis of the IL28B locus, were first used to determine the in vivo kinetics of ISG activation induced by human IFN- in the livers of upa/scid mice. Nineteen chimeric animals receiving a single dose of human IFN- were sacrificed at 4 hours (n 2), 8 hours (n 7), 12 hours (n 4), 16 hours (n 3), and 24 hours (n 3) post-injection and compared to baseline expression levels (n 7). Expression levels of human OAS-1, MxA, MyD88, TLR2, TLR4, as well as of genes of the antigen presentation pathway (HLA-A, HLA-E, and TAP-1) were measured by real-time PCR using human specific primers not cross-reacting with murine sequences (Supplementary Figure 1A). For all genes analyzed the highest ISG activation levels were achieved between 8 and 12 hours after IFN administration. Figure 1 shows representative kinetics of responses determined for human MxA (up to 60-fold induction), OAS-1 ( 24-fold induction), and HLA-A ( 35-fold induction). Furthermore, analysis performed by using primers exclusively recognizing the corresponding ISG murine transcripts indicated that treatment with human IFN- (1350 IU/g body weight) failed to induce the IFN response in liver cells Figure 1. Kinetics of IFN- induced activation of ISGs in human hepatocytes within the liver of upa/scid mice. Human chimeric mice were sacrificed either before (0 hours) or at different time points (as indicated) after IFN injection to determine steady-state levels of human (top panel) MxA, (middle panel) OAS-1, and (bottom panel) HLA-A RNAs by realtime polymerase chain reaction and using human specific primers. ISG expression levels are expressed on a log scale and are normalized to human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) amounts. Maximal activation was achieved 12 hours postinjection and in most cases returned to baseline within 24 hours. of murine origin (Supplementary Figure1B), suggesting that in this experimental setting human interferon induced several human ISGs, but not the corresponding murine genes.

4 June 2011 HBV-INDUCED INHIBITION OF THE IFN SYSTEM 2077 Figure 2. Temporary inhibition of HBV replication induced by daily IFN- treatment in human chimeric mice. Twenty HBV-infected mice displaying median viremia of HBV copies/ml serum were treated either with IFN- (n 12) or saline (n 8). After 5 days of treatment, mice were sacrificed at 8 hours (n 8), 12 hours (n 5), and 24 hours (n 3) after the last IFN injection to determine viremia reduction (A), intrahepatic covalently closed circular DNA (cccdna) copies per human hepatocytes (B), as well as reduction of virion productivity. Between 8 and 12 hours post-ifn administration, a significant, but short lasting, decrease of both (C) pgrna/cell and (D) rcdna/cccdna molecule was determined. Virological Changes Induced by IFN- Treatment in Chimeric upa/scid Mice To determine the direct antiviral activity of IFN- in HBV-infected hepatocytes, 20 mice displaying stable viremia levels (median, HBV DNA copies/ml; range, ) received either daily injections of human IFN- for 5 days (n 12), or saline (n 8). IFN treatment induced a median 0.8log (range, log) and 0.5log (range, log) viremia reduction compared to pretreatment levels when animals were analyzed 8 hours (n 5) and 12 hours (n 4) after the last IFN administration (Figure 2A). However, comparative analysis of viremia changes performed in single mice revealed that viremia rebound occurred within 24 hours after IFN injection, indicating that the direct antiviral effect induced by administration of regular human IFN was short-lasting in vivo (Supplementary Figure 2). To determine the impact of 5 days of IFN treatment on intrahepatic viral activity, HBV-infected mice were sacrificed either at 8 hours (n 5), 12 hours (n 4), or 24 hours (n 3) after the last IFN application and compared to a group of untreated mice (n 8) displaying comparable viral titers (Supplementary Figure 2). DNA and complementary DNA samples obtained from liver specimens were analyzed by real-time PCR to determine human hepatocyte contents (human genome equivalents), intrahepatic cccdna loads, as well as viral RNA expression levels. As expected, levels of cccdna per human hepatocyte did not differ significantly among animal groups (Figure 2B), indicating that intrahepatic HBV infection levels were comparable among mice and that 5 days of IFN administration did not decrease intrahepatic cccdna loads. Compared to baseline levels, a significant reduction of steady-state pgrna levels ( 3-fold) (Figure 2C) and replicative activity (rcdna copies/cccdna molecule) (Figure 2D) was determined at both 8 and 12 hours after IFN administration in chronically infected mice. As observed by analyzing the viremia levels, reduction of steady-state levels of HBV transcripts was short-lasting and re-establishment of baseline HBV transcript levels was determined in the animals analyzed 24 hours after IFN injection. Impairment of IFN- Mediated Enhancement of ISGs Transcription in HBV-Infected Human Hepatocytes in upa/scid Mice To determine whether IFN- responsiveness of human ISGs in HBV-infected mice was similar to the

5 2078 LÜTGEHETMANN ET AL GASTROENTEROLOGY Vol. 140, No. 7 Figure 3. Impaired responsiveness of human ISGs to IFN- treatment in HBV chronically infected livers of human chimeric mice. Intrahepatic RNA expression levels of (A) human MxA and OAS-1, as well as of (B) TLR2, TLR4, and adaptor molecule MyD88 were analyzed at 8 hours or 12 hours after the last IFN-injection both in HBV-infected (n 16) and uninfected control mice (n 18) and compared to levels found in the livers of untreated HBV-infected (n 8) and uninfected (n 7) mice. *Enhancement of ISG expression levels was highly significant (P.001) in uninfected animals, although it did not reach significance in HBV-chronically infected mice (n.s.). response induced in uninfected mice repopulated with human hepatocytes derived from the same donor liver, expression levels of human ISGs were determined both in uninfected and HBV-infected mice receiving 5 days of IFN- treatment. As shown in Figure 3, median baseline transcription levels of human ISGs were slightly elevated in HBV-infected chimeric mice compared to uninfected animals, although statistical significance was achieved only for MxA and TLR4 (P.01) genes and no significant correlation between ISG levels and viremia could be established among stably HBV-infected mice. Notably, transcription levels of human MxA and OAS-1 significantly increased (P.001) in uninfected animals after IFN- administration (median, 38.4-fold and 16-fold induction, respectively, at 12 hours), compared to levels determined in untreated and uninfected controls analyzed in parallel, while IFN- treatment was not able to increase significantly the levels of MxA and OAS-1 in HBV-infected mice (P.3), indicating that induction of these ISGs was impaired in HBV-infected human hepatocytes. Expression analysis of human genes of the TLR pathways (Figure 3B) revealed that IFN administration did not induce significant changes (P.1) of steady-state levels of TLR2 and TLR4 transcripts in HBV-infected mice, while the same treatment remarkably enhanced levels of TLR2 and TLR4 (P.001) in mice harboring uninfected human hepatocytes (median, 44.4-fold and 28.9-fold induction, respectively). A clear block of MyD88 induction was also determined after IFN treatment of HBV-infected mice, while a 6- to 15-fold increase of human MyD88 expression levels (P.001) was induced at 8 and 12 hours, respectively, in the absence of HBV infection (Figure 3B). Primers were also designed to investigate expression levels of genes of the antigen presentation. A strong induction of human HLA-I genes (HLA-A median, fold; P.001 and HLA-E median, 118-fold induction; P.001) was measured in IFN-treated uninfected mice. Notably, a significant increase of HLA-I gene expression was also determined in HBV-infected mice (HLA-A median, 7.1-fold and HLA-E median, 11.8-fold induction) 12 hours post-ifn application, although it did not reach levels comparable to those found in uninfected livers, indicating that HBV infection did not hinder enhancement of HLA-I expression levels efficiently (Figure 4A B). Nevertheless, quantitative measurements of human

6 June 2011 HBV-INDUCED INHIBITION OF THE IFN SYSTEM 2079 Figure 4. IFN-mediated up-regulation of a subset of genes of the antigen presentation is impaired by HBV infection in vivo. Quantitative intrahepatic RNA measurements performed in livers of animals sacrificed either at 8 and 12 hours post-ifn injection revealed that IFN-induced enhancement of (A) HLA-A and (B) HLA-E expression levels was not significantly restrained by HBV infection, while induction of (C) human TAP-1 gene expression, a key regulatory element of the antigen presentation pathway, reached significance only in mice harboring uninfected human hepatocytes. *P.001. TAP-1 transcripts revealed that IFN- significantly enhanced steady-state expression levels of this key factor of the antigen presentation pathway in uninfected human chimeric mice (median, 15.4-fold induction at 12 hours post-ifn treatment; P.001), while HBV infection clearly restrained the induction of TAP-1 (Figure 4C; P.10). To confirm our findings at protein level, we performed confocal analysis of immunostained liver samples. HLA-I protein levels were barely detectable in uninfected, untreated human hepatocytes, slightly elevated in untreated, HBV chronically infected mice and strongly enhanced in all mice treated with IFN, regardless of the HBV infection status (Figure 5A). The lack of IFN-stimulated enhancement of TAP-1 expression determined by real-time PCR in HBV-infected mice could be confirmed at protein level by immunohistochemistry and confocal analysis (Figure 5B), because high levels of TAP-1 protein levels were exclusively found in uninfected, IFN-treated chimeric mice. HBV Prevents Nuclear Translocation of STAT-1 After Administration of IFN- Activation and translocation of STAT proteins are necessary to initiate transcription of ISGs in nuclei of IFN-stimulated cells and many viruses have evolved strategies to block the activation and/or translocation of STAT proteins to the cell nucleus in response to IFN stimulation. 13 To study the molecular mechanisms of inhibition of ISG enhancement measured in HBVinfected hepatocytes after treating animals with IFN-, livers of uninfected and HBV-infected mice sacrificed at 4, 8, and 12 hours after IFN injection were analyzed by indirect immunofluorescence using antibodies that specifically recognize human STAT-1. As shown in Figure 6, STAT translocation was promptly detected in human hepatocyte nuclei reconstituting the liver of HBV-uninfected mice already at 4 hours after IFN injection. In contrast, analysis of HBV-infected mice revealed that STAT-1 translocation was severely impaired in human hepatocytes. This could represent an important mechanism by which HBV can antagonize the induction of the IFN signaling in vivo. Treatment With Polymerase Inhibitors Failed to Restore ISG Induction in HBV-Infected Hepatocytes To address the question whether reduction of viral replication induced by antiviral treatment may partially restore the cellular response to IFN-, 6 HBV chronically infected chimeric mice displaying stable viral titers ranging between and HBV- DNA/mL (median, ) were orally treated with ETV. Viremia levels strongly decreased in all mice (median, HBV-DNA/mL; range, to ) after 2 weeks of ETV treatment. After that, IFN- was administered in combination with ETV to 3 mice from day 15 to 20. Despite the low viremia levels achieved in those 3 mice sacrificed 12 hours after the last IFN injection ( HBV-DNA/mL serum), 5 days of combination therapy was not able to enhance human ISG induction in HBV-infected cells. As shown in Figure 7, IFN- treatment strongly enhanced human ISG expression in uninfected mice compared to baseline levels, but did not increase expression of the same genes in HBV-infected mice even when mice were treated for 20 days with this potent polymerase inhibitor. Because ETV induced a 3log viremia reduction by inhibiting rcdna production without affecting the synthesis of viral proteins, as could be seen by HBcAg staining (Supplementary Figure 3), it may be possible that the presence of intracellular viral proteins was still responsible for the lack of induction of the IFN signaling.

7 2080 LÜTGEHETMANN ET AL GASTROENTEROLOGY Vol. 140, No. 7 Figure 6. The nuclear translocation of STAT-1 in response to IFN- is inhibited in HBV-infected human hepatocytes. Immunofluorescence analysis of uninfected (upper panels) and HBV-infected (lower panels) chimeric livers derived from mice sacrificed 4 hours after injection of IFN-. Double staining with human SP100 antibodies (red-pink dots in cell nuclei, left panels) and STAT antibodies (green, right panels) permit to identify the human hepatocytes within the mouse livers, as well as nuclear accumulation of STAT-1 in not-infected human hepatocytes. 4=,6-Diamidino-2-phenylindole staining (left panels) was also used to identify all cell nuclei in liver sections. Figure 5. HBV infection blocks the IFN-induced enhancement of TAP-1, but not of HLA proteins in human hepatocytes repopulating the livers of upa/ SCID mice. Confocal analysis of immunostained liver samples shows (A) barely detectable levels of HLA class I proteins (green) in uninfected and untreated human hepatocytes (left, upper panel), which are slightly elevated in untreated, HBV-positive mouse livers (left, lower panel) and become strongly increased after IFN- treatment both in uninfected and HBV-infected human hepatocytes (right panels). (B) Double staining with human specific cytokeratin 18 antibodies (red, left panels) permits identification of human hepatocytes in upa mouse livers as well as protein levels of human TAP-1 (green, right panels). In agreement with the RNA measurements, IFN treatment specifically increases human TAP-1 protein levels in the liver of uninfected animals (upper panel), while TAP-1 levels remain barely detectable in HBV-positive mice. Discussion In this study, we first analyzed the kinetics of ISG activation induced by IFN- administration in primary human hepatocytes after repopulation of upa/scid mouse livers. Our measurements revealed that injection of human IFN- strongly enhanced expression levels of ISGs in human hepatocytes (Figure 1), confirming that human hepatocytes transplanted into upa/scid mice possess functional IFN signaling and maintain the capability to respond to stimuli induced by exogenously applied IFNs. The analysis of murine transcripts also showed that human IFN- was unable to induce the corresponding mouse ISGs, indicating that in our experimental setting such treatment was not sensed by the mouse system (Supplementary Figure 1). Thus, it is unlikely that changes occurring in mouse cells significantly affected the human hepatocyte response. ISGs such as MxA, OAS-1, and genes of the TLR pathways, reached high steady-state expression levels between 8 and 12 hours after IFN administration, started to decline thereafter and, in most cases, returned to baseline levels within 24 hours before the next daily injection of IFN was given. Notably, comparable short-lived effects of IFN treatment were assessed in mice receiving a single injection or 5 days of daily IFN- administration. Moreover, the same kinetics of transcriptional response had been reported for uninfected chimpanzees, where most ISGs returned to baseline within 24 hours. 14 Although IFN- administration significantly reduced viremia levels (median 0.8 log) in HBV- infected mice, the

8 June 2011 HBV-INDUCED INHIBITION OF THE IFN SYSTEM 2081 Figure 7. Suppression of HBV replication induced by ETV treatment was unable to re-establish the IFN- response in HBV-infected hepatocytes. Human specific primers were used to determine expression levels of the indicated ISGs both in uninfected (light gray columns), HBV-infected (dark gray columns), and ETV-treated mice (black columns). Shown are the folds of ISGs induction relative to values determined in the respective untreated control groups (either uninfected or HBV-infected mouse livers). antiviral effect was also remarkably short-lasting and appeared to be abolished within 24 hours. Such transitory antiviral effects may explain some discrepancies with previous studies involving single time point analysis. 15 Intrahepatic measurements correlated with viremia changes, revealing a temporary decrease of both pgrna (3-fold) and rcdna/cccdna (4-fold) levels, while cccdna contents remained unchanged, indicating that exogenously applied IFN treatment could not reduce cccdna loads directly (Figure 2) and confirming previous studies performed in HBV transgenic mice where cccdna was detected. 16 Further studies will be addressed to define whether longer treatment periods and use of pegylated IFN may affect cccdna stability in these mice. However, immune-mediated elimination of infected hepatocytes and compensatory cell growth may remain the key determinants inducing significant reduction of intrahepatic cccdna loads in vivo. 17 Previous reports showed that IFN-mediated suppression of viral replication in HBV-transgenic mice mainly occurred through intracellular destabilization of the HBV nucleocapsids. 8,18 Further studies will be needed to elucidate whether reduction of HBV transcripts in human hepatocytes was also due to pgrna destabilization or down-regulation of cccdna transcription. 19,20 Considering that IFN regulatory elements are present on the HBV cccdna and that the kinetics of IFN-mediated HBV suppression matched with the kinetics of ISG induction, it might be that common molecular mechanisms are simultaneously involved in both suppression of HBV transcription and induction of several ISGs A major finding of the study was that IFN administration failed to promote detectable nuclear translocation of STAT-1 in HBV-infected human hepatocytes, although STAT-1 nuclear accumulation was promptly induced in uninfected human hepatocytes (Figure 6). These results strongly support recent in vitro studies showing that transient overexpression of the HBV polymerase inhibited STAT translocation in hepatoma cell lines and consequently impaired STAT-mediated induction of the MyD88 IFN-inducible promoter. 24 The inhibition of STAT translocation may provide one mechanistic explanation for the impairment of ISG induction determined in HBV-infected human hepatocytes (Figure 3) and suggests that circumvention of the activation of innate immune responses may contribute to the limited effectiveness of endogenous and therapeutically applied IFN in HBV infection and thereby promote viral persistence. Transient restoration of HBV-specific T-cell activity was determined after treatment of chronic HBV-infected patients with lamivudine, suggesting an inverse relationship between viremia levels and immune cell responsiveness. 25 In this study, strong impairment of ISG induction was also observed in mice that had been treated for 20 days with the polymerase inhibitor ETV (Figure 7). Despite the 3log reduction of viremia achieved in animals receiving the ETV IFN combination treatment, the intracellular production of HBV proteins remained unchanged (Supplementary Figure 3). It is plausible that the presence of intracellular viral components, rather than circulating virions, continued to interfere with the induction of the IFN signaling in this experimental setting. Because liver cells isolated from a human donor with IL28B C/C genetic polymorphism were used to reconstitute the livers of all animals used in the study, these results strongly indicate that the lack of susceptibility to IFN- treatment was due to the HBV infection and not to host variations, such as genetic polymorphisms, known to affect the strength of the IFN response. 26 The expression of various components of the antigen presentation pathway is IFN-regulated. Although HLA protein levels were slightly increased in infected human hepatocytes repopulating the livers of upa/scid mice (Figures 4 and 5), our analysis indicated that IFN- could further increase the expression of these genes, although the fold induction was greater in the absence of HBV. TAP-1 and TAP-2 (transporter associated with antigen presentation) associate to form the TAP complex, the function of which is to transport proteasome-processed peptides into the endoplasmic reticulum, where formation of the peptide-loaded MHC class I complexes takes place. 27,28 Notably, IFN-mediated increase of TAP-1 expression was clearly restrained in HBV-infected human hepatocytes. Although both TAP-1 and HLA-I genes display IFN responsive elements, different characteristics of the respective promoters and the involvement of additional IFN signaling pathways may contribute to the different strengths of induction determined among genes of the antigen presentation. 27 Because low TAP-1 levels have been associated with the immunotolerant state in chronic HBV infection, 28 it would be important to inves-

9 2082 LÜTGEHETMANN ET AL GASTROENTEROLOGY Vol. 140, No. 7 tigate whether the lack of TAP-1 induction in HBVinfected hepatocytes is sufficient to maintain low levels of viral antigen presentation and hence may favor the escape of infected cells from immune surveillance, despite the up-regulation of other components of the MHC class I antigen presentation induced by IFN administration. HBV has been described as a stealth virus, which does not launch the innate immunity in experimentally infected chimpanzees 5 and the lack of production of type I IFNs determined both in patients 3 and animal models 29,30 is thought to contribute to the establishment of HBV persistence. Nevertheless, recent in vitro and in vivo studies indicated that the innate immune system is able to sense HBV infection in humans. 2,3,31 Our results indicated that ISG expression levels were slightly increased in HBV-infected livers compared to baseline levels measured in uninfected and untreated mice, suggesting that HBV could be sensed by the human hepatocytes. The lack of intrahepatic IFN signaling induction determined in chimpanzees may be due, in part, to unique features of the chimpanzee model, as well as to the fact that our analysis focused on changes occurring exclusively in HBV-infected human hepatocytes, thus excluding signals deriving from uninfected nonparenchymal immune cells, which may display different ISG expression patterns. A relationship between increased baseline ISG expression and the lack of IFN response has been described in hepatitis C virus infected patients, 26,32 and it is conceivable that, in conjunction with the inhibition of STAT accumulation, even a modest intrahepatic increase of ISG levels may contribute to the ineffectiveness of the IFN response determined in HBV-infected human hepatocytes. Furthermore, mechanisms of HBV interference with the IFN system may also involve other pathways of the innate immune response. For instance, in vitro studies showed that HBV proteins may affect STAT methylation, 6 and the activity of cellular DNA methyltransferases, which could induce epigenetic modifications of the host chromatin. 33,34 Interactions between the regulatory HBx protein, MAVS, 35 and members of the cellular epigenetic machinery have been reported and may also contribute to the reduced capacity of IFN to stimulate target genes in HBV-infected hepatocytes Nevertheless, it is also known that HBV/hepatitis C virus coinfected patients can respond to IFN therapy in vivo and that HBV-infected patients (with and without therapeutic virus suppression) do not exhibit clinically apparent innate immune dysfunction. In summary, our findings suggest that HBV can sabotage pathways of the IFN response in vivo, in stably infected primary human hepatocytes supporting all steps of the HBV life cycle. The lack of an adaptive immune system and the undetectable responsiveness of mouse liver cells to human IFN- administration permitted exploitation of the capacities of HBV to interfere directly with pathways of the innate antiviral response in infected human hepatocytes. Future studies are needed to define specific viral components that antagonize STAT translocation and ISG induction as well as to understand the relevance of this effect in HBV pathogenesis. Supplementary Material Note: To access the supplementary material accompanying this article, visit the online version of Gastroenterology at and at doi: /j.gastro References 1. Sadler AJ, Williams BR. Interferon-inducible antiviral effectors. Nat Rev Immunol 2008;8: Fisicaro P, Valdatta C, Boni C, et al. Early kinetics of innate and adaptive immune responses during hepatitis B virus infection. Gut 2009;58: Dunn C, Peppa D, Khanna P, et al. Temporal analysis of early immune responses in patients with acute hepatitis B virus infection. Gastroenterology 2009;137: Boni C, Fisicaro P, Valdatta C, et al. Characterization of hepatitis B virus (HBV)-specific T-cell dysfunction in chronic HBV infection. J Virol 2007;81: Wieland S, Thimme R, Purcell RH, et al. Genomic analysis of the host response to hepatitis B virus infection. Proc Natl Acad Sci U S A 2004;101: Christen V, Duong F, Bernsmeier C, et al. Inhibition of alpha interferon signaling by hepatitis B virus. J Virol 2007;81: Guan SH, Lu M, Grunewald P, et al. Interferon-alpha response in chronic hepatitis B-transfected HepG cells is partially restored by lamivudine treatment. World J Gastroenterol 2007;13: Wieland SF, Guidotti LG, Chisari FV. Intrahepatic induction of alpha/beta interferon eliminates viral RNA-containing capsids in hepatitis B virus transgenic mice. J Virol 2000;74: Dandri M, Burda MR, Torok E, et al. Repopulation of mouse liver with human hepatocytes and in vivo infection with hepatitis B virus. Hepatology 2001;33: Petersen J, Dandri M, Mier W, et al. Prevention of hepatitis B virus infection in vivo by entry inhibitors derived from the large envelope protein. Nat Biotechnol 2008;26: Dandri M, Murray JM, Lutgehetmann M, et al. Virion half-life in chronic hepatitis B infection is strongly correlated with levels of viremia. Hepatology 2008;48: Volz T, Lutgehetmann M, Wachtler P, et al. Impaired intrahepatic hepatitis B virus productivity contributes to low viremia in most HBeAg-negative patients. Gastroenterology 2007;133: Garcia-Sastre A, Biron CA. Type 1 interferons and the virus-host relationship: a lesson in detente. Science 2006;312: Lanford RE, Guerra B, Bigger CB, et al. Lack of response to exogenous interferon-alpha in the liver of chimpanzees chronically infected with hepatitis C virus. Hepatology 2007;46: Hiraga N, Imamura M, Hatakeyama T, et al. Absence of viral interference and different susceptibility to interferon between hepatitis B virus and hepatitis C virus in human hepatocyte chimeric mice. J Hepatol 2009;51: Anderson AL, Banks KE, Pontoglio M, et al. Alpha/beta interferon differentially modulates the clearance of cytoplasmic encapsidated replication intermediates and nuclear covalently closed circular hepatitis B virus (HBV) DNA from the livers of hepatocyte nuclear factor 1alpha-null HBV transgenic mice. J Virol 2005;79:

10 June 2011 HBV-INDUCED INHIBITION OF THE IFN SYSTEM Lutgehetmann M, Volz T, Kopke A, et al. In vivo proliferation of hepadnavirus-infected hepatocytes induces loss of covalently closed circular DNA in mice. Hepatology 2010;52: Xu C, Guo H, Pan XB, et al. Interferons accelerate decay of replication-competent nucleocapsids of hepatitis B virus. J Virol 2010;84: Uprichard SL, Wieland SF, Althage A, et al. Transcriptional and posttranscriptional control of hepatitis B virus gene expression. Proc Natl Acad Sci U S A 2003;100: Heise T, Guidotti LG, Cavanaugh VJ, et al. Hepatitis B virus RNA-binding proteins associated with cytokine-induced clearance of viral RNA from the liver of transgenic mice. J Virol 1999;73: Rang A, Heise T, Will H. Lack of a role of the interferon-stimulated response element-like region in interferon alpha-induced suppression of hepatitis B virus in vitro. J Biol Chem 2001;276: Alcantara FF, Tang H, McLachlan A. Functional characterization of the interferon regulatory element in the enhancer 1 region of the hepatitis B virus genome. Nucleic Acids Res 2002;30: Levrero M, Pollicino T, Petersen J, et al. Control of cccdna function in hepatitis B virus infection. J Hepatol 2009;51: Wu M, Xu Y, Lin S, et al. Hepatitis B virus polymerase inhibits the interferon-inducible MyD88 promoter by blocking nuclear translocation of Stat1. J Gen Virol 2007;88: Boni C, Penna A, Bertoletti A, et al. Transient restoration of anti-viral T cell responses induced by lamivudine therapy in chronic hepatitis B. J Hepatol 2003;39: Dill MT, Duong FH, Vogt JE, et al. Interferon-induced gene expression is a stronger predictor of treatment response than IL28B genotype in patients with hepatitis C. Gastroenterology 2011; 140: e Scholz C, Tampe R. The intracellular antigen transport machinery TAP in adaptive immunity and virus escape mechanisms. J Bioenerg Biomembr 2005;37: Sukriti S, Pati NT, Bose S, et al. Impaired antigen processing and presentation machinery is associated with immunotolerant state in chronic hepatitis B virus infection. J Clin Immunol 2010;30: Guidotti LG, Chisari FV. Immunobiology and pathogenesis of viral hepatitis. Annu Rev Pathol 2006;1: Guidotti LG, Rochford R, Chung J, et al. Viral clearance without destruction of infected cells during acute HBV infection. Science 1999;284: Lucifora J, Durantel D, Testoni B, et al. Control of hepatitis B virus replication by innate response of HepaRG cells. Hepatology 2010;51: Sarasin-Filipowicz M, Oakeley EJ, Duong FH, et al. Interferon signaling and treatment outcome in chronic hepatitis C. Proc Natl Acad Sci U S A 2008;105: Park IY, Sohn BH, Yu E, et al. Aberrant epigenetic modifications in hepatocarcinogenesis induced by hepatitis B virus X protein. Gastroenterology 2007;132: Vivekanandan P, Daniel HD, Kannangai R, et al. Hepatitis B virus replication induces methylation of both host and viral DNA. J Virol 2010;84: Wei C, Ni C, Song T, et al. The hepatitis B virus X protein disrupts innate immunity by downregulating mitochondrial antiviral signaling protein. J Immunol 2010;185: Belloni L, Pollicino T, De Nicola F, et al. Nuclear HBx binds the HBV minichromosome and modifies the epigenetic regulation of cccdna function. Proc Natl Acad Sci U S A 2009;106: Cougot D, Wu Y, Cairo S, et al. The hepatitis B virus X protein functionally interacts with CREB-binding protein/p300 in the regulation of CREB-mediated transcription. J Biol Chem 2007;282: Zheng DL, Zhang L, Cheng N, et al. Epigenetic modification induced by hepatitis B virus X protein via interaction with de novo DNA methyltransferase DNMT3A. J Hepatol 2009;50: Received September 10, Accepted February 18, Reprint requests Address requests for reprints to: Maura Dandri, PhD, Medizinische Klinik und Poliklinik, Zentrum für Innere Medizin, Universitätsklinikum Hamburg-Eppendorf, Martinistr. 52, D Hamburg, Germany. m.dandri@uke.de; fax: Acknowledgments Dr Lütgehetmann and Mr Bornscheuer contributed equally to this work. The authors thank R. Reusch for her continuous excellent assistance with the mouse colony and G. Apitzsch for her technical help with immunohistochemistry. The authors are also grateful to Drs J. Winking and R. Ebel, Sigma-Aldrich Chemie GmbH, for their great support with the primer design, Hans Will for kindly providing the SP100 antibody, and to M. Schweizer for her technical aid with the confocal microscopy. Conflicts of interest The authors disclose no conflicts. Funding Dr Dandri is supported by the Deutsche Forschungsgemeinschaft (SFB 481) and receives research support from Roche Palo Alto LLC (Grant number ). Drs Petersen and Dandri were also supported by the Deutsche Forschungsgemeinschaft (Pe/ ) and by the Deutsche Leberstiftung (HepNet program, Project 13.5).

11 2083.e1 LÜTGEHETMANN ET AL GASTROENTEROLOGY Vol. 140, No. 7 Supplementary Table 1. List of the Human and Murine Species-Specific Primers That Have Been Used on the LightCycler to Define Human and Mouse ISG Expression Levels in the Liver of Chimeric upa/scid Mice htap1 For: 5=GGATTCTACAAGATGGCTCAG; Rev: 5=TGTTGTTATAGATCCCGTCAC hoas1 For: 5=GAAACCAACAGCAGTCCAAG; Rev: 5=GCCTGAGGAGCCACCCTTTA hmxa: For: 5=GAGGCCGCACTCCAGCA; Rev: 5=CCGTGACACTGGGATTCCT hhlae For: 5=GGTTGCTGCTGTGATATGG; Rev: 5=CACTGTCGCTCCACTCAG hhlaa For: 5=CGTGATGTGGAGGAGGAAGAGC; Rev: 5=GTCACAAAGGGAAGGGCAGGAAC htlr4 For: 5=AATATGACCACAGTCAGAAGTGTTTGTTAC; Rev: 5=GGGATGTTCAATCACCCTAGACCT htlr2 For: 5=GCGTTCTCTCAGGTGACTGCTCG; Rev: 5=GAAAGCAGTGAAAGAGCAATGGGCACAA hmyd88 For: 5=GGATGCCTGTGGTCATGCTCTC; Rev: 5=TCTGTATGTGAGTCTGTATGTG moas1 For: 5=GGAGGTTGGAGTGCCAATGAAGTATC Rev: 5=CTTCCCAAAGATGAAATGAAACAAAGACC mmxa: For: 5=CTGTTCAGCAATAGTTCTT Rev: 5=TGAGTCATACTTGGTGTT mh2q10 For: 5=TCCTTCCACTGACTCTAT Rev: 5=TCCTTCCACTGACTCTAT mtlr4 For: 5= ATGCCTTGTGAGATGGATGAATGTTG Rev: 5= ACTGAAATAAGGTGAAAGCAGAAATGTGT mtlr2 For: 5=GGGAGCGGCGGCTGGAGGACTCCTA Rev: 5=AGGTCGCAGAGACTGCCGTCCAACC mmyd88 For: 5=GCACCTCAGTACACACAT Rev: 5=TGATGATAGAACTCTTCCACT mgapdh For: 5=CGACTTCAACAGCAACTC Rev: 5=GTAGCCGTATTCATTGTCAT Supplementary Figure 1. Expression levels of human and murine ISGs were quantitated by real-time polymerase chain reaction before and after administration of human IFN-. Human and mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) housekeeping genes were used for normalization. (Top panel) Log expression of the indicated human ISGs was determined using human specific primers not cross-reacting with murine sequences. The specificity of the designed primers was validated on complementary DNA samples derived from not-transplanted mouse liver, human-chimeric mouse liver, and human liver tissue. (Bottom panel) Primers recognizing ISG murine transcripts showed that injection of human IFN- (1350 IU/g body weight human) failed to induce induction of the ISGs analyzed in murine liver cells, because transcription levels remained comparable to levels determined in untreated control littermates.

12 June 2011 HBV-INDUCED INHIBITION OF THE IFN SYSTEM 2083.e2 Supplementary Figure 2. Changes in levels of viremia (Log HBV- DNA copies/ml serum) were determined in the same HBV-infected mice before treatment (baseline [BL]) and at different time points after IFN- administration. Viremia levels measured in untreated control mice used for the intrahepatic measurements are also shown (control group). Supplementary Figure 3. Intracellular amounts of HBV proteins do not differ between untreated and ETV IFN- treated mice. HBcAg staining (green, upper panels) of liver tissues obtained from HBVinfected chimeric mice receiving ETV for 2 weeks followed by 5 days of combination therapy with IFN- ETV (right upper panel) was comparable to the staining obtained from untreated HBV-infected chimeric livers (left upper panel). As expected, polymerase inhibitors strongly reduced viremia levels but not intracellular production of HBV proteins. Double staining with human cytokeratin 18 (CK-18) antibodies permitted to identify human cells in upa/scid mouse livers (lower panels).