Isorce Nathalie, Testoni B., Luangsay S., Locatelli M., Zannetti C., Henry T., Hasan U., Zoulim F., Durantel D.
|
|
- Martin Wilson
- 5 years ago
- Views:
Transcription
1 Activité antivirale de différents interférons (IFNs) et cytokines proinflammatoires dans des modèles pertinents d hépatocytes infectés par le virus de l hépatite B (HBV) Isorce Nathalie, Testoni B., Luangsay S., Locatelli M., Zannetti C., Henry T., Hasan U., Zoulim F., Durantel D. Centre de Recherche en Cancérologie de Lyon CRCL (France) UMR Inserm 1052 CNRS 5286 CLB
2 I have no disclosure.
3 OBJECTIVES Interplay between HBV and innate immunity Circulating HBV DC LSEC KC Recognition by sensors NK/N KT SD Cytokines (e.g. IL-6, IL-1β, TNFα, IFNs, ) Stimulation of specialized s Recognition by host sensors Antiviral actions BC Prevention against infection Hepato-protection and survival Hepatocyte Infected Infected Protected Adapted from Ait-Goughoulte et al., Viruses 2010
4 OBJECTIVES Interplay between HBV and innate immunity TLR9 Circulating HBV DC LSEC Inflammasome KC Recognition by sensors NK/N KT SD Cytokines (e.g. IL-6, IL-1β, TNFα, IFNs, ) IFNs BC Hepatocyte Infected Infected Protected Gruffaz et al, EASL 2013 & HBV meeting 2013 ; Zannetti, Isorce, et al, EASL 2013 ; Vincent et al, PLoS One 2011
5 OBJECTIVES Interplay between HBV and innate immunity Circulating HBV DC LSEC KC Recognition by sensors NK/N KT SD Cytokines (e.g. IL-6, IL-1β, TNFα, IFNs, ) Hepatocyte Recognition by host sensors Infected Antiviral actions Infected 1. Anti-HBV effect of cytokines in relevant in vitro BC models? 2. Mechanisms and effectors Protected? Define new immunotherapeutic approaches against HBV
6 OBJECTIVES Interplay between HBV and innate immunity Circulating HBV DC LSEC KC Recognition by sensors NK/N KT SD Cytokines (e.g. IL-6, IL-1β, TNFα, IFNs, ) Recognition by host sensors Antiviral actions 1. Anti-HBV effect of cytokines? Hepatocyte Infected Infected Protected
7 EXPERIMENTAL APPROACH Differentiated HepaRG s or PHH D0 HBV infection 100 vge/ CYTOKINE SINGLE ADMINISTRATION D7 Established infection * D10 -IFN-I,II,III -Inflammatory cytokines days PI Analysis of viral parameters Viral DNA* Viral proteins* days PI HBV: 100 vge/ vge/ vge/ Hantz et al., J Gen Virol, 2009 ; Luangsay et al., submitted
8 HepaRG Effect on intraular total HBV DNA accumulation (qpcr) All cytokines dose-dependently decrease HBV DNA Units: pg/ml
9 HepaRG Effect on intraular total HBV DNA accumulation (qpcr) IL-1β still exerts inhibition of HBV DNA at very low doses Units: pg/ml
10 HepaRG IFNβ (IFNs) STAT1/2-dependent IL-1β (Inflammatory cytokines) NFκB-dependent HBV DNA HBV DNA HBV RNA HBV RNA HBV Ag HBV Ag
11 IFNβ IL-1β HepaRG STAT1/2-dependent NFκB-dependent HBV DNA HBV DNA HBV RNA HBV RNA HBV Ag HBV Ag Different mechanism of action between IFNs and inflammatory cytokines
12 IFNβ IL-1β HepaRG STAT1/2-dependent NFκB-dependent HBV DNA HBV DNA HBV RNA HBV RNA HBV Ag HBV Ag Confirmation in PHH in progress. Next step: Investigation of the effect on cccdna (silencing or degradation?) and pgrna?
13 OBJECTIVES Circulating HBV DC Inflammasome KC NK/N KT LSEC SD Cytokines IL-1β (e.g. IL-6, IL-1β, TNFα, IFNs, ) (very low doses) 2. Mechanisms and effectors? Antiviral actions Hepatocyte Infected Infected Protected Zannetti, Isorce, et al, EASL 2013
14 Comparison among IL-1 family members Adapted from Dinarello, 2009
15 Comparison among IL-1 family members Adapted from Dinarello, 2009 Downstream signaling of IL-1RI is involved in IL-1β antiviral effect against HBV
16 HYPOTHESIS? IL-1β IL-1RI IL-1RAcP NFκB Target transcripts IFNs TGFβ IL-6 TNFα IL-8 MIP1α IL-1α INDIRECT antiviral effect? (potentially induced secreted cytokines)
17 HYPOTHESIS? IL-1β IL-1RI IL-1RAcP NFκB Target transcripts IFNs IL-6 IL-8 TGFβ TNFα MIP1α IL-1α INDIRECT antiviral effect? (potentially induced secreted cytokines) DIRECT inhibitory effect? Putative binding sites of NFκB on HBV genome Kwon et al., 2002 Inhibitory transcriptional role of NFκB Hasan et al., 2013
18 Early and direct antiviral effect of IL-1β Antiviral effect of IL-1β already at 8h post-treatment and not related to IL-6
19 Early and direct antiviral effect of IL-1β Antiviral effect of IL-1β already at 8h post-treatment and not related to IL-6
20 HYPOTHESIS? IL-1β IL-1RI IL-1RAcP NFκB Target transcripts IFNs IL-6 IL-8 TGFβ TNFα MIP1α IL-1α INDIRECT antiviral effect? (potentially induced secreted cytokines) DIRECT inhibitory effect? Putative binding sites of NFκB on HBV genome Kwon et al., 2002 Inhibitory transcriptional role of NFκB Hasan et al., 2013
21 Does IL-1β have an inhibitory effect on HBV transcription? Plating of proliferating HepaRG s D0 D1 Transfection SINGLE ADMINISTRATION IL-1β D2 2h Medium change D3 time Luciferase assay
22 Does IL-1β have an inhibitory effect on HBV transcription? Plating of proliferating HepaRG s D0 D1 Transfection SINGLE ADMINISTRATION IL-1β D2 2h Medium change D3 time Luciferase assay IL-1β inhibits both Core and X activity promoters within 2 hours, suggesting that IL-1β may target HBV transcription directly
23 Does IL-1β activate the NF-κB promoter in our model? IL-1β can activate NF-κB promoter, suggesting that IL-1β may target HBV transcription through this pathway. Next step: Confirmation in ChIP with NF-kB
24 CONCLUSION Panel of cytokines: type I, II, III IFNs IL-6, TNFα, IL-1α/β BC Antiviral actions BC Infected Hepatocyte Infected Protected
25 CONCLUSION Panel of cytokines: type I, II, III IFNs IL-6, TNFα, IL-1α/β BC Antiviral actions BC Infected Hepatocyte Infected Protected HBV DNA (Watashi et al., 2013) HBV RNA (+++) HBeAg (not HBsAg) IL-1β (low doses) HBx/Core promoters NF-κB promoter
26 CONCLUSION Panel of cytokines: type I, II, III IFNs IL-6, TNFα, IL-1α/β Mechanisms? BC Antiviral actions BC Infected Hepatocyte Infected Protected HBV DNA (Watashi et al., 2013) HBV RNA (+++) HBeAg (not HBsAg) IL-1β (low doses) HBx/Core promoters NF-κB promoter cccdna? pgrna and others?
27 Acknowledgments Teams 15&16 of INSERM U1052 (CRCL, Lyon, France) And particularly Fabien Zoulim David Durantel Barbara Testoni Souphalone Luangsay Marion Gruffaz Dulce Alfaiate Judith Fresquet Maud Michelet Lydie Lefrançois Marie-Laure Plissonnier Maëlle Locatelli Collaborations: Uzma Hasan, Thomas Henry, Claudia Zannetti INSERM U1111 (CIRI), Lyon Nathalie Bendriss-Vermare, Christophe Caux INSERM U1052 (CRCL) Travel Grant:
28 Viability Assays No cytotoxicity Units: pg/ml, excepted for positive control Puromycin(antibiotic) in µg/ml
29 No impairement of extracted RNA rate by IL-1β treatments
30 HBV infected Primary Human Hepatocytes Southern Blot (HBV) on intraular total DNA Batch #1 IFNβ IFNγ TNFα IL-28B IL-29 IL-6 IL-1β (ng/ml) IL-18 Ribavirin IFNα 60-80% inhibition
31 HBV infected Primary Human Hepatocytes
32 IL-1α results in HepaRG s: Intraular HBV DNA (qpcr) Secreted HBeAg and HBsAg (ELISA)
33 What is the effect of IL-1β/ IFNα or Tenofovir co-treatment on HBV? Chronically infected HBV patients could be treated with IFNα or Tenofovir 30% 75% 85% No antagonism between IL-1β and IFNα or Tenofovir (Potentiation of the combination (with IFN) demonstrated in PLC/PRF/5, Hamasaki et al, 1992)
34 1. Indirect antiviral effect via other potential cytokines? SUMMARY 50% inhibition of HBeAg secretion by 100pg/ml of IL-1β Cytokines secreted Upon 100pg/ml IL-1β treatment during 72h IL-6 ~3000pg/ml <50% TNFα <10 pg/ml No IL-1α <20 pg/ml No IL-29 <50 pg/ml No Individual antiviral activity (HBeAg) IP10 ~1000 pg/ml Not determined IL-4 Not detected Not determined Other cytokines? Luminex analyses? Hypothesis: Antiviral activity of IL-1β could not be totally due to IL-6 Confirm this hypothesis using (excess of) anti-il-6 neutralizing antibody (>10ng/ml) and anti-tnfα neutralizing antibody (>100pg/ml), and IL-1Ra (150µg/ml) to confirm specificity of action of IL-1 Identify other cytokines?
35 Cellular factors associated with IL-1β anti-hbv activity? Analysis of some hepatocyte markers: mrna quantification by qrt-pcr Secreted protein quantification by ELISA Next step: Confirmation at the protein level (FACS HNF-4α) has to be done
36 Are HepaRG expressing receptors of inflammatory cytokines? What about IL-1 family? IL-1 Receptor (IL-1RI) IL18 Receptor (IL-18Ra) Receptors from IL-1 family are present, but we still have to check the expression of ST2 (IL-33R) and IL1RAcP (associated receptor of IL-1RI and ST2)
37 Are HepaRG expressing receptors of inflammatory cytokines? What about other receptors of inflammatory cytokines? IL-6 Receptor (gp80) TNFα Receptor (TNFRI) Receptors of IL-6 and TNFα are expressed
38 IL-1β signaling Dinarello, Ann Rev Immunol 2009
Hepatitis B: Clinical Relevance of HBV cccdna
Hepatitis B: Clinical Relevance of HBV cccdna Fabien Zoulim Hepatology Department, Hospices Civils de Lyon INSERM U1052, Cancer Research Center of Lyon Lyon University, France What is cccdna? Covalently
More informationHepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
More informationIntrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
More informationIs There a Best Direct Acting Antiviral Agent for HBV?
Is There a Best Direct Acting Antiviral Agent for HBV? Fabien Zoulim Hepatology Department, Hospices Civils de Lyon INSERM U1052, Cancer Research Center of Lyon Lyon University, France What targets for
More informationNovel targets for HBV therapy
VHPB Meeting Hot Topics in Prevention and Control of Viral Hepatitits Lisbon, 15-16th March 2018 Novel targets for HBV therapy Barbara Testoni, PhD Cancer Research Center of Lyon INSERM UMR1052, CNRS 5286
More informationCLARA 2013 Flash talk. Uzma Hasan CR1 Claudia Zannetti (Post doc) Guillaume Roblot (EPHE) Issam Tout (pre-doc)
HPV16 and regulation of the innate immune response CLARA 2013 Flash talk Uzma Hasan CR1 Claudia Zannetti (Post doc) Guillaume Roblot (EPHE) Issam Tout (pre-doc) Carlos Romain (M2) U851/U1111 CIRI/U1111
More informationRevisiting HBV biology: perspective for cure
Revisiting HBV biology: perspective for cure Fabien Zoulim Hepatology Department, Hospices Civils de Lyon INSERM U1052, Cancer Research Center of Lyon Lyon University, France What do we want to achieve?
More informationInterferon-gamma pathway is activated in a chronically HBV infected chimpanzee that controls HBV following ARC-520 RNAi treatment
Interferon-gamma pathway is activated in a chronically HBV infected chimpanzee that controls HBV following ARC-520 RNAi treatment Zhao Xu, Deborah Chavez, Jason E. Goetzmann, Robert E. Lanford and Christine
More informationComplete Blockage of HBV Virus Replication and Inhibition of cccdna Formation by Core Protein Allosteric Modifiers
Complete Blockage of HBV Virus Replication and Inhibition of Formation by Core Protein Allosteric Modifiers G. Renuka Kumar, Yuhua Zong, Alex Mercier, Pao-Chen Li, Cathal Mahon, Emily Connelly, Katherine
More informationSlides are the property of the author and AASLD. Permission is required from both AASLD and the author for reuse.
Inarigivir Demonstrates Potent Dose Dependent Anti-Viral Activity in HBV Treatment-Naïve Patients: Role of HBeAg Status and Baseline HBsAg in Anti-Viral Response MF Yuen, M. Elkhashab, CY Chen, YF Chen,
More informationRNA Interference: A New Tool in the Toolbox for Treatment of HBV. Discovery On Target Senior Director, Research 25 September 2017
RNA Interference: A New Tool in the Toolbox for Treatment of HBV Amy Lee Discovery On Target Senior Director, Research 25 September 2017 Arbutus Biopharma Boston, MA NASDAQ: ABUS www.arbutusbio.com Chronic
More informationInarigivir ACHIEVE Trial Results and HBV Clinical Program Update. August 2, 2018
Inarigivir ACHIEVE Trial Results and HBV Clinical Program Update August 2, 2018 FORWARD LOOKING STATEMENT This presentation includes forward-looking statements within the meaning of the Private Securities
More informationEradication of HBV? a «one step at a time» calendar!
UMR INSERM-U1052/CNRS-5286/UCBL/CLB Eradication of HBV? a «one step at a time» calendar! David DURANTEL Cancer Research Center of Lyon (CRCL) INSERM U1052 Team#15 Associate Editor of Antiviral Journal
More informationRNAi Therapy for Chronic HBV Infection
RNAi Therapy for Chronic HBV Infection Bill Symonds, PharmD Chief Development Officer October 2017 NASDAQ: ABUS www.arbutusbio.com Forward Looking Statements This presentation contains forward-looking
More informationHepatitis B New Therapies
Hepatitis B New Therapies Richard K. Sterling, MD, MSc, FACP, FACG, FAASLD, AGAF VCU Hepatology Professor of Medicine Chief, Section of Hepatology Fellowship Director, Transplant Hepatology Virginia Commonwealth
More informationEbola virus crisis. Prof. Viktor Volchkov. Molecular basis of viral pathogenicity
Ebola virus crisis Prof. Viktor Volchkov Molecular basis of viral pathogenicity International Centre for Research in Infectiology (CIRI), INSERM Claude Bernard University Lyon-1, Lyon, France viktor.volchkov@inserm.fr
More informationHepatitis B Cure: from discovery to regulatory endpoints in HBV clinical research A summary of the AASLD/EASL statement
Hepatitis B Cure: from discovery to regulatory endpoints in HBV clinical research A summary of the AASLD/EASL statement Fabien Zoulim Service d hépatologie, Hospices Civils de Lyon INSERM U1052, Cancer
More informationConsensus AASLD-EASL HBV Treatment Endpoint and HBV Cure Definition
Consensus AASLD-EASL HBV Treatment Endpoint and HBV Cure Definition Anna S. Lok, MD, DSc Alice Lohrman Andrews Professor in Hepatology Director of Clinical Hepatology Assistant Dean for Clinical Research
More informationTherapeutic Efficacy of a TLR7 Agonist for HBV Chronic Infection in Chimpanzees
Therapeutic Efficacy of a TLR7 Agonist for HBV Chronic Infection in Chimpanzees Robert Lanford 1, Bernadette Guerra 1, Deborah Chavez 1, Vida L. Hodara 1, Xubin Zheng 2, Grushenka Wolfgang 3, Daniel B.
More information10th International Rotavirus Symposium Bangkok, Thailand
Rotavirus Host Range Restriction and Innate Immunity: Mechanisms of Vaccine Attenuation Harry Greenberg MD Stanford University 10th International Rotavirus Symposium Bangkok, Thailand 09/19/12 B dsrna
More informationNewly Recognized Components of the Innate Immune System
Newly Recognized Components of the Innate Immune System NOD Proteins: Intracellular Peptidoglycan Sensors NOD-1 NOD-2 Nod Protein LRR; Ligand Recognition CARD RICK I-κB p50 p65 NF-κB Polymorphisms in Nod-2
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationRNAi in HBV, the next backbone therapy for use in combinations? Bruce D. Given, MD COO, Arrowhead Pharmaceuticals L.I.F.E.R.
RNAi in HBV, the next backbone therapy for use in combinations? Bruce D. Given, MD COO, Arrowhead Pharmaceuticals L.I.F.E.R. October 20, 2017 Safe Harbor Statement This presentation contains forward-looking
More informationHepatitis B Virus infection: virology
Hepatitis B Virus infection: virology 167 Falk Symposium: Liver under constant attack from fat to viruses III Falk Gastro-Konferenz 17.-21. September 2008 Congress Centrum Mainz Maura Dandri Department
More informationInnate Immunity & Inflammation
Innate Immunity & Inflammation The innate immune system is an evolutionally conserved mechanism that provides an early and effective response against invading microbial pathogens. It relies on a limited
More informationHepatitis B. HBV Cure: Insights for the Biotechnology and the Research Analyst Community November 11, Lalo Flores, PhD Global Head HBV R&D
Hepatitis B HBV Cure: Insights for the Biotechnology and the Research Analyst Community November 11, 2016 Lalo Flores, PhD Global Head HBV R&D Infectious Diseases Diseases Infectious 11 Janssen s Vision
More informationSPONSOR & COPYRIGHT NOTICE
SPONSOR & COPYRIGHT NOTICE THIS PRESENTATION WAS GIVEN AT THE LIVER MEETING 2014 (AASLD), DURING AN INVESTIGATOR MEETING SPONSORED BY CN BIO INNOVATIONS LIMITED (UK REGISTERED COMPANY: 06517359) This presentation
More informationThe Evolution of sirna Therapeutics Targeting HBV at Arrowhead Pharmaceuticals. Sept 25, 2018
The Evolution of sirna Therapeutics Targeting HBV at Arrowhead Pharmaceuticals Sept 25, 2018 Disclosures I am an employee and shareholder in Arrowhead Pharmaceuticals, Inc. Safe Harbor Statement This presentation
More informationTKM-HBV RNAi Therapeutic for Chronic Hepatitis B Infection
TKM-HBV RNAi Therapeutic for Chronic Hepatitis B Infection Amy Lee, Arbutus Biopharma DIA/FDA Oligonucleotide-Based Therapeutics Conference September 9 Washington, DC Disclaimer The views and opinions
More informationHepatitis virus immunity. Mar 9, 2005 Rehermann and Nascimbeni review Crispe review
Hepatitis virus immunity Mar 9, 2005 Rehermann and Nascimbeni review Crispe review HBV & HCV infection outcomes Both viruses cause immune-mediated active and chronic hepatitis HBV Vertical transmission
More informationPrevention Of Liver Fibrosis and Cancer in Africa
HIGH INCIDENCE OF A HEPATITIS B VIRUS PRES2 DELETION IN WEST AFRICA AMONG HBV CHRONIC CARRIERS : ASSOCIATION WITH HEPATOCELLULARCARCINOMA Prevention Of Liver Fibrosis and Cancer in Africa Isabelle CHEMIN
More informationViral Load-Dependent Effects of Liver Injury and Regeneration on HBV. Replication in Mice
JVI Accepts, published online ahead of print on 20 June 2012 J. Virol. doi:10.1128/jvi.01087-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13 14
More informationImmunity to Viruses. Patricia Fitzgerald-Bocarsly September 25, 2008
Immunity to Viruses Patricia Fitzgerald-Bocarsly September 25, 2008 The Immune System Deals with a Huge Range of Pathogens Roitt, 2003 Immune Responses to Viruses Viruses are dependent on the host cell
More informationNew Drug Research for Chronic Hepatitis B Man-Fung Yuen, MD, PhD
New Drug Research for Chronic Hepatitis B Man-Fung Yuen, MD, PhD Department of Medicine. The University of Hong Kong, Queen Mary Hospital, Hong Kong OVERVIEW Emerging Drugs against HBV Direct-acting antiviral
More informationDiagnostic Methods of HBV and HDV infections
Diagnostic Methods of HBV and HDV infections Zohreh Sharifi,ph.D Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine Hepatitis B-laboratory diagnosis Detection
More informationHBV Novel Therapies Maria Buti MD, PhD
HBV Novel Therapies Maria Buti MD, PhD Liver Unit, Internal Medicine Department Vall d Hebron Hospital CONFLICT OF INTEREST I have financial relationships to disclose within the past 12 months relevant
More informationWhats new on HBsAg and other markers for HBV infection? Christoph Höner zu Siederdissen
Whats new on HBsAg and other markers for HBV infection? Christoph Höner zu Siederdissen Why diagnostic markers are important They are the basis for clinical decision makings treatment or no treatment?
More informationSupplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
More informationEffects of Inarigivir (SB9200) Therapy on Immune Responses in Patients with Chronic Hepatitis B (CHB)
Effects of (SB9200) Therapy on Immune Responses Patients with Chronic Hepatitis B (CHB) Renae Walsh 1, Rachel Hammond 1, Kathy Jackson 1, Ros Edwards 1, Chelsea Macfarlane 2, Radhakrishnan P. Iyer 2, Man
More informationSupplementary information
Supplementary information Exosomes mediate the cell-to-cell transmission of interferon alpha-induced antiviral activity Jianhua Li, Kuancheng Liu, Yang Liu, Yan Xu, Fei Zhang, Huijuan Yang, Jiangxia Liu,
More informationRole of Innate Immunity in Hepatitis B Virus Infection Adam J. Gehring, Ph.D.
Role of Innate Immunity in Hepatitis B Virus Infection Adam J. Gehring, Ph.D. Biology Lead Toronto Centre for Liver Disease Toronto General Hospital Research Institute University Health Network (UHN) HBV
More informationLYON. FRANCE NOVEMBER / 2013 TRANSLATIONAL RESEARCH IN CHRONIC VIRAL HEPATITIS - BRIDGING BASIC SCIENCE AND CLINICAL RESEARCH
LYON. FRANCE NOVEMBER 29-30 / 2013 TRANSLATIONAL RESEARCH IN CHRONIC VIRAL HEPATITIS - BRIDGING BASIC SCIENCE https://events.easl.eu/eventportal/ Information/MLYON2013/HOME.aspx Abstract submission deadline:
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationHBV Cure Overview of Viral and Immune Targets
HBV Cure Overview of Viral and Immune Targets Harry L.A. Janssen Francis Family Chair of Hepatology Director Toronto Centre for Liver Disease University Health Network University of Toronto, Canada October
More informationSupplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
More information4th International HIV/Viral Hepatitis Co-Infection Meeting
4th International HIV/Viral Hepatitis Co-Infection Meeting The Rocky Road to Viral Hepatitis Elimination: Assuring access to antiviral therapy for ALL co-infected patients from low to high income settings
More informationAllergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by
More informationBALANCE BETWEEN ESTROGENS AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION
BALANCE BETWEEN ESTROGE AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION Nadine Dragin 1, 2, 3,, Patrice Nancy 4, José Villegas 2, 3, 5, Régine
More informationSupplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationRichard Colonno Executive Vice President and Chief Scientific Officer of Virology Operations
Targeting HBV Core Protein to Clear Infection and Achieve Higher Cure Rates Richard Colonno Executive Vice President and Chief Scientific Officer of Virology Operations 1 CAUTIONARY NOTE REGARDING FORWARD-
More informationVirion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics
Hepadnaviruses Virion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics Hepatitis viruses A group of unrelated pathogens termed hepatitis viruses cause the vast majority
More informationTargeting HBV Core Protein to Clear Infection and Achieve Higher Cure Rates
Targeting HBV Core Protein to Clear Infection and Achieve Higher Cure Rates Richard Colonno Executive Vice President and Chief Scientific Officer of Virology Operations 1 CAUTIONARY NOTE REGARDING FORWARD-LOOKING
More informationHepatitis C Virus and Cytokine Responses
Hepatitis C Virus and Cytokine Responses Eui-Cheol Shin, M.D., Ph.D. Laboratory of Immunology & Infectious Diseases (LIID), Graduate School of Medical Science & Engineering (GSMSE), KAIST Daejeon, Korea
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral
More informationMF Yuen 2, CS Coffin 3, M Elkhashab 4, S Greenbloom 5, A Ramji 6, H LY Chan 7, RP Iyer 1, S Locarnini 8, C Macfarlane 1, NH Afdhal 1, W Kim 9
SB 9200 (Inarigivir), an oral selective immunomodulator is safe and efficacious in treatment-naïve, non-cirrhotic HBV patients: Results from cohort 1 of the ACHIEVE Trial MF Yuen 2, CS Coffin 3, M Elkhashab
More informationAre Immune Modulators Really Needed to Cure HBV infection?
Are Immune Modulators Really Needed to Cure HBV infection? Harry L.A. Janssen Francis Family Chair of Hepatology Director Toronto Centre for Liver Disease University Health Network University of Toronto,
More informationCrucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
More informationNgAgo-gDNA system efficiently suppresses hepatitis B virus replication through accelerating decay of pregenomic RNA
Accepted Manuscript NgAgo-gDNA system efficiently suppresses hepatitis B virus replication through accelerating decay of pregenomic RNA Zhuanchang Wu, Siyu Tan, Leiqi Xu, Lifen Gao, Haizhen Zhu, Chunhong
More informationCornerstones of Hepatitis B: Past, Present and Future
Cornerstones of Hepatitis B: Past, Present and Future Professor Man-Fung Yuen Queen Mary Hospital The University of Hong Kong Hong Kong 1 Outline Past Natural history studies Development of HBV-related
More informationAbstract: I. A ims Aim 1:
Abstract: Previous work from our laboratory demonstrated that obese mice have alterations in antiviral cytokine gene expression when infected with the influenza virus. Since these cytokines play a major
More informationSustained HBs seroconversion during lamivudine and adefovir dipivoxil combination therapy for lamivudine failure
Sustained HBs seroconversion during lamivudine and adefovir dipivoxil combination therapy for lamivudine failure Marianne Maynard, Parviz Parvaz, Sandra Durantel, Michèle Chevallier, Philippe Chevallier,
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationImmunoadjuvant Properties of Oncolytic Schwarz Measles Virus
Immunoadjuvant Properties of Oncolytic Schwarz Measles Virus Dr Jean-François Fonteneau Institut de Recherche en Santé de l Université de Nantes INSERM UMR892, CNRS UMR6299 Nantes, France Anti-tumor Virotherapy
More informationD2 inhibits TLR2- initiated 12p40 transcription (-) TLR2 PGN MDP. MyD88 IRAK ECSIT TRAF6 NIK. Smallest unit of PGN muramyl dipeptide IKK.
D2 inhibits TLR2- initiated 12p40 transcription CARD CARD NOD2 LRR RICK/Rip2 NIK MDP TRAF6 PGN TLR2 MyD88 IRAK ECSIT (-) IKK Smallest unit of PGN muramyl dipeptide IκB NF-κB atanabe et al, 2004 NF-κB IL-12p40
More informationUnderstanding HBV Testing: HBsAg, HBV RNA, cccdna, HBeAg and HBcrAg in Context of Antiviral Drug Development
Understanding HBV Testing: HBsAg, HBV RNA, cccdna, HBeAg and HBcrAg in Context of Antiviral Drug Development Professor Stephen Locarnini WHO Regional Reference Centre for Hepatitis B Victorian Infectious
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationCHRONIC HEPATITIS B VIRUS Prospects for Cure
VIRAL HEPATITIS and CO-INFECTION with HIV Bucharest, Romania, 6-7 October, 2016 CHRONIC HEPATITIS B VIRUS Prospects for Cure Patrick T. F. Kennedy Reader in Hepatology & Consultant Hepatologist Blizard
More informationDoctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationHBV Cure Definition and New Drugs in Development
HBV Cure Definition and New Drugs in Development Harry L.A. Janssen Francis Family Chair of Hepatology Director Toronto Centre for Liver Disease University Health Network University of Toronto, Canada
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationNature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses.
Supplementary Figure 1 Raf-1 inhibition does not affect TLR4-induced type I IFN responses. Real-time PCR analyses of IFNB, ISG15, TRIM5, TRIM22 and APOBEC3G mrna in modcs 6 h after stimulation with TLR4
More informationHepatitis B Virus Does Not Interfere With Innate Immune Responses in the Human Liver
Gastroenterology 2018;-:1 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Q11
More informationBasics of hepatitis B diagnostics. Dr Emma Page MRCP MD(Res) Locum Consultant Sexual Health & Virology
Basics of hepatitis B diagnostics Dr Emma Page MRCP MD(Res) Locum Consultant Sexual Health & Virology Basics of hepatitis B diagnostics Background Epidemiology Morphology Life-cycle Diagnostic markers
More informationInarigivir: A novel RIG-I agonist for chronic hepatitis B
: A novel RIG-I agonist for chronic hepatitis B Stephen Locarnini, Danny Wong, Kathy Jackson, Renae Walsh, Ros Edwards, Rachel Hammond, Carla S. Coffin, Magdy Elkhashab, Susan Greenbloom, Alnoor Ramji,
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationBasis of Immunology and
Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie
More informationHBV/HCV Eradication. Prof. Jean-Michel Pawlotsky, MD, PhD
HBV/HCV Eradication Prof. Jean-Michel Pawlotsky, MD, PhD National Reference Center for Viral Hepatitis B, C and delta Department of Virology & INSERM U955 Henri Mondor Hospital University of Paris-Est
More informationSupplementary Information
Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara
More informationANTIBODIES DETERMINE VIRULENCE IN DENGUE. Scott B HALSTEAD, M.D. DIRECTOR, Research Pediatric Dengue Vaccine Initiative IVI, Seoul, Korea
ANTIBODIES DETERMINE VIRULENCE IN DENGUE Scott B HALSTEAD, M.D. DIRECTOR, Research Pediatric Dengue Vaccine Initiative IVI, Seoul, Korea Global Spread of Dengue 50-100 million infections/year Countries
More informationSUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish
SUPPLEMENTARY INFOATION Divergent TLR7/9 signaling and type I interferon production distinguish pathogenic and non-pathogenic AIDS-virus infections Judith N. Mandl, Ashley P. Barry, Thomas H. Vanderford,
More informationHost cell activation
Dept. of Internal Medicine/Infectious and Respiratory Diseases Stefan Hippenstiel Epigenetics as regulator of inflammation Host cell activation LPS TLR NOD2 MDP TRAF IKK NF-κB IL-x, TNFα,... Chromatin
More informationScreening and Diagnosis of Hepatitis Virus Infections
Screening and Diagnosis of Hepatitis Virus Infections Prof. Jean-Michel Pawlotsky, MD, PhD National Reference Center for Viral Hepatitis B, C and delta Department of Virology & INSERM U955 Henri Mondor
More informationMolecular insights into the synergism between the HBV/HDV entry inhibitor Myrcludex B and Interferon
Medical Faculty Heidelberg Molecular insights into the synergism between the HBV/HDV entry inhibitor Myrcludex B and Interferon blocking both, intrahepatic spread of HDV through de novo entry of virions
More informationNLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
More informationHHS Public Access Author manuscript Hepatology. Author manuscript; available in PMC 2017 December 01.
HHS Public Access Author manuscript Published in final edited form as: Hepatology. 2016 December ; 64(6): 2246 2249. doi:10.1002/hep.28834. Hepatitis B Virus X Protein Crosses Out Smc5/6 Complex to Maintain
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationDevelopment of subcutaneously administered RNAi therapeutic ARO-HBV for chronic hepatitis B virus infection
Development of subcutaneously administered RNAi therapeutic ARO-HBV for chronic hepatitis B virus infection Christine Wooddell, Rui Zhu, Holly Hamilton, Qili Chu, Heather Sternard, Joshua Schumacher, Thomas
More informationALN-HBV. Laura Sepp-Lorenzino November 11, Alnylam Pharmaceuticals, Inc.
ALN-HBV Laura Sepp-Lorenzino November 11, 2016 2016 Alnylam Pharmaceuticals, Inc. 1 N-Acetyl Galactosamine (GalNAc) sirna Conjugates Subcutaneous Investigational RNAi Therapeutics 5 -sense 5 -AS ASGPR
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationHepatitis B virus (HBV) infection, with 400
Therapeutic Recovery of Hepatitis B Virus (HBV)-Induced Hepatocyte-Intrinsic Immune Defect Reverses Systemic Adaptive Immune Tolerance Peixiang Lan, 1 Cai Zhang, 1 Qiuju Han, 1 Jian Zhang, 1 and Zhigang
More informationTitle: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1
1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting
More informationEmerging drugs for hepatitis B.
Emerging drugs for hepatitis B. Fabien Zoulim To cite this version: Fabien Zoulim. Emerging drugs for hepatitis B.. Expert Opinion on Emerging Drugs, Informa Healthcare, 2007, 12 (2), pp.199-217.. HAL
More informationsilent epidemic,. (WHO),
Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationHepatitis B Virus Replication in Primary Macaque Hepatocytes: Crossing the Species Barrier Toward a New Small Primate Model
Hepatitis B Virus Replication in Primary Macaque Hepatocytes: Crossing the Species Barrier Toward a New Small Primate Model Julie Lucifora, 1,2,3 * Isabelle E. Vincent, 1,2 * Pascale Berthillon, 1,2 Tatiana
More informationInnate Antiviral Immune Responses to Hepatitis B Virus
Viruses 2010, 2, 1394-1410; doi:10.3390/v2071394 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Review Innate Antiviral Immune Responses to Hepatitis B Virus Malika Ait-goughoulte 1,2,
More information