Display Unusual Genetic Diversity

Transcription

1 JOURNAL OF VIROLOGY, Mar. 1990, p X/90/ $02.00/0 Copyright 1990, American Society for Microbiology Vol. 64, No. 3 Simian Immunodeficiency Viruses from African Green Monkeys Display Unusual Genetic Diversity PHILIP R. JOHNSON,'* ANDERS FOMSGAARD,1 JONATHAN ALLAN,2 MANETH GRAVELL,3 WILLIAM T. LONDON,1 ROBERT A. OLMSTED,' AND VANESSA M. HIRSCH1 Retroviral Pathogenesis Section, Division of Molecular Virology and Immunology, Department of Microbiology, Georgetown University, Parklawn Drive, Rockville, Maryland ; Southwest Foundation for Biomedical Research, San Antonio, Texas ; and National Institute for Neurological and Communicative Disorders, Bethesda, Maryland Received 12 September 1989/Accepted 4 December 1989 African green monkeys are asymptomatic carriers of simian immunodeficiency viruses (SIV), commonly called SIVagm. As many as 50% of African green monkeys in the wild may be SIV seropositive. This high seroprevalence rate and the potential for genetic variation of lentiviruses suggested to us that African green monkeys may harbor widely differing genotypes of SIVagm. To investigate this hypothesis, we determined the entire nucleotide sequence of an infectious proviral molecular clone of SIVagm (155-4) and partial sequences (long terminal repeat and Gag) of three other distinct SIVagm isolates (90, gri-1, and ver-l). Comparisons among the SIVagm isolates revealed extreme diversity at the nucleotide and amino acid levels. Long terminal repeat nucleotide sequences varied up to 35% and Gag protein sequences varied up to 30%. The variability among SIVagm isolates exceeded the variability among any other group of primate lentiviruses. Our data suggest that SIVagm has been in the African green monkey population for a long time and may be the oldest primate lentivirus group in existence. Simian immunodeficiency viruses (SIV) are primate lentiviruses that share a common ancestry with the human immunodeficiency viruses (HIV-1 and HIV-2) (4, 5, 12, 29, 30, 35). SIV was initially isolated from immunodeficient Asian macaques (SIVmac) in captivity in the United States (2). However, macaques do not appear to be infected with SIV in the wild (21, 26). In contrast, at least six species of African primates are naturally infected with SIV (16, 21, 26). Moreover, SIV-infected African monkeys do not manifest the acquired immune deficiency syndrome-like illness observed in macaques experimentally infected with SIV (7, 8, 19, 21, 24). Thus, a detailed understanding of the natural history of SIV infection in African monkeys may provide useful insights into the pathogenesis of acquired immune deficiency syndrome and the origins of human lentiviruses. Three genetically distinct African SIV strains have been isolated in culture: SIVsm from sooty mangabeys (Cercocebus atys) (8, 21, 24), SIVagm from African green monkeys (Cercopithecus aethiops) (3, 9, 14, 18, 26), and SIVmnd from mandrills (Papio sphinx) (33). Data concerning the extent of SIV infection among feral sooty mangabeys and mandrills are not available, but several studies indicate that African green monkeys (up to 50%) are widely infected with SIV (11, 15, 16, 21, 26). Given the potential for rapid evolution of RNA viruses (32), the high incidence of SIVagm infection may provide fertile ground for substantial genetic variation. Genetic heterogeneity among SIVagm isolates was shown by previous work from our laboratory and others (7, 14, 18, 20), based on restriction endonuclease mapping, cross-hybridization, and limited nucleotide sequence data. In this report, we demonstrate that the sequence variability of SIVagm isolates exceeds that reported for isolates of HIV-1, HIV-2, and SIVmac. In fact, variation among SIVagm isolates is greater than the variation between a simian (SIVsm) and a human (HIV-2) lentivirus (12). * Corresponding author MATERIALS AND METHODS Cells and viruses. The four SIVagm isolates used in this study have been described previously (9, 14; J. S. Allan, P. Kanda, R. C. Kennedy, E. K. Cobb, M. Anthony, and J. Eichberg, AIDS Res. Hum. Retroviruses, in press) and were propagated in the human T-lymphocyte cell line CEMss (kindly provided by Peter Nara, National Cancer Institute). The designations used in this report are SIVagm 155, SIVagm 90, SIVagm gri-1 (previously called SIVagm 677), and SIVagm ver-1 (previously called SIVagm 692). SIVagm 155 and SIVagm 90 were isolated from monkeys imported from Kenya. SIVagm gri-1 and SIVagm ver-1 were isolated from monkeys originally captured in Ethiopia. PCR. Genomic DNA isolated from CEMss cells persistently infected with SIVagm was the template for polymerase chain reaction (PCR) amplification (23). An amplification reaction (100,lA) contained the following components: genomic DNA (5 [.g); primer 1 and primer 2 (0.5 p.m each, see below); dgtp, datp, dttp, and dctp (200 pum each); KCl (50 mm); Tris hydrochloride, ph 8.3 (10 mm); MgCl2 (1.5 mm); gelatin (0.01% wt/vol); and Taq polymerase (2.5 U). All reagents (Gene Amp Kit) and the DNA Thermal Cycler were from Perkin Elmer Cetus (Norwalk, Conn.). Amplification cycles were programmed as follows: 940 for 5 min, 450 for 2 min, 720 for 10 min (first cycle only); 940 for 1 min, 450 for 1.5 min, 720 for 10 min (35 additional cycles). Oligonucleotide primers were synthesized on a DNA synthesizer (model 380B; Applied Biosystems, Foster City, Calif.). Primers were designed with restriction endonuclease sites near the 5' end to facilitate cloning. The primers used to amplify SIVagm long terminal repeat (LTR) sequences were 5'ATGCGAGCTCTGGATGGGATTTATTACTCC3' (primer 406) and 5'AAGTGAATTCCACTCAAGTCCCTGTTCG GG3' (primer 407). The primers used to amplify SIVagm gag gene sequences were 5'ATAGCGGCCGCTTATTGGTCTT CTCCAAAGA3' (primer 444) and 5'TGCAGTCGACGGGC GCCCGAACAGGGACTTG3' (primer 445). Underlined nu-

2 VOL. 64, 1990 GENETIC DIVERSITY OF SIMIAN IMMUNODEFICIENCY VIRUSES 1087 Lentivirus strain TABLE 1. Percent amino acid identity between proteins of primate lentivirusesa % Identity Envelope gag pol vif v^pxr vpr re\, pat gpl2o gp32/41 gp32/41 prestop gp32/41 poststop nef whole codon codon SIVagm 155 vs: SIVagm (TYO-1) SIVsm (smh-4) HIV-1 (HXB2) SIVsm vs HIV SIVsm vs SIVmac SIVmac: 142 vs HIV-2: ROD vs NIH-Z HIV-1: HXB2 vs MAL SIVsm vs HIV a Sequences were obtained from the Los Alamos HIV sequence database. Pairwise alignments were performed by using the PRTALN program with default parameters. Amino acid identities were calculated with the inclusion of insertions and deletions. A dash indicates no comparison was performed for the following reasons: SIVagm lacks vpr, HIV-1 lacks vpx, HIV-1 lacks an in-frame stop codon in env, and nef of HIV-2 (NIH-Z) has a large deletion. cleotides signify sequences derived from the SIVagm clone that represent conserved regions among primate lentiviruses (see Results). Specificity of PCR products was confirmed by Southern blotting (31) by using specific (LTR or gag) hybridization probes derived from plasmid subclones of For cloning, 80 to 90 RI of a PCR was digested with an appropriate restriction endonuclease and separated on a preparative 1% agarose gel. Alternatively, some reaction mixtures were treated with T4 DNA polymerase (New England BioLabs, Inc., Beverly, Mass.) to generate blunt ends prior to electrophoresis. The specific band of interest was excised from the gel, purified on glass beads (Bio 101, La Jolla, Calif.), and ligated into a plasmid vector. Molecular cloning and DNA sequencing. The derivation of a biologically active proviral molecular clone of SIVagm 155 (designated 155-4) has been described previously (14). Proviral DNA was subcloned as 1- to 3-kilobase fragments into plasmid vectors. Sequencing of double-stranded DNA templates was accomplished by the dideoxynucleotide-chain termination method with T7 DNA polymerase (United States Biochemical Corp., Cleveland, Ohio). Computer-assisted analyses. Nucleotide sequence alignments were performed with the programs Genalign (IntelliGenetics, Mountain View, Calif.), NUCALN (34), and MALIGN (Hugo Martinez, University of California at San Francisco). Amino acid sequence alignments were performed with Genalign or PRTALN (34). To identify highly conserved or invariant motifs, amino acid sequences were compared to consensus-like sequences for primate lentiviruses generated in conjunction with the PLSEARCH program (Randall Smith and Temple Smith, Dana Farber Cancer Institute, Harvard University; as described in reference 25) Ṫhe nucleotide sequences described in this paper have been submitted to the GenBank database under accession numbers M29973, M29974, M29975, and M RESULTS Nucleotide sequence of SIVagm 155: comparison with those of other primate lentiviruses. We determined the complete nucleotide sequence (9,775 base pairs) of the biologically active proviral molecular clone and compared it with other primate lentivirus sequences (Table 1). The overall genome organization of closely resembled those of other primate lentiviruses. In addition to the traditional retroviral genes (gag, pol, and env), five other genes were identified (by genome position and amino acid identity) as vif, vpx, rev, tat, and nef. Like that of TYO-1 (the other completely characterized SIVagm molecular clone [7]), the genome lacked the vpr gene found in all other primate lentiviruses. A gene-by-gene comparison of deduced amino acid identities from and TYO-1 revealed unexpected findings (Table 1). Although Gag was relatively well conserved (90%), amino acid identities between other viral proteins ranged from 63 to 82%. Surprisingly, the two gene products displaying the lowest identities were the transacting nuclear regulatory proteins, Rev (63%) and Tat (68%). Inspection of the two Rev amino acid sequences revealed that the amino-terminal half was well conserved (76%), while the carboxy-terminal half was poorly conserved (50%) (data not shown). This suggested that the amino-terminal half of Rev might contain sequences important for Rev function. In fact, the most highly conserved region was the putative arginine-rich nuclear localization domain (14 consecutive identical residues) (22) located in the amino-terminal half of Rev. For Tat, similar regional conservation was noted (data not shown). The cysteine-rich metal binding motif was almost completely conserved, while the carboxy-terminal second exon was poorly conserved in sequence and length. Another surprising finding was the low identity (79%) between the Pol proteins of the two SIVagm clones. The most highly conserved pol-encoded enzyme was integrase (83%), while protease and reverse transcriptase were less conserved (76 and 78%, respectively). Given the low conservation of the rev, tat, and pol genes, we expected the env gene to exhibit a high degree of variation. However, the identity between the two SIVagm envelope glycoproteins (79%) was the same as between the two Pol proteins and was higher than identities between Rev (63%) or Tat (68%) proteins. Interestingly, the external glycoprotein (gpl20) was more conserved than the transmembrane glycoprotein (gp38). This was partially due to poor amino acid identity (64%) after a premature stop codon in the cytoplasmic domain of the transmembrane glycoprotein. This in-frame stop codon was in the same position in and TYO-1 but was downstream of the premature stop codon in SIVmac and HIV-2 molecular clones (1, 6, 7, 10, 13).

3 1088 JOHNSON ET AL. J. VIROL. SIVagm isolates SI1Vsm/SIVmac/HIV-2 isolates HIV-1 isolates TYO-1 90 gri-i ver-i UV-2 mac251 sm ROD SBL BRU RF MAL macl TYO mac gri-l smh4 HIV-2 ROD HXB BRU RF 85 FIG. 1. Percent nucleotide identity between LTRs of primate lentiviruses. SIVagm LTR sequences were taken from Fig. 2; other LTR sequences were obtained from the Los Alamos HIV sequence database. Pairwise nucleotide alignments were performed by using the program Genalign. Identities were calculated with the inclusion of insertions and deletions. We next compared the variation between the two SIVagm clones (155-4 and TYO-1) with variation between clones of other groups of primate lentiviruses (Table 1). Overall, the SIVagm clones were the most divergent species-specific pair examined. For example, two divergent HIV-1 isolates (HXB2 and MAL) exhibited 91% identity in Pol (79% for SIVagm), 84% in Rev (63% for SIVagm), and 75% in Tat (68% for SIVagm). The divergence between the two SIVagm clones was roughly equivalent to the divergence we previously reported for SIVsm and HIV-2 (12). LTR and Gag sequences from other SIVagm isolates reveal extreme diversity. Because of the surprising variation between and TYO-1, we extended our analyses to include three other SIVagm isolates. We previously showed by nucleic acid cross-hybridization studies that SIVagm 90, SIVagm gri-1, and SIVagm ver-1 were genetically distinct from SIVagm 155 and from each other (14). To partially quantitate these differences, we amplified, cloned, and sequenced the 5' end (LTR through gag) of integrated proviral DNA representing agm 90, gri-1, and ver-1. Our strategy for cloning sequences of unknown divergence involved identifying regions of high conservation among all primate lentiviruses and synthesizing complementary primers for use in PCR amplification under conditions of reduced stringency. For LTR amplification, we identified the absolute 5' end of U3 in the LTR (primer 406) and the primer binding site just downstream of the LTR (primer 407) as conserved regions (see Materials and Methods). To amplify the gag gene (including noncoding sequences), we exploited the conserved primer binding site and synthesized a primer (no. 445) representing the inverse complement of primer 407. The second primer (no. 444) for gag amplification was derived from conserved sequences at the 3' end of gag. Comparisons of LTR sequence identities for pairs of primate lentiviruses are shown in Fig. 1. The gri-1 and ver-1 LTR sequences were very different from those of and TYO-1 (67 to 71% identity) and from each other (65% identity). Similar comparisons between LTR sequences of other pairs of primate lentiviruses showed that SIVagm isolates were by far the most divergent (Fig. 1). Global inspection of a multiple alignment of primate lentivirus LTRs revealed an enormous amount of sequence variation, especially in U3 and U5 (Fig. 2). Despite the lack of overall nucleotide identity, the SIVagm LTR shared certain structural features with the HIV-1 LTR, including overall length, gaps in U3 and U5 (relative to the SIVsm LTR), and a single TAR sequence (target sequence for transactivation; see below). Enhancer and signal sequences were generally well conserved. Although more than one core enhancer-like sequence was noted in several of the LTR U3 regions, only one enhancer sequence (boxed in Fig. 2) was perfectly conserved in all primate lentivirus LTRs. The invariance of this element suggested that it may serve as the major core enhancer. Other signals in U3 (Sp-1 sites and TATA boxes) were imperfectly but highly conserved. An interesting feature of the R region was the apparent insertion of a second TAR sequence (TAR 2, Fig. 2) in SIVsm (and SIVmac and HIV-2, data not shown) relative to all the SIVagm clones and HIV-1. This tandem TAR region in the SIVsm/SIVmac/ HIV-2 group of viruses has sequence similarity to the human variable heavy-chain gene (25). One possible interpretation of this observation is that the common progenitor of this triad of viruses was a retrovirus infecting humans. Another possibility (which we favor) is that this sequence represents an insertion from a simian variable heavy-chain gene, but sequence data are not available to validate this conclusion. To determine whether the LTR nucleotide variation was reflective of variation in coding regions of SIVagm genomes, we sequenced the gag genes of the gri-1 and ver-1 isolates. A comparison of Gag amino acid identities is shown in Fig. 3. SIVagm Gag proteins were highly divergent (up to 30% variation) when compared with those of other primate lentivirus isolates (up to 17% variation). The high degree of variation notwithstanding, predicted sites of polypeptide cleavage and the cysteine-rich domain in p15 were well conserved (data not shown). DISCUSSION Genetic variation of SIVagm: factors influencing diversity. Our data indicate that SIVagm isolates from a restricted geographic locale (East Africa) display genetic variation that is unusual in kind and amount. To understand how this genetic diversity occurred, we should consider at least four factors that influence genetic variation in retroviruses (and RNA viruses in general): mutation rate, replication cycles, constraints, and selective pressures. The effects of mutation rate and replication cycles are intertwined. The relatively high error rate for the polymerase of retroviruses (and in particular, HIV-1) is well documented (27, 28). Therefore, nucleotide substitutions (if tolerated) in a retroviral genome might be expected to accumulate over a given number of replicative cycles. The absolute number of replication cycles is determined by the rate of replication, the time span of replication, and the virus load. The error frequency for the SIVagm polymerase and the rate of SIVagm replication have not been determined. However, it is likely that the SIVagm polymerase error rate does not differ dramatically from that of other retroviruses (in particular, lentiviruses). In addition, there is no evidence that SIVagm replicates at an extraordinary pace in African green monkeys. Thus, unusual polymerase infidelity and rapid replication rate may not be major factors in the extreme genetic diversity among SIVagm isolates.

4 VOL. 64, 1990 GENETIC DIVERSITY OF SIMIAN IMMUNODEFICIENCY VIRUSES 1089 AGM TYO-1 AGM 90 AGM gri-1 AGM ver-1 AGM 155 HIV-1 SIVsm U3 -* TGGATGGGATTTATTACTCCGATAGGAGAAATAAGATC CTGAATCTGT ATGCTCTTAATGAAT GGGGGATAATTGATGATTGGAATGCCTGGTCGAAGGGACCAGGAATAAGATrTCCC-TA A-----G---- GA-----C--C--A A--C A-----AGCA C AT--CC A--A---G-A T CT-G--C--G ----A-----A C-A--T-AC--ACCA--C--G--G-----G-A---G A--A--GG-A----TT----C AT-A A--C--A C-A--T-ATA-TCCA--T-----C--C----AT--A T C--C A--C C--A-----A--A-----T--G A---G- ----A--- C-AAT-C-----C-AC-A---C-AG-T-----TG -----GGATCTACC-CAC-CAA--CTACT-CCC-----A-C-GAA--ACA-ACCA--G-----G--C----AT--AC. AGM TYO-1 AATGCTTTGGGTTCTGCTTTAAGCTAGTGCCAGTGGACTTACATGAGGAAGCACAAACA... TGTGAAAGA. CAT.TGCCTAGTCCATCCAGCGCAGATGGGAGAAGATCCAGATGGTA AGM 90 GC C--T-----C---T----A--G--A--GA-G-----A--G---G----C G T-G--G-----T--A--AG-AAA---G--C--C-----C- AGM gri-1 AGM ver-1 G-GT------C C C-G G----GC-AC G C.--T--GA-GA A G T-----A- G T---G-AT C-TAG G---GG G C.--T--G T--T--AT-ACAG--G AGM 155 GG C C A--G--T-C-C-G G G T-G--A--C-----A--AC--CAT-----C--T TV-1 wtii T.Atf------A-n,G----AC A-----T--n.rr-n--CA--TT--A-r.--a-rPAArAAAC,--āT --A--rrtA--T-CT-A--C--T-T-AG==--CAT-G-ATMAT _. A-u Au ---A--- s V A As A V V WiW V V-A- -_A- s-..a...-.-a _--. V A *ww SIVsm TGCA--A.----GGCT--GG--AT-----C---A--TG-CTCA--TT----- T--GGA-...GAC--G-C G--G------G--A---..ACTTATCA.GTGG----A.. C.E C.E AGM TYO-1 CGCAAGCCTGCGGTTAGAACATCACCATGGAGATGACATTAAAAACTGCTGACT...GGGACTTTCCAGCGA...GA.GGACTTTCCA.. AGM G--T--T-----AGC-G-TG--GG AA-.. AGM gri c--c--t-tg-... GG--GGG-CT-T-C-C A AGM ver-1.cg-g--...cg----cc--tgtacc--ccagca-ag-... AACCATGC-AATGAGCT... AGM 155 -A--G--T TCCTGG-TG--TA HIV-1 A--.T--A-C T--T G ATCGA.GCTTGCTACAA TG.. SIVsm GTA---AGAAG-C-A-CCG--AG-GG... CCTT. TTAAAAT--CTG... -CAAGAAGGAAACAAGCTGAGACAGC _CA Sp.1 Sp.1 Sp-1 TATA U31R AGM TYO-1... AGGCGGGACATGGGCGGTCC.GGGGAGTGGCTTTACCCTCAGA.GCTG ATAAAAG CAGATGCTCGCTGGC.TTGTAAC.TCAGT.CTCT. AGM 90.G------C A T AGM gri-1 GTGGG.TG.GATCGGTCT----G---G A -.T C AGM ver gaa..t--a tat-----t TTG AGM HIV-1... GGG-----T-G-C GA-T GAG TC- --C- ----TTT--C GG CTG SIVsm AGGGGCTGTCAT... G--A--T--TG---A--AG-T--CT..G-AACGCC-A--T-TTCT T -AC---.ATT-C--TC T-----G--CTGCGGAGAGGCTGG AGM TYO-1 TCAGCCATGGAGAGA..TCTTGGTGTGGAAGTTTGATCC.TATGTTGGCAATACAGTACGACCCCAATCGGGAGTACTTTACTGACATGCATGGGCTGGTGA. AGAGGAAGTAGCCAGAC AGM T C------C C--C------A---G-G-----T-----A--CA-AC----T--AGAA CA T-. -- AGM gri-1 -AGAT AG C C---.G-A GG-GG CG---...G-AC-..TG----AG A--C-AA-AT-CA-. --C-CT AGM ver-i --T-G A-.. CA-----C----GA--CA----.C---C-A---TGCA--GC-ATG--... A--AG..TG--C-A CAACA G.... AGM 155 -A-AT A-..-A---- CA A TG-T TCAA A---T-AT--TCAACA---GT-C-----ACTAG-C--- HIV-1.-CCGG-GA----AG..-G--A-A-----G CAG.CCGCC-A---T-T-....-TC-CA-G---C--G SIVsm.-CC G----GG-AC---CA AGAA--A--TTATAGC--TA-GG-ATT-ATTA-----CCAGAA--GT-TGG-A-TAA-TCAGGCTT-TC--.--GA---G TAR 2 TAR I _ AGM TYO-1...TACTAGGAGACCAGCT.TGAGCCTGGGTGTTCGCTGGTT.AGCCTAACCTGG..TTGGCC..ACCAGGG... GTAAG.GACTCCTTGGC AGM AGMgri-1...A C G---. AGM ver A C C.T A-C----AC--- AGM HIV-1... GTT A-C A-C--T----C-.-A-...T----. AACCC-CT-CT-. SIVsm CAGATTGAGCCCTGGGAGGTTCTCTCC-GC-CT G-. A C---C-AG-CT--C---A-CAC------GGTG-T---CAGAGTGGC-CCAC-CT-G PolyA RIU5 AGM TYO-1 TT.AGAAAGCT... AATAAA. TTGCCTGCATTAGAGCT.TATCTG. AGTCAAGTGCCCTCATTGACGCCTC.ACTCTCTTGAACG. GGAATC. AGM G _ A A AA-C-G G AGM gri-1 --C-T-T----C..T. A-.C---TC--T-AGTC---A---TG CT--GC-G-GC----A-.-G-.T---C-. AGM ver T---T.. -C------C AG-.AC-TC GT---GT-C-----C G-TC AGM G A G CAAG. ---.GT- --TT-TGG.----T-GAA... HIV-1 G G--T---.-CAAGT.---.GT------G.TC-.. -TT-TG-G AA... T SIVsm --.-A-G-C--CTTC --- C-.---A.AT-.---AG... TAAGCA-.GTGT---TT-C---CTCTC-TAGTCGC-G-C--GT-ATCTCGGTACTCGACAC.ATAAGAAGACCCTGGT AGM TYO-1 TTCCTTACTGGGTTCTCTCTCTG... ACCCAGGCGAGAGAAACTCCAGCA AGM O AGM gri-1 -CT-- ---G-.T AGM ver-1 C--AA T...G------G AGM AA HIV-1 AGAGA-C-CTCAGA-C--T-T... GT---TGTG--A--T---T---- SIVsm C-GT-AGGACCC--TCTG--T--GAAA---G----AG--A--T-C-T---- FIG. 2. Alignment of LTR nucleotide sequences of primate lentiviruses. Nucleotide sequences were derived as described in the text (all SIVagm sequences) or were obtained from the Los Alamos HIV sequence database (25). The HIV-1 clone was HXB2 and the SIVsm clone was smh-4. A dash indicates identity with the TYO-1 nucleotide sequence and dots represent gaps introduced to optimize the alignment. Highly conserved regulatory sequences are boxed. The U3/R and R/U5 junctions are indicated by solid overlines. The TAR sequences (TAR 1 and TAR 2) are indicated by dashed overlines. C.E., Core enhancer; Sp-1, potential Sp-1 binding sites; TATA, TATA box; Poly A, signal sequence for polyadenylate addition. Two factors that may have considerable bearing on infected by SIV (11, 15, 16, 21, 26). Thus, the extreme SIVagm variability are (i) how long the virus has been genetic variability among SIVagm isolates probably reflects replicating (time span) and (ii) how many viruses are repli- an accumulation of tolerated nucleotide substitutions introcating (virus load). SIVagm may be the oldest of the primate duced by polymerase errors over a large number of replicalentiviruses in existence. African green monkeys were tive cycles (many animals infected for a long time). widely infected in the 1950s (11), predating documented Structural (or functional) constraints and selective presinfection by any other primate lentivirus. Furthermore, sures may limit the extent and influence the type of genetic recent large-scale serologic surveys have shown that as change. The Rev protein is a likely example of a sequence many as 50% of African green monkeys in the wild are with functional constraints. Rev is a regulatory protein that

5 1090 JOHNSON ET AL. J. VIROL. SIVagm isolates SIVem/SIVmac/HIV-2 isolates HEIV-1 isolates TYO-l gri-l ver-1 HIV-2 mac251 sm ROD SBL BRU RF MAL TYO-1 gri maci mac smhr4 HIV-2 ROD HXB BRU RF FIG. 3. Percent amino acid identity between Gag proteins of primate lentiviruses. SIVagm Gag amino acid sequences (except TYO-1) were derived as described in the text; other Gag sequences were obtained from the Los Alamos HIV sequence database. Pairwise amino acid alignments were performed by using the program PRTALN. Identities were calculated with the inclusion of insertions and deletions. 84 positively influences the expression of viral structural proteins and is required for viral replication (22). Because of this essential function, one might expect a high level of sequence conservation. However, we observed a low level of overall sequence identity between the SIVagm 155 and TYO-1 Rev proteins; rather, only distinctive functional domains were highly conserved. Further examination and alignment of Rev sequences from all primate lentiviruses confirmed that certain domains were relatively invariant, while other regions shared very little identity (data not shown). Thus, domains required for vital functions are likely intolerant of substitutions, while other relatively nonessential sequences may sustain many substitutions during repeated replication events. Many selective pressures, including environmental and host-specific factors, affect the evolution and variation of viruses. One recognized selective pressure is the influence of host immune responses on sequence variation in the surface glycoproteins of enveloped RNA viruses (32). The surface glycoprotein is exposed to circulating antibodies and immune effector cells that may neutralize the virus. Mutations arising during replication that allow a virus to escape neutralization or elimination may gain a selective advantage. Neutralization escape mutants subsequently elicit new immune responses and another round of selection takes place. In RNA viruses, this type of selective pressure occurs on a background of accumulating polymerase errors. Therefore, the env gene of lentiviruses (and other infectious retroviruses [4]) might be expected to diverge more rapidly than genes encoding internal structural proteins (like gag and pot). In agreement with this hypothesis, env is the most divergent gene among HIV-1 isolates (Table 1). In contrast, the env gene of SIVagm appears to be diverging in concert with the rest of the genome. Between the two completely sequenced SIVagm isolates (155 and TYO-1), only the gag gene is significantly more conserved than the env gene. These data suggest that immune selection may not be a significant factor influencing SIVagm env gene variation. The importance of specific immune responses (or lack thereof) in SIVagm infection of African green monkeys remains to be determined. One intriguing explanation for the unusual genetic diversity among SIVagm isolates might be intratypic genetic recombination. The presence of multiple distinct genotypes within a single animal has not been demonstrated to date. Additional analyses of SIVagm sequences present in wildcaught African green monkeys will be required to address this issue. Also, the availability of distinct biologically active SIVagm molecular clones may afford the opportunity to study dual infections in experimentally infected monkeys. Phylogeny and origins of SIVagm and other primate lentiviruses. In light of the data presented here, it was of interest to examine the phylogenetic relationships among SIVagm and other primate lentiviruses. Prior to phylogenetic analysis, we assumed that SIVagm might group with other simian lentiviruses (SIVsm, SIVmac, and HIV-2) based on the following observations. (i) SIVagm infects feral monkeys without causing illness; this is also true for SIVsm, the likely progenitor of SIVmac and HIV-2 (8, 12, 21, 24). (ii) Comparisons of amino acid identities between SIVagm and other primate lentiviruses show that SIVagm is slightly more related (over the entire genome) to simian lentiviruses than to HIV-1 (Table 1; reference 7). (iii) The SIVagm genome contains the vpx gene; this gene is also found in SIVsm/ SIVmac/HIV-2, but not HIV-1. (iv) The envelope proteins of the simian lentiviruses, including SIVagm, contain five to six more cysteine residues than the envelope protein of HIV-1. To more rigorously test this assumption, we constructed a phylogenetic tree based on LTR nucleotide sequences of primate lentiviruses (Fig. 4). This analysis revealed a virtual trichotomy among HIV-1, SIVagm, and SIVsm/SIVmac/ HIV-2, implying that the three groups of primate lentiviruses have radiated in time from a common (but unknown) progenitor virus (G. Myers, personal communication). This interpretation is in full agreement with several phylogenetic analyses of HIV and SIV coding sequences reported by other investigators (5, 29, 35). Considered together, these analyses conclude that the time since the divergence of SIVagm, HIV-1, and SIVsm/HIV-2/SIVmac can be measured in decades or centuries. Thus, it is likely that infection of humans by pathogenic lentiviruses (HIV-1 and HIV-2) is a relatively recent event. However, the origins of human lentiviruses are not known. We previously reported that SIVsm, a West African nonhuman primate lentivirus, was closely related to HIV-2 and suggested that SIVsm may have infected humans in West Africa and evolved as HIV-2 over the last 30 to 50 years (12). It seems likely that HIV-1 evolved in a similar manner in Central Africa, the result of horizontal transmission of a simian lentivirus (perhaps avirulent in its natural host) to a human(s). It is tempting to speculate that SIVagm or a closely related lentivirus was the ancestor of HIV-1. However, the evolutionary distances between HIV-1 and SIVagm and other present-day simian lentiviruses do not allow us to currently identify a simian progenitor for HIV-1. The rapid evolution of HIV-1 may prevent the discovery of a relationship like that between SIVsm and HIV-2. The unusual genetic diversity of simian lentiviruses from African green monkeys suggests that a continued search for novel African lentiviruses may provide important clues to the origins of HIV-1. Use of PCR to amplify divergent viral sequences. The advent of automated PCR technology has spawned the investigation of nucleotide sequences that otherwise might

6 VOL. 64, 1990 GENETIC DIVERSITY OF SIMIAN IMMUNODEFICIENCY VIRUSES 1091 I ZWA- agm 155 SIVagm 58/.U 45/.09 gri.1 4.3/09 ver /07 HIV-2 30/.06 W07 28rz SlVmac SIVsm FIG. 4. Minimum-length evolutionary tree based on LTR nucleotide sequences of primate lentiviruses. The tree was constructed as described previously (25, 30) from variation in LTR nucleotide sequences by using the branch and bound algorithm of PAUP (version 2.4.2). The LTR sequences were obtained from the Los Alamos HIV sequence database (25): HIV-1 is HXB2, HIV-2 is ROD, SIVmac is MM251, and SIVsm is smh-4; the SIVagm sequences are described in the text. The total number of sites examined was 505 (of which 326 were variable) and the consistency index was Lengths of the horizontal lines (indicated above each line) are proportional to the minimum number of nucleotide substitutions required to generate the observed variation; the percentage figure above each line is the ratio of the branch length and the total number of sites. The length of vertical lines is for clarity only. The tree was rooted on a random sequence (generated by the MARKOVALL program) and was roughly calibrated by aligning the tip for SIVsm with that of agm TYO-1; the assumption is that the viruses from which these sequences were derived were isolated at about the same time. By using the branch and bound algorithm of PAUP, a second tree was found that is rooted such that HIV-1 and HIV-2 are in the same clade. The same two trees were found by using the DNABOOT algorithm of PHYLIP (version 3.21), indicating an irreducible ambiguity for this data set. not have been examined because of time-consuming and cumbersome cloning procedures. Recently, mitochondrial DNA evolution in animals has been analyzed by amplifying divergent sequences located between regions of high conservation (17). We devised a similar strategy for generating sequences from highly divergent isolates of SIVagm by identifying conserved domains among available sequences of primate lentiviruses. As sequences from different primate lentiviruses become available, highly conserved consensus sequences will emerge that should allow rapid analyses of highly diverse lentiviral genomes. This general strategy is applicable to any set of related sequences containing conserved domains. ACKNOWLEDGMENTS We thank Gerry Myers and Kersti Maclnnes of the Los Alamos HIV sequence database for many helpful discussions and computer analyses; Steve Feinstone for introducing us to PCR; George Dapolito, Chris McGann, and Svetlana Kitov for expert technical assistance; and Robert Purcell, John Gerin, and Robert Chanock for continued support. This work was supported in part by Public Health Service contract N01-AI from the National Institute of Allergy and Infectious Diseases. LITERATURE CITED 1. Chakrabarti, L., M. Guyader, M. Alizon, M. D. Daniel, R. C. Desrosiers, P. Tiollais, and P. Sonigo Sequence of simian immunodeficiency virus from macaque and its relationship to other simian and human retroviruses. Nature (London) 328: Daniel, M. D., N. L. Letvin, N. W. King, M. Kannagi, P. K. Sehgal, R. D. Hunt, P. J. Kanki, M. Essex, and R. C. Desrosiers Isolation of a T-cell tropic HTLV-II like retrovirus from macaques. Science 228: Daniel, M. D., Y. Li, Y. M. Naidu, P. J. Durda, D. K. Schmidt, C. D. Troup, D. P. Silva, J. J. MacKey, H. W. Kestler III, P. K. Sehgal, N. W. King, Y. Ohta, M. Hayami, and R. C. Desrosiers Simian immunodeficiency virus from African green monkeys. J. Virol. 62: Doolittle, R. F., D.-F. Feng, M. S. Johnson, and M. A. McClure Origins and evolutionary relationships of retroviruses. Q. Rev. Biol. 64: Doolittle, R. F The simian-human connection. Nature (London) 339: Franchini, G., C. Gurgo, H.-G. Guo, R. C. Gallo, E. Collati, K. A. Fargnoli, L. F. Hall, F. Wong-Staal, and M. S. Reitz, Jr Sequence of the simian immunodeficiency virus and its relationship to the human immunodeficiency viruses. Nature (London) 328: Fukasawa, M., T. Miura, A. Hasegawa, S. Morikawa, H. Tsujimoto, K. Miki, T. Kitamura, and M. Hayami Sequence of simian immunodeficiency virus from African green monkey, a new member of the HIV/SIV group. Nature (London) 333: Fultz, P. N., H. M. McClure, D. C. Anderson, R. B. Swenson, R. Anand, and A. Srinivasan Isolation of a T-lymphotropic retrovirus from naturally infected sooty mangabey monkeys (Cercocebus atys). Proc. Natl. Acad. Sci. USA 83: Gravell, M., W. T. London, R. S. Hamilton, G. Stone, and M. Monzon Infection of macaque monkeys with simian immunodeficiency virus from African green monkeys: virulence and activation of latent infection. J. Med. Primatol. 18: Guyader, M., M. Emerman, P. Sonigo, F. Clavel, L. Montagnier, and M. Alizon Genome organization and transactivation of the human immunodeficiency virus type 2. Nature (London) 326: Hendry, R. M., M. A. Wells, M. A. Phelan, A. L. Schneider, J. S. Epstein, and G. V. Quinnan Antibodies to simian immunodeficiency virus in African green monkeys in Africa in Lancet ii: Hirsch, V. M., R. A. Olmsted, M. Murphey-Corb, R. H. Purcell, and P. R. Johnson An African primate lentivirus (SIVsm) closely related to HIV-2. Nature (London) 339: Hirsch, V. M., N. Reidel, and J. I. Mullins The genome organization of STLV-3 is similar to that of the AIDS virus

7 1092 JOHNSON ET AL. except for a truncated transmembrane protein. Cell 49: Johnson, P. R., M. Gravell, J. Allan, S. Goldstein, R. A. Olmsted, G. Dapolito, C. McGann, W. T. London, R. H. Purcell, and V. M. Hirsch Genetic diversity among simian immunodeficiency virus isolates from African green monkeys. J. Med. Primatol. 18: Kanki, P. J., J. Alroy, and M. Essex Isolation of T- lymphotropic retrovirus related to HTLV-I/LAV from wild caught African green monkeys. Science 230: Kanki, P. J., R. Kurth, W. Becker, G. Dressman, M. F. McLane, and M. Essex Antibodies to simian T-lymphotropic retrovirus type III in African green monkeys and recognition of STLV-III viral proteins by AIDS and related sera. Lancet i: Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Edwards, S. Paabo, F. X. Villablanca, and A. C. Wilson Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc. Natl. Acad. Sci. USA 86: Kraus, G., A. Werner, M. Baier, D. Binniger, F. J. Ferdinand, S. Norley, and R. Kurth Isolation of human immunodeficiency virus-related simian immunodeficiency viruses from African green monkeys. Proc. Natl. Acad. Sci. USA 86: Letvin, N. L., M. D. Daniel, P. K. Sehgal, R. C. Desrosiers, R. D. Hunt, L. M. Waldron, J. J. MacKey, D. K. Schmidt, L. V. Chalifoux, and N. W. King Induction of AIDS-like disease in macaque monkeys with T-cell tropic retrovirus STLV-III. Science 230: Li, Y., Y. M. Naidu, M. D. Daniel, and R. C. Desrosiers Extensive genetic variability of simian immunodeficiency virus from African green monkeys. J. Virol. 63: Lowenstine, L. J., N. C. Pederson, J. Higgins, K. C. Pallis, A. Uyeda, P. Marx, N. W. Lerche, R. J. Munn, and M. B. Gardner Seroepidemiologic survey of captive old-world primates for antibodies to human and simian retroviruses, and isolation of a lentivirus from sooty mangabeys (Cercocebus atys). Int. J. Cancer 38: Malim, M. H., S. Bohnlein, J. Hauber, and B. R. Cullen Functional dissection of the HIV-1 Rev trans-activator-derivation of a trans-dominant repressor of rev function. Cell 58: Mullis, K. B., and F. A. Faloona Specific synthesis of J. VIROL. DNA in vitro via a polymerase catalyzed reaction. Methods Enzymol. 155: Murphey-Corb, M., L. N. Martin, S. R. S. Rangan, G. Baskin, B. J. Gormus, R. H. Wolf, W. A. Andes, M. West, and R. C. Montelaro Isolation of an HTLV-III related retrovirus from macaques with simian AIDS and its possible origin in asymptomatic mangabeys. Nature (London) 321: Myers, G., A. B. Rabson, S. F. Josephs, T. F. Smith, J. A. Berzofsky, and F. Wong-Staal Human retroviruses and AIDS Theoretical Division, Los Alamos National Laboratory, Los Alamos, N.Mex. 26. Ohta, Y., T. Masuda, H. Tsujimoto, K. Isehikawa, T. Kodama, S. Morikawa, M. Naki, S. Honjo, and M. Hayami Isolation of simian immunodeficiency virus from African green monkeys and seroepidemiologic survey of the virus in various non-human primates. Int. J. Cancer 41: Preston, B. D., B. J. Poiez, and L. A. Loeb Fidelity of HIV-1 reverse transcriptase. Science 242: Roberts, J. D., K. Bebenek, and T. A. Kunkel The accuracy of reverse transcriptase from HIV-1. Science 242: Sharp, P. M., and W.-H. Li Understanding the origins of AIDS viruses. Nature (London) 336: Smith, T. F., A. Srinivasan, G. Schochetman, M. Marcus, and G. Myers The phylogenetic history of immunodeficiency viruses. Nature (London) 333: Southern, E. M Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98: Steinhauer, D. A., and J. J. Holland Rapid evolution of RNA viruses. Annu. Rev. Microbiol. 41: Tsujimoto, H., R. W. Cooper, T. Kodama, M. Fukasawa, T. Miura, Y. Ohta, K. Ishikawa, M. Nakai, E. Frost, G. E. Roelants, J. Roffi, and M. Hayami Isolation and characterization of simian immunodeficiency virus from mandrills in Africa and its relationship to other human and simian immunodeficiency viruses. J. Virol. 62: Wilbur, W. J., and D. J. Lipman Rapid similarity searches of nucleic acid and protein sequence databanks. Proc. Natl. Acad. Sci. USA 80: Yokoyama, S., L. Chung, and T. Gojobori Molecular evolution of the human immunodeficiency and related viruses. Mol. Biol. Evol. 5: