IMMUNE SELECTION IN VITRO REVEALS HUMAN IMMUNODEFICIENCY VIRUS-1 NEF SEQUENCE MOTIFS IMPORTANT FOR ITS IMMUNE EVASION FUNCTION IN VIVO

Transcription

1 JVI Accepts, published online ahead of print on 2 May 2012 J. Virol. doi: /jvi Copyright 2012, American Society for Microbiology. All Rights Reserved. Lewis et al 1 Mapping Nef MHC-I downregulation with Immune Selection IMMUNE SELECTION IN VITRO REVEALS HUMAN IMMUNODEFICIENCY VIRUS-1 NEF SEQUENCE MOTIFS IMPORTANT FOR ITS IMMUNE EVASION FUNCTION IN VIVO Martha J. Lewis# 1,2, Patricia Lee 1,2, Hwee L. Ng 1,2,3, Otto O. Yang 1,2,3 1 Department of Medicine, Division of Infectious Diseases; 2 UCLA AIDS Institute; 3 Department of Microbiology, Immunology, and Medical Genetics, Geffen School of Medicine at UCLA, Los Angeles, CA, USA #Corresponding author: LeConte Ave., CHS , Los Angeles, CA, malewis@mednet.ucla.edu. (310) (office); (310) (fax). Running title (54 characters): Mapping Nef MHC-I downregulation with Immune Selection Word count: abstract 226; Text 5,949 Key words: HIV-1, MHC Class I Genes, Cytotoxic T-Lymphocyte, Nef, molecular evolution

2 Lewis et al 2 Mapping Nef MHC-I downregulation with Immune Selection ABSTRACT Human Immunodeficiency Virus-1 (HIV-1) Nef downregulates Major Histocompatibility Complex class I (MHC-I), impairing clearance of infected cells by CD8 + cytotoxic T lymphocytes (CTLs). While sequence motifs mediating this function have been determined by in vitro mutagenesis studies of laboratory adapted HIV-1 molecular clones, it is unclear whether the highly variable Nef sequences of primary isolates in vivo rely on the same sequence motifs. To address this issue, nef quasispecies from nine chronically HIV-1-infected persons were examined for sequence evolution and altered MHC-I downregulatory function under Gagspecific CTL immune pressure in vitro. This selection resulted in decreased nef diversity and strong purifying selection. Site-by-site analysis identified 13 codons undergoing purifying selection, and one undergoing positive selection. Of the former, only 6 have been reported to have roles in Nef function, including 4 associated with MHC-I downregulation. Functional testing of naturally occurring in vivo polymorphisms at the 7 sites with no previously known functional role revealed 3 mutations (A84D, Y135F and G140R) that ablated MHC-I downregulation, and 3 (N52A, S169I, and V180E) that partially impaired MHC-I downregulation. Globally, the CTL pressure in vitro selected functional Nef from the in vivo quasispecies mixtures that predominately lacked MHC-I downregulatory function at baseline. Overall, these data demonstrate that CTL pressure exerts a strong purifying selective pressure for MHC-I downregulation and identifies novel functional motifs present in Nef sequences in vivo.

3 Lewis et al 3 Mapping Nef MHC-I downregulation with Immune Selection INTRODUCTION The HIV-1/SIV accessory protein Nef, an abundantly expressed 27kDa myristoylated protein, is not essential for viral replication but is central to pathogenesis (reviewed in (21, 48)). This protein plays a key role in viral persistence and virulence. In humans, infection with Nefdefective HIV-1 has been associated with low-to-undetectable levels of viremia with vigorous antiviral immunity and delayed disease progression (14, 18, 19, 31, 32, 34, 44). Similarly, experimental infection of rhesus macaques with SIV in which Nef has been deleted (SIV239Δnef) results in low-to-undetectable levels of viremia, asymptomatic infection, and protection from subsequent challenge with wild type virus (17). This model system has been considered the gold standard for a disease-attenuating vaccine model. Although numerous functions have been attributed to Nef, the mechanisms whereby Nef exerts these dramatic clinical effects appear to involve its ability to direct immune evasion. While Nef initially was misunderstood as a negative transcriptional activator (2, 45), further work has shown that it contributes to viral pathogenesis through multiple functions that enhance viral infectivity, such as downregulation of CD4 on the surface of infected cells (24, 37) and modulation of cellular activation (8, 9, 56, 58, 61). Furthermore, it is well established that Nef downregulates Major Histocompatibility Complex class I (MHC-I) cell surface proteins (12, 13, 60). In vitro models demonstrate that Nef-mediated MHC-I downregulation impairs cytotoxic T lymphocyte (CTL) recognition and clearance of infected cells (1, 13, 63, 68), suggesting that it plays a central role in immune evasion. In vivo evidence also suggests that this function is important for immune evasion. Rhesus macaques infected with SIV containing Nef rendered specifically defective in MHC-I downregulation function via difficult-to-revert mutations showed trends for higher CTL levels

4 Lewis et al 4 Mapping Nef MHC-I downregulation with Immune Selection and lower viremia in the first 14 weeks of infection followed by viral rebound accompanied by a striking pattern of Nef evolution to reconstitute this function via new sequence motifs resembling those in HIV-1 (62). In chronically HIV-1-infected humans, Nef has been shown to lose function in persons with severely depressed cellular immunity due to very young age (25, 65) or late stage AIDS (11, 33), and more specifically, its MHC-I downregulatory function correlates to the breadth of the HIV-1-specific CTL response during chronic infection (40). These data strongly suggest the importance of this function in the immunopathogenesis of infection by reducing CTL clearance of virus-infected cells. Moreover, the variability of Nef function during chronic infection suggests that it evolves to optimize its balance of different functions to maximize viral persistence in the face of changing selective pressures in vivo (40). Mutational studies of Nef in laboratory strains of HIV-1 have defined key amino acid sites and functional domains involved in downmodulation of MHC-I (reviewed in (26, 47)). However, the sequence of Nef is highly variable in primary isolates of HIV-1. It is likely that Nef can adapt to downregulate MHC-I through altered or distinct motifs depending on its sequence context, as seen in the SIV model (62). However, few studies have addressed the ability of Nef from primary isolates of HIV-1 to downregulate MHC-I (46), and there is almost no information about whether the functional motifs of primary isolates of Nef match those identified by mutagenesis of laboratory adapted strains of HIV-1. To address this issue, we investigated the interplay between the MHC-I downregulatory function of primary isolate quasispecies Nef proteins and sequence evolution under experimentally imposed selective pressure to evade Gag-specific CTLs. This selective pressure caused a clear pattern of purifying selection coincident with the optimization of MHC-I downregulation to allow viral persistence in the presence of CTL selective pressure. Sequence

5 Lewis et al 5 Mapping Nef MHC-I downregulation with Immune Selection analysis of this adaptive evolution identified key amino acid sites important for Nef-mediated immune evasion in primary HIV-1 isolates, demonstrating the close reciprocal relationship between Nef and CTL-mediated immunity in pathogenesis, and suggesting vulnerable regions that could be targeted beneficially by vaccines or pharmacologic blockade. 93

6 Lewis et al 6 Mapping Nef MHC-I downregulation with Immune Selection MATERIALS AND METHODS Isolation of plasma nef quasispecies and insertion into recombinant reporter viruses. The nef gene was amplified from the plasma of 9 chronically HIV-1 infected subjects and cloned into an NL4-3 based reporter virus as previously published (40). Briefly, cdna was made from viral RNA using the gene-specific primer Nef 9589R 5 TAGTTAGCCAGAGAGCTCCCA. Then nef was amplified using the following primers: Nef 9589R 5 TAGTTAGCCAGAGAGCTCCCA, Nef 8670F 5 AATGCCACAGCCATAGCAGTG, Nef 8675F 5 GCAGTAGCTGAGGGGACAGATAGG, Nef 8687F 5 GTAGCTCAAGGGACAGATAGGGTTA, Nef 8736F 5 AGAGCTATTCGCCACATACC. A nested PCR was performed with the following primers: Nef 8787 XbaIF 5 GCTCTAGAATGGGTGGCAAGTGCTCAA and Nef 9495R 5 TTATATGCAGCATCTGAGGGC. Following amplification overhanging A s were added to the ends of the PCR products then cloned in bulk by the TA method into pcr2.1-topo vector (Invitrogen). Ligation mixtures were grown in liquid culture and not subject to individual colony selection on solid media in order to preserve the quasispecies mixture of cloned PCR products. Plasmid DNA was digested with XbaI and BspEI (New England Biolabs) and subsequently subcloned into the nef position of the half-genome construct p83-10 (4). Ten μg of each half genome plasmid, p83-10 with nef and the reporter p83-2-hsaxvpr (4), was digested with EcoRI (New England Biolabs). Both plasmids electroporated into 10 million T1 (174 x CEM.T1) cells (57) using a GenePulser Electroporator (BioRad). Recombinant reporter virus stocks were collected in the supernatant 7-10 days after electroporation. Control viruses carrying the Nef mutant M20A unable to downregulate MHC-I (3) or standard NL4-3 Nef were made in parallel.

7 Lewis et al 7 Mapping Nef MHC-I downregulation with Immune Selection In vitro immune selection. One million T1 (HLA-A*02-positive) lymphocytes (see above) were infected with virus stock containing 12.5 ng of p24. This is equivalent to an MOI of approximately based on previous titers. After infecting for 4 hours at 37 o C cells were washed and split into two wells of 0.5 x 10 6 each. Then either 0.5ml of RPMI supplemented with 10%FCS and 50 units/ml IL-2 (R10-50) or 0.5ml of R10-50 with an HLA-A*02-restricted CTL clone specific for the p17 Gag epitope SL9 was added to the infected cells at an effector to target ratio of 1:4. Culture supernatant was collected on days 5 and 7 post-infection and virus growth was quantified by p24 antigen ELISA. These p24 levels were used to set up a second round of infections again with 12.5ng of p24 and 1 x 10 6 fresh T1 cells, and selection was performed as before with the same CTL clone. The first round virus cultured in the presence of the CTL clone was again cultured with the clone, and as a control for genetic drift the viruses cultured without CTL selection were also cultured again without CTL selection. Again, culture supernatants containing the selected quasispecies were collected on day 5 and 7 post-infection and quantified by p24 ELISA to confirm viral growth. RNA isolation, RT-PCR and nef sequencing. Viral RNA was isolated from either the viral stock (i.e. the input virus) or culture supernatant after 2 rounds of culture with or without the CTL clone. RNA was isolated using the QiaAMP Viral RNA Mini Kit (Qiagen) according to the manufacturer s protocol then used as a template for cdna synthesis using SuperScript III Reverse Transcriptase (Invitrogen) and the gene-specific primer Nef 9589R 5 TAGTTAGCCAGAGAGCTCCCA. The resulting cdna was used as template for nef amplification using the high fidelity polymerase Phusion (New England Biolabs) and the following primers: Nef 8787 XbaIF 5 GCTCTAGAATGGGTGGCAAGTGCTCAA and Nef

8 Lewis et al 8 Mapping Nef MHC-I downregulation with Immune Selection R 5 TTATATGCAGCATCTGAGGGC. PCR reactions were carried out using the following conditions: 5 min. at 98 0 C, 35 cycles of 98 0 C for 10s, 57 0 C for 30s, 72 0 C for 30s, followed by a final extension at 72 0 C for 10 min. A 20 minute incubation at 72 0 C with standard Taq polymerase (New England Biolabs) and dntps added the necessary overhanging A s, and PCR products which were then cloned in bulk by the TA method into pcr2.1-topo vector (Invitrogen). A minimum of 10 nef clones per subject were selected for sequencing using the standard vector primers M13F and M13R and the Big Dye Terminator Reaction Kit 3.1(Applied Biosystems). Cycle sequencing products were run on an ABI3130 Genetic Analyzer (Applied Biosystems). Sequence analysis. Nucleotide sequences were translated into amino acid sequences and manually edited using the program BioEdit then aligned along with NL4-3 and the Los Alamos HIV-1 database Clade B Consensus nef using CLUSTAL X. A neighbor-joining tree was constructed using the DNADist and Neighbor programs of PHYLIP 3.64 (22). The tree was statistically evaluated with 1000 bootstrap replicates. The sequences were then divided into 3 separate populations - input, with CTL, and without CTL selection - for the subsequent analyses. Sequence diversity within the quasispecies swarm and overall divergence from Clade B consensus sequence were determined using the program SENDBS with the Hasegawa model + gamma and standard errors estimated from 500 bootstrap replicates. Change in diversity and divergence was calculated by taking the value for the with CTL population minus the value for the no CTL population. Difference between control and selected sequences were evaluated with a two-tailed t test. Divergent sequences were examined for G to A hypermutation using Hypermut 2.0 from the LANL HIV-1 database tools. Sequences with non-intact reading frames due to frame shift or non-sense mutations were counted and excluded prior to the analysis for

9 Lewis et al 9 Mapping Nef MHC-I downregulation with Immune Selection adaptive evolution. Difference in the number of sequences containing stop codons between control and selected sequences was evaluated by a two-tailed Χ 2 test. All of the following analyses were performed using HyPhy (50). The program MODELTEST (52) was used to determine the best fitting model for the data was HKY85. The global dn/ds ratio along with its 95% confidence intervals were estimated after building and optimizing the maximum likelihood function for each of the three data sets. Individual amino acid positions with evidence of adaptive evolution were identified by three separate methods, ancestor counting (SLAC), relative-effects likelihood (REL), and fixed-effects likelihood (FEL). A site was considered to be adapting under CTL selective pressure if that site was identified by at least 2 of 3 methods with a significance level of at least 95% and was only identified in the dataset with CTL and not in the without CTL dataset. Additionally, only those sites with a dn/ds significantly > and < 1 were considered positive. Selected sites were highlighted on the composite crystal structure of Nef kindly provided by Dr. Art F. Y. Poon (Vancouver, B.C., Canada) using the program RasMol Conservation of the selected sites was determined by compiling an amino acid alignment of all complete, non-recombinant Nef sequences submitted to the LANL HIV-1 Sequence Database through 2010, N=2114 including genotypes A-K. The probability of each amino acid at the selected sites was plotted using WebLogo3 (16). Creation of Nef Mutants by Site-directed Mutagenesis. The 7 sites undergoing purifying selection with no previously known association with Nef function were selected for site-directed mutagenesis. The following 8 mutations were created individually within the NL4-3 based p83-10 plasmid using the appropriate primers and the QuikChange XL-II Kit (Stratagene): N52A, N52S, A84D, Y135F, G140R, S169I, H171A, V180E. The amino acid changes selected were based on mutations observed at these sites in the primary isolates, except H171A. All mutations

10 Lewis et al 10 Mapping Nef MHC-I downregulation with Immune Selection were confirmed by sequencing. Recombinant reporter viruses were created by coelectroporation with p83-2 HSAxvpr as detailed above. Assessment of MHC I downregulation by Nef. Levels of HLA A*02 on the surface of cells infected by Nef recombinant reporter viruses was performed as previously described (40). Briefly, T1 cells were infected with either the input virus stock or the supernatant containing the quasispecies surviving after 2 rounds of CTL selection. All 9 input viruses were tested, and 5 of 9 samples after 2 rounds of culture with CTL yielded adequate samples for testing. Similarly, T1 cells were also infected with the 8 Nef mutants. On day 5 post-infection cells were stained with FITC-anti-murine CD24 (HSA) (BD) to detect reporter positive infected cells and PE-antihuman HLA A*02 (ProImmune). At least 2x10 4 live cells were counted using a FACScan flow cytometer, and data were analyzed using CellQuest software (Becton Dickinson). Maximum levels of HLA A*02 were determined using the Mean Fluorescent Intensity (MFI) of the M20A Nef mutant which is defective in MHC-I downregulation or Delta Nef virus. Percent HLA A*02 down-regulation was calculated using the MFI of M20ANef-infected cells as maximum and the MFI of isotype stained cells as minimum. Infections and flow measurements were repeated at least 3 times, except for the passafed viruses for which only one sample was available. A twotailed t test was used to determine differences between NL4-3 and mutant viruses. Sequence Accession numbers: available upon acceptance of manuscript.

11 Lewis et al 11 Mapping Nef MHC-I downregulation with Immune Selection RESULTS Isolation of in vivo HIV-1 nef quasispecies. As previously described (40), full length nef sequences were isolated from plasma of nine persons with chronic, untreated HIV-1 infection. All subjects had detectable viremia ranging from 400 to >750,000 RNA copies/ml and peripheral blood CD4 + T lymphocyte counts ranging from 0 to 900 cells/mm 3 (data not shown). The bulk nef quasispecies from each subject ( input sequences ) were cloned into a replication-competent NL4-3-based reporter virus for subsequent selection experiments. Genetic evolution of primary nef quasispecies under experimental selection by Gag-specific CTLs. The influence on Nef of immune pressure against HIV-1 was assessed by subjecting the recombinant viruses to experimental selection by HIV-1 Gag-specific CTLs. The recombinant viruses containing primary nef quasispecies were cultured either alone as a control for random genetic drift ( control ), or in combination with CTLs recognizing the Gag epitope SLYNTVATL ( selected ) for two passages of seven days each, followed by clonal nef sequence analysis of the resulting viruses. These control and selected sequences were aligned with the input nef sequences (n=231) to create a neighbor-joining phylogenetic tree that was statistically evaluated with 1000 bootstrap replicates (Figure 1). Sequences from each subject clustered independently (>99% bootstrap support) with the exception of Subjects and 00039, who previously were identified to have related viruses suggesting a common infection source (40). A few highly divergent sequences were observed in the control quasispecies of subjects 00034, 00039, and 00041, although only the sequence from had evidence of G-to-A hypermutation (p=0.02). Generally, however, the persisting nef sequences after immune

12 Lewis et al 12 Mapping Nef MHC-I downregulation with Immune Selection selection were intermingled with the input and control sequences. The CTL-selected sequences formed phylogenetically distinct clusters (bootstrap values >70%) in two of nine subjects (00022 and 00034). In both of these cases these sequences converged towards the Clade B consensus sequence, suggesting evolution towards a more fit sequence. Increased maintenance of the nef reading frame as a result of CTL selection. The nucleotide alignments were translated into amino acid sequences to examine the status of the reading frame (Figure 2A). At baseline, 6.5% (7/107) of input sequences from plasma contained non-sense mutations including both premature stop codons and frame-shift mutations. The control passaged population cultured without CTL exhibited an increase to a non-sense mutations frequency of 14.8% (12/81), consistent with genetic drift in a setting where changes in Nef have little or no fitness cost, i.e. in vitro culture in immortalized T cells (29). In contrast, the CTL-selected quasispecies had a significantly lower than expected non-sense mutation frequency of 4.9% (4/81) (Χ 2 p=0.0351). Overall, the increase in reading frame preservation with CTL selection versus decrease in the absence of CTLs suggest that CTLs exert selective pressure on Nef to increase viral persistence. Reduced diversity of primary nef quasispecies after CTL selection. The change of variability within the nef quasispecies population in response to immune selective pressure was assessed for each subject individually and across all subjects by calculating changes in diversity and divergence from the Clade B consensus sequence in the absence and presence of selection by the Gag-specific CTLs. As mentioned above, the quasispecies from subjects and with immune selection clearly converged on the Clade B consensus sequence (Figure 1). For all other subjects, whether analyzed individually or grouped, there was no significant change in sequence divergence with immune selection (data

13 Lewis et al 13 Mapping Nef MHC-I downregulation with Immune Selection not shown). However, for 4 of 9 subjects there was a significant (t test p<0.05) decrease in the diversity of the quasispecies after CTL selection (Figure 2B and C). The decrease in diversity and the convergence toward the consensus sequence in the presence of CTL suggest that CTL selection places constraints on evolution of the nef reading frame. Global adaptive evolution of nef for viral persistence in the setting of CTL immune selective pressure. The subset of nef sequences with intact reading frames was codon-aligned and used to calculate the ratio of the rate of non-synonymous to synonymous changes (dn/ds) for the entire coding region for each of three sequence groups: input plasma sequences (n= 94), CTL selected sequences (n=71) and control passaged sequences (n= 67) (Figure 3A). The dn/ds ratio of the input plasma nef sequences demonstrated purifying selection at baseline in vivo (dn/ds = 0.59, 95% CI ), similar to previously reported data (39). Control sequences passaged without CTL selection had a similar ratio to the input sequences (dn/ds = 0.61, 95% CI ). However, the CTL-selected nef sequences had significantly greater purifying selection (dn/ds = 0.47, 95% CI ) compared to control sequences as demonstrated by the non-overalpping 95% CIs of the control and selected dn/ds estimates. These results demonstrate that CTLs exerted selective pressure for maintenance of Nef through a functional constraint. Amino acids in Nef undergoing selection lie in important functional domains. To identify key sites within Nef that were undergoing selection, dn/ds ratios were calculated for each codon using ancestor counting (SLAC), relative-effects likelihood (REL), and fixed-effects likelihood (FEL) methods (50). Codons were considered to be under significant selection if they reached p <0.05 by at least two of these three methods for the CTL selection and not the control sequences. Site-by-site analysis identified 13 sites subject to

14 Lewis et al 14 Mapping Nef MHC-I downregulation with Immune Selection purifying selection and 1 site undergoing positive selection (Figure 3B and Table 1). Of these 14 sites, 7 were previously reported to be associated with motifs important for Nef function, of which 5 were linked specifically to MHC-I downregulation (Table 1). The identified sites are located in key domains of Nef (Figure 4A), such as the N-terminal α-helix (E18) and unstructured loops that bind cellular proteins (E62, L164, and D175) (27, 38). Notably, site E62 lies within the EEEE acidic domain and site V74 lies at the φ position within the PxφP motif, and both motifs are known to be required for MHC-I downregulation, although V74 has not been tested specifically for its effect on downregulation independently of the prolines (43, 49, 56, 67). Site D123 is required for dimerization of Nef and therefore all its functions (7, 41, 67), including MHC-I downregulation. Site E18 is the X within the RXR motif important for β-cop binding and necessary for maximal MHC-I downregulation, although previously only the arginines within this motif specifically have been tested (59, 67). Site L164 lies within the dileucine motif required for CD4 downregulation by Nef and is also important for infectivity and replication in PBMCs (15, 26, 54). Sites V74, A83, and D175 lie within motifs implicated in modulation of cell signaling pathways by Nef (20). While site S169 has no previously identified role in Nef function, a recent analysis showed that this site is co-evolving with N157 and therefore likely to have some functional role (51). The remaining six other sites under purifying selection (N52, A84, Y135, G140, H171, and V180) have no previously defined associations with known functions of Nef. CTL selected sites in Nef are highly conserved in primary isolates of all HIV-1 genotypes. To determine whether these selected sites in the cohort tested here are broadly important to Nef in general all complete Nef sequences in the Los Alamos National Laboratory (LANL) HIV-1 Sequence Database were examined for amino acid sequence conservation at these sites.

15 Lewis et al 15 Mapping Nef MHC-I downregulation with Immune Selection A total of 2114 complete, non-recombinant Nef sequences representing genotypes A-K submitted through 2010 were aligned and translated into amino acid sequences. The probability of each amino acid at each of the 13 sites under purifying selection was plotted (Figure 4B). At 11 of the 13 sites there was >90% conservation of the amino acid with only Y135 and S169 showing significant variability. There was virtually 100% conservation of 7 of 13 sites (V74, A84, D123, G140, L164, H171, and D175) of which, A84, G140, and H171 have no previous association with Nef function. By comparison, the LANL Nef sequences were also examined for conservation at other sites previously known to be associated with MHC-I downregulation: R17, R19, M20, E (62-65), P72, P75, and P78 (Figure 4C). There was less conservation of these sites relative to the 13 selected sites, with only the 3 prolines demonstrating near 100% conservation, and R17, R19 and E62 showing >90% conservation (60 vs. 85% showing >90% conservation and 30 vs. 54% with near 100% conservation). There was significant variability at E (63-65) and significant numbers of M20I and M20L isolates of unknown functional significance. These results highlight the amino acid residues of primary Nef isolates that are associated with a survival advantage, confirm previously-identified motifs and suggest novel residues that are important for Nef structure/function in the context of CTL pressure. Functional testing of Nef polymorphisms at CTL selected sites. In order to determine whether any of the newly identified sites under purifying selection affected Nef s ability to downregulate MHC-I a panel of mutants was created. Site-directed mutagenesis of NL4-3 Nef was used to incorporate the following polymorphisms, all observed in one or more of the primary plasma sequences and removed by CTL purifying selection (except H171A): N52A, N52S, A84D, Y135F, G140R, S169I, H171A, and V180E. Cells infected with recombinant reporter viruses with these Nef polymorphisms were assessed for levels of MHC-I

16 Lewis et al 16 Mapping Nef MHC-I downregulation with Immune Selection downregulation compared to control viruses (Figure 5). Six of 8 mutants had significant reductions in MHC-I downregulation compared to wild type NL4-3 Nef (Figure 5A). Nef with G140R had complete loss of function, and Nef with A84D had a phenotype comparable to Nef with M20A, a mutant known to be deficient in MHC-I downregulation (3) (Figure 5A and B). Nef with Y135F had an intermediate phenotype, about 50% the function of NL4-3 Nef, while Nef with N52A, S169I, or V180E had significant although more modest reductions to approximately 80% the level of NL4-3 Nef. Polymorphisms N52S and H171A had no affect on Nef function. These data show that the Nef polymorphisms removed from the quasispecies by CTL purifying selection are associated with deficiencies in MHC-I downregulation. Gag-specific CTLs select for MHC-I downregulatory function within primary Nef quasispecies. Because Nef-mediated downregulation of MHC-I is known to reduce the susceptibility of HIV-1-infected cells to CTLs, the primary nef quasispecies were tested for this function both before and after selection with the Gag-specific CTLs (Figure 6). Cells infected with recombinant reporter viruses carrying the nef quasispecies were assessed for MHC-I downregulation in comparison to viruses containing NL4-3 Nef ( wild type ) and M20A Nef (Figure 6A). Infection with virus carrying NL4-3 Nef downregulated A*02 by about 80%, and this level of function was unchanged after after passaging this virus in the presence of CTLs. Similarly, virus with nef quasispecies from Subject was functional at baseline and after selection. However, Subjects and had Nef quasispecies with partial function at baseline, which increased to full function after selection. Most strikingly, Nef from Subjects and (both with late stage untreated AIDS and minimal CTL responses in vivo) had no ability to downregulate MHC-I at baseline, but CTL pressure selected functional populations

17 Lewis et al 17 Mapping Nef MHC-I downregulation with Immune Selection of Nef (Figure 5B). Except for subject 00021, the baseline plasma quasispecies of all subjects had amino acid polymorphisms at the sites identified in this analysis that would predict impaired function, and viruses with these polymorphisms were not present after selection (Table II). Quasispecies sequences were also examined for mutations at other sites previously known to be important for Nef MHC-I downregulation since these would also likely impair baseline function (Table II). Although we were not able to test selected viruses from all subjects, we previously reported partial impairment of Nef-mediated MHC-I downregulation by the baseline plasma Nef quasispecies of all subjects included in this study, with the exception of subject 21 (40). Thus the presence of these mutations was associated with impaired function of the quasispecies, while reconstitution of function was associated with loss of these polymorphisms from the quasispecies. These data indicate that the sites identified by CTL selection play an important role in Nef-mediated MHC-I downregulation and consequent immune evasion and provide a functional context for the sequence evolution of nef under CTL selection in vivo.

18 Lewis et al 18 Mapping Nef MHC-I downregulation with Immune Selection DISCUSSION Human and animal model data suggest that Nef-mediated MHC-I downregulation plays a key role in pathogenesis through promoting viral persistence in the presence of a vigorous CTL response. We previously reported an in vivo correlation between the breadth of the HIV-1- specific CTL response and the capacity of circulating Nef quasispecies to downregulate MHC-I (40). Furthermore, it has been demonstrated with a laboratory strain of HIV-1 that CTLs exert selective pressure to maintain functional Nef (3, 5). The preservation of Nef-mediated MHC-I downregulation in the presence of CTL and its loss in the absence of strong CTL selection is also consistent with the observation of predominately defective Nef in neonates (25, 65) and persons with late stage AIDS and strong pressure to maintain Nef-mediated MHC-I downregulation in SIV-infected macaques (11, 33, 62). Here we demonstrate a selective advantage for primary in vivo Nef quasispecies that can downregulate MHC-I that correlates with the presence of both known and novel amino acid residues important for this function. Examination of nef quasispecies sequence evolution across subjects due to immune selection by Gag-specific CTLs pinpointed 13 sites where key amino acid residues are involved in the optimization of Nef-mediated immune. Examination of more than 2000 Nef sequences in the LANL HIV-1 Database revealed >90% conservation of the amino acid sequence at 11 of these 13 selected sites, with near 100% conservation at 7 sites. This analysis also confirmed several sites that were identified previously through point mutagenesis studies of laboratory adapted HIV-1 nef sequences to be involved in multiple Nef functions. These included residues in the motifs important for dimerization (41), MHC-I downregulation (43, 49, 67), trafficking via Adaptor Proteins and β-cop binding (59, 67), and enhancement of viral replication through cell signaling (20).

19 Lewis et al 19 Mapping Nef MHC-I downregulation with Immune Selection Additionally, 7 amino acid sites were identified as experiencing strong purifying selection by CTL pressure and previously had no known role in Nef function. Mutations at 6 of these sites, reflecting polymorphisms in vivo, resulted in significant impairment of Nef-mediated MHC-I downregulation. Two sites in particular, A84 and G140, were both virtually 100% conserved across all genotypes and resulted in complete or near complete loss of MHC-I downregulation when mutated. Although H171 was similarly 100% conserved, mutation at this site to an alanine had no affect on this Nef function. However, H171A was not among the observed polymorphisms at this site in vivo (i.e.- H171 N, P, and G), and perhaps testing these may yield a different result. The MHC-I downregulation function by Nef with N52A, S169I, and V180E was only modestly affected suggesting either that these mutations may work cooperatively with other mutations to have a more crippling effect, or that they represent tradeoffs to optimize other Nef functions. A recent analysis has shown that site S169 co-evolves with N157 (51), perhaps hinting that these sites may contribute to Nef function cooperatively. The exact mechanism whereby these mutations affect Nef function, how they interact with other sites, and whether they affect other Nef functions such as CD4 downregulation are not known but are currently being investigated. It is also important to note that the 3 portion of nef overlaps with the U3 region of the 3 LTR, and consequently this region is potentially subject to additional LTR-related constraints (36). However, the critical domains including binding sites for NF- κb and Sp1, and the TATAA box are all downstream of the region of nef overlap. Five selected sites with no previously identified Nef function (Y135, G140, S169, H171, V180) lie within this overlapping LTR region. Although it is possible that these sites may be under strong purifying selection due to an LTR-associated function, the sites we identified were specific for CTL selection (i.e. not

20 Lewis et al 20 Mapping Nef MHC-I downregulation with Immune Selection identified in both selected and control sequences), and Nef polymorphisms at 4 of these sites had significant impairment of MHC-I downregulation making selection due to an LTR function alone unlikely. The important functional role played by these selected sites is clearly demonstrated by the reconstitution of MHC-I downregulation after CTL-mediated purifying selection by removed these mutants from the quasispecies population. Except for subject Nef, which functioned at wild-type levels at baseline, plasma quasispecies of all subjects contained amino acid polymorphisms at the sites of purifying selection that would predict impaired function that subsequently were not present after selection. The most dramatic examples of functional reconstitution were the plasma Nefs of Subjects and 00037, who had late stage AIDS and minimal or undetectable HIV-1-specific CTL responses ((40) and data not shown), consistent with prior reports of loss of MHC-I downregulation in vivo in the absence of any CTL selective pressure in persons with AIDS (11, 33). Experimental selection by Gag-specific CTLs enriched for nef alleles with the capacity to downregulate MHC-I, suggesting a strong selective advantage for reconstituting this function of Nef in the presence of an active CTL response. The distinct phylogenetic clustering of CTL-selected nef genes from Subject indicated overgrowth from a small subset of clones from within the baseline quasispecies population, and the convergence of these sequences (as well as those of Subject 00034) towards the clade B consensus sequence indicated evolution towards the most generally optimal sequence. While MHC-I downregulation is likely to be the main mechanism by which Nef promotes HIV-1 survival under selection by CTLs, it is important to note that Nef is a polyfunctional protein with numerous effects on infected cells, including CD4 downregulation and cellular activation. Our data do not exclude other functions that may be important for viral

21 Lewis et al 21 Mapping Nef MHC-I downregulation with Immune Selection persistence in the face of CTL pressure. Some functions are likely to be separable due to distinct locations of important functional residues, while others may be inter-related (43). Several of the functionally important areas identified here and in other studies, such as the acidic domain, PxφP motif, and dileucine motif, lie in unstructured flexible loops of the protein (23, 38). This may allow Nef to have functional flexibility to evolve and optimize different functions or combinations of functions in response to different environmental constraints. It is unexpected to see that L164 of the dileucine motif critical for CD4 downregulation by Nef was identified as a residue under strong purifying selection for viral persistence under CTL pressure. It may be that the function of this motif to bind Adaptor Proteins is important for both MHC-I and CD4 downregulation, but more essential for the latter. It is also possible that other functions associated with this amino acid residue such as enhancement of infectivity and replication may have played a role is its selection under CTL pressure. Because Nef is an attractive target for pharmacologic or immunologic inhibition in vivo, examining primary isolate Nef proteins for crucial functional sites that could serve as therapeutic targets is important. Mathematical modeling has predicted that blocking MHC-I downregulation by Nef has the potential to decrease viremia in chronically infected individuals by up to 2.4 logs by reducing Nef-mediated evasion of CTLs (66), and thus inhibition of this function of Nef could be an effective therapeutic approach. Small molecule inhibitors of Nef have been considered for this purpose (53, 55). Alternatively, an appropriately directed vaccine response could achieve this goal by putting immune pressure directly on Nef (3). Of note, two of the six vaccineinduced epitopes that predicted efficacy of vaccination in reducing set-point viremia in the HVTN 502 (STEP) trial were the Nef epitopes B*57-restricted HW9 (HTQGYFPDW, Nef ) and A*02-restricted LV10 (LTFGWCFKLV, Nef ) (10). These epitopes contain

22 Lewis et al 22 Mapping Nef MHC-I downregulation with Immune Selection the D123 and G140 sites we identified to be under selective pressure. While D123 is known to be important for Nef dimerization and both CD4 and MHC-I downregulation (41), G140 was not previously known to have an important functional role but now we demonstrate that mutation at this site critically impairs MHC-I downregulation. Thus, examining primary isolate sequences may be important for identifying sites in Nef that are most relevant for its role in immune evasion, and for which pharmacologic or immunologic targeting may be most effective due to strict functional constraints. Prior reports have demonstrated that direct CTL targeting of Nef yields positive selective pressure that leads to loss of function (5, 35, 64, 69), complementing our finding of purifying selection and reconstitution of Nef function in the setting of CTLs targeting Gag and not Nef directly. While the evolution of Nef and other HIV-1 proteins in vivo appears to be dominated overall by purifying selection reflecting strong functional constraints (39), there is clear positive selective pressure exerted by direct CTL targeting of Nef. This has been demonstrated experimentally; in vitro selection of laboratory adapted HIV-1 strains with Nef-specific CTL clones resulted in a dramatic pattern of point mutations, deletions, and non-sense mutations due to lack of fitness cost for Nef deletion in vitro (6, 69). Subsequently, these selected laboratory strain viruses deficient in functional Nef were demonstrated to become more susceptible to non- Nef-specific CTLs (6, 64). It was further shown that simultaneous addition of Gag-specific CTLs placed a functional constraint on viral escape from Nef-specific CTLs by Nef mutation (5). Our data confirm and extend these findings with more relevant primary isolate Nef alleles, and suggest that these principles may apply for therapeutic interventions in vivo. In summary, these results highlight the close reciprocal relationship between the host CTL immune response and Nef function. Nef quasispecies under CTL selection display a pattern

23 Lewis et al 23 Mapping Nef MHC-I downregulation with Immune Selection of strong purifying selection associated with optimization of MHC-I downregulation. Studying circulating primary isolate Nef alleles revealed novel amino acid residues that are directly important for HIV-1 persistence under immune pressure by the host CTL response. Better defining functional sites within circulating plasma Nef quasispecies will be useful for the design of pharmacologic or immunotherapeutic agents targeting functionally crucial regions of Nef capable of disabling its ability to direct immune evasion. Downloaded from on June 30, 2018 by guest

24 Lewis et al 24 Mapping Nef MHC-I downregulation with Immune Selection 479 ACKNOWLEDGMENTS This work was supported by NIH AI (MJL), AI (MJL), and AI (OOY). Interleukin-2 was provided by the NIH AIDS Reagent Repository. We wish to thank Ms. Mabel Ching Yee Chan for her technical assistance Downloaded from on June 30, 2018 by guest

25 Lewis et al 25 Mapping Nef MHC-I downregulation with Immune Selection REFERENCES 1. Adnan, S., A. Balamurugan, A. Trocha, M. S. Bennett, H. L. Ng, A. Ali, C. Brander, and O. O. Yang Nef interference with HIV-1-specific CTL antiviral activity is epitope specific. Blood 108: Ahmad, N., and S. Venkatesan Nef protein of HIV-1 is a transcriptional repressor of HIV-1 LTR. Science 241: Akari, H., S. Arold, T. Fukumori, T. Okazaki, K. Strebel, and A. Adachi Nefinduced major histocompatibility complex class I down-regulation is functionally dissociated from its virion incorporation, enhancement of viral infectivity, and CD4 down-regulation. J Virol 74: Ali, A., B. D. Jamieson, and O. O. Yang Half-genome human immunodeficiency virus type 1 constructs for rapid production of reporter viruses. J Virol Methods 110: Ali, A., H. L. Ng, M. D. Dagarag, and O. O. Yang Evasion of cytotoxic T lymphocytes is a functional constraint maintaining HIV-1 Nef expression. Eur J Immunol 35: Ali, A., S. Pillai, H. Ng, R. Lubong, D. D. Richman, B. D. Jamieson, Y. Ding, M. J. McElrath, J. C. Guatelli, and O. O. Yang Broadly increased sensitivity to cytotoxic T lymphocytes resulting from Nef epitope escape mutations. J Immunol 171: Arold, S., F. Hoh, S. Domergue, C. Birck, M. A. Delsuc, M. Jullien, and C. Dumas Characterization and molecular basis of the oligomeric structure of HIV-1 nef protein. Protein Sci 9:

26 Lewis et al 26 Mapping Nef MHC-I downregulation with Immune Selection Baur, A. S., E. T. Sawai, P. Dazin, W. J. Fantl, C. Cheng-Mayer, and B. M. Peterlin HIV-1 Nef leads to inhibition or activation of T cells depending on its intracellular localization. Immunity 1: Bodeus, M., A. Marie-Cardine, C. Bougeret, F. Ramos-Morales, and R. Benarous In vitro binding and phosphorylation of human immunodeficiency virus type 1 Nef protein by serine/threonine protein kinase. J Gen Virol 76: Brumme, Z. L., M. John, J. M. Carlson, C. J. Brumme, D. Chan, M. A. Brockman, L. C. Swenson, I. Tao, S. Szeto, P. Rosato, J. Sela, C. M. Kadie, N. Frahm, C. Brander, D. W. Haas, S. A. Riddler, R. Haubrich, B. D. Walker, P. R. Harrigan, D. Heckerman, and S. Mallal HLA-associated immune escape pathways in HIV-1 subtype B Gag, Pol and Nef proteins. PLoS One 4:e Carl, S., T. C. Greenough, M. Krumbiegel, M. Greenberg, J. Skowronski, J. L. Sullivan, and F. Kirchhoff Modulation of different human immunodeficiency virus type 1 Nef functions during progression to AIDS. J Virol 75: Cohen, G. B., R. T. Gandhi, D. M. Davis, O. Mandelboim, B. K. Chen, J. L. Strominger, and D. Baltimore The selective downregulation of class I major histocompatibility complex proteins by HIV-1 protects HIV-infected cells from NK cells. Immunity 10: Collins, K. L., B. K. Chen, S. A. Kalams, B. D. Walker, and D. Baltimore HIV-1 Nef protein protects infected primary cells against killing by cytotoxic T lymphocytes. Nature 391: Couillin, I., B. Culmann-Penciolelli, E. Gomard, J. Choppin, J. P. Levy, J. G. Guillet, and S. Saragosti Impaired cytotoxic T lymphocyte recognition due to

27 Lewis et al 27 Mapping Nef MHC-I downregulation with Immune Selection genetic variations in the main immunogenic region of the human immunodeficiency virus 1 NEF protein. J Exp Med 180: Craig, H. M., M. W. Pandori, and J. C. Guatelli Interaction of HIV-1 Nef with the cellular dileucine-based sorting pathway is required for CD4 down-regulation and optimal viral infectivity. Proc Natl Acad Sci U S A 95: Crooks, G. E., G. Hon, J. M. Chandonia, and S. E. Brenner WebLogo: a sequence logo generator. Genome Res 14: Daniel, M. D., F. Kirchhoff, S. C. Czajak, P. K. Sehgal, and R. C. Desrosiers Protective effects of a live attenuated SIV vaccine with a deletion in the nef gene. Science 258: Deacon, N. J., A. Tsykin, A. Solomon, K. Smith, M. Ludford-Menting, D. J. Hooker, D. A. McPhee, A. L. Greenway, A. Ellett, C. Chatfield, V. A. Lawson, S. Crowe, A. Maerz, S. Sonza, J. Learmont, J. S. Sullivan, A. Cunningham, D. Dwyer, D. Dowton, and J. Mills Genomic structure of an attenuated quasi species of HIV-1 from a blood transfusion donor and recipients. Science 270: Dyer, W. B., A. F. Geczy, S. J. Kent, L. B. McIntyre, S. A. Blasdall, J. C. Learmont, and J. S. Sullivan Lymphoproliferative immune function in the Sydney Blood Bank Cohort, infected with natural nef/long terminal repeat mutants, and in other longterm survivors of transfusion-acquired HIV-1 infection. Aids 11: Erdtmann, L., K. Janvier, G. Raposo, H. M. Craig, P. Benaroch, C. Berlioz-Torrent, J. C. Guatelli, R. Benarous, and S. Benichou Two independent regions of HIV-1 Nef are required for connection with the endocytic pathway through binding to the mu 1 chain of AP1 complex. Traffic 1:

28 Lewis et al 28 Mapping Nef MHC-I downregulation with Immune Selection Fackler, O. T., and A. S. Baur Live and let die: Nef functions beyond HIV replication. Immunity 16: Felsenstein, J PHYLIP-Phylogeny Inference Package (Version 3.2). Cladistics 5: Franken, P., S. Arold, A. Padilla, M. Bodeus, F. Hoh, M. P. Strub, M. Boyer, M. Jullien, R. Benarous, and C. Dumas HIV-1 Nef protein: purification, crystallizations, and preliminary X-ray diffraction studies. Protein Sci 6: Garcia, J. V., and A. D. Miller Serine phosphorylation-independent downregulation of cell-surface CD4 by nef. Nature 350: Geffin, R., D. Wolf, R. Muller, M. D. Hill, E. Stellwag, M. Freitag, G. Sass, G. B. Scott, and A. S. Baur Functional and structural defects in HIV type 1 nef genes derived from pediatric long-term survivors. AIDS Res Hum Retroviruses 16: Geyer, M., O. T. Fackler, and B. M. Peterlin Structure--function relationships in HIV-1 Nef. EMBO Rep 2: Geyer, M., C. E. Munte, J. Schorr, R. Kellner, and H. R. Kalbitzer Structure of the anchor-domain of myristoylated and non-myristoylated HIV-1 Nef protein. J Mol Biol 289: Geyer, M., H. Yu, R. Mandic, T. Linnemann, Y. H. Zheng, O. T. Fackler, and B. M. Peterlin Subunit H of the V-ATPase binds to the medium chain of adaptor protein complex 2 and connects Nef to the endocytic machinery. J Biol Chem 277: Gibbs, J. S., D. A. Regier, and R. C. Desrosiers Construction and in vitro properties of HIV-1 mutants with deletions in "nonessential" genes. AIDS Res Hum Retroviruses 10: